Starting /dee2/code/volunteer_pipeline.sh SRR5986244 current disk space = 3088139198464 free memory = 1429255608 SRR5986244 SRAfilesize 8c1c33a3c69868ba8ed4b8d87b4af52b SRR5986244.sra SRR5986244.sra file validated SRR5986244 is paired end SRR5986244 is conventional basespace SRR5986244 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986244_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.11625 32.0 27.0 32.0 2.0 32.0 2 31.43625 32.0 32.0 32.0 32.0 32.0 3 33.18 32.0 32.0 37.0 27.0 37.0 4 35.305 37.0 37.0 37.0 32.0 37.0 5 35.955 37.0 37.0 37.0 32.0 37.0 6 39.33425 41.0 41.0 41.0 37.0 41.0 7 39.103 41.0 37.0 41.0 37.0 41.0 8 39.50875 41.0 41.0 41.0 37.0 41.0 9 39.6795 41.0 41.0 41.0 37.0 41.0 10-14 39.37055 41.0 41.0 41.0 37.0 41.0 15-19 39.4649 41.0 41.0 41.0 37.0 41.0 20-24 39.55785 41.0 41.0 41.0 37.0 41.0 25-29 38.83845 41.0 39.4 41.0 35.0 41.0 30-34 38.968650000000004 41.0 39.4 41.0 35.0 41.0 35-39 38.5139 41.0 39.4 41.0 33.0 41.0 40-44 38.41855 41.0 38.6 41.0 33.0 41.0 45-49 37.56869999999999 41.0 37.0 41.0 29.0 41.0 50-54 36.816449999999996 41.0 37.0 41.0 25.0 41.0 55-59 37.08045 41.0 37.0 41.0 26.0 41.0 60-64 37.26535 41.0 36.0 41.0 28.0 41.0 65-69 36.060500000000005 40.2 36.0 41.0 23.0 41.0 70-74 37.73255 41.0 37.0 41.0 30.0 41.0 75-79 37.5082 41.0 37.0 41.0 29.0 41.0 80-84 34.90735 39.4 33.0 41.0 18.0 41.0 85-89 35.951350000000005 41.0 35.0 41.0 22.0 41.0 90-94 36.9128 41.0 37.0 41.0 27.0 41.0 95-99 35.73074999999999 40.2 33.0 41.0 24.0 41.0 100-104 32.17145000000001 36.8 25.0 41.0 14.0 41.0 105-109 34.16045 39.4 30.0 41.0 18.0 41.0 110-114 34.19095 38.6 30.0 41.0 18.0 41.0 115-119 35.6784 40.2 34.0 41.0 23.0 41.0 120-124 32.611200000000004 37.8 26.0 41.0 15.0 41.0 125-129 32.09815 36.0 26.0 41.0 12.0 41.0 130-134 31.597299999999997 36.0 25.0 40.2 12.0 41.0 135-139 33.1262 37.0 30.0 41.0 12.0 41.0 140-144 28.463549999999998 31.0 21.0 37.6 12.0 41.0 145-149 31.6787 36.0 26.0 41.0 12.0 41.0 150 31.80375 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 5.0 22 10.0 23 26.0 24 36.0 25 52.0 26 41.0 27 78.0 28 113.0 29 119.0 30 136.0 31 159.0 32 184.0 33 235.0 34 202.0 35 294.0 36 340.0 37 361.0 38 461.0 39 617.0 40 527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.236021007105343 18.999073215940683 18.010503552672226 34.75440222428175 2 25.8 25.55 34.55 14.099999999999998 3 21.26220886551465 30.202854996243428 28.625093914350114 19.90984222389181 4 22.875 35.449999999999996 21.0 20.674999999999997 5 23.25 37.125 21.9 17.724999999999998 6 15.725 38.0 23.925 22.35 7 16.5 16.475 43.025000000000006 24.0 8 18.45 22.85 28.875 29.825000000000003 9 20.25 22.900000000000002 29.725 27.125 10-14 20.59 30.490000000000002 26.68 22.24 15-19 21.46 27.99 27.99 22.56 20-24 21.240000000000002 28.79 27.515 22.455 25-29 20.39 29.24 27.884999999999998 22.485 30-34 21.115000000000002 29.005 28.205000000000002 21.675 35-39 20.880000000000003 29.075 27.875 22.17 40-44 21.759999999999998 28.305000000000003 27.865000000000002 22.07 45-49 21.185000000000002 28.49 28.139999999999997 22.185 50-54 21.6 29.005 27.325 22.07 55-59 21.765 29.25 27.18 21.805 60-64 21.97 28.810000000000002 27.27 21.95 65-69 21.884999999999998 28.435 28.22 21.46 70-74 21.105 28.345 28.22 22.33 75-79 21.265 28.455000000000002 27.825 22.455 80-84 21.38 28.57 28.03 22.02 85-89 21.65 28.544999999999998 27.91 21.895 90-94 21.560000000000002 28.51 27.85 22.08 95-99 21.48 28.08 28.625 21.815 100-104 21.884999999999998 28.854999999999997 28.189999999999998 21.07 105-109 22.0 28.825 27.72 21.455 110-114 21.57 28.435 28.53 21.465 115-119 21.815 28.15 28.59 21.445 120-124 21.154999999999998 28.294999999999998 28.79 21.759999999999998 125-129 21.375 28.12 28.849999999999998 21.654999999999998 130-134 21.645 28.244999999999997 28.599999999999998 21.51 135-139 22.145 27.779999999999998 27.889999999999997 22.185 140-144 22.09 28.54 28.62 20.75 145-149 22.355 28.185 27.785 21.675 150 22.1 29.299999999999997 26.974999999999998 21.625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 2.0 24 2.0 25 4.5 26 9.0 27 12.0 28 13.5 29 18.5 30 25.5 31 36.0 32 42.0 33 61.5 34 80.0 35 87.5 36 110.0 37 122.5 38 145.5 39 165.5 40 196.5 41 230.5 42 248.0 43 260.0 44 248.5 45 263.0 46 242.0 47 216.5 48 221.5 49 183.5 50 148.5 51 124.0 52 107.0 53 88.0 54 58.0 55 49.5 56 49.0 57 37.5 58 23.0 59 15.0 60 13.0 61 9.0 62 4.0 63 3.5 64 3.5 65 2.0 66 2.0 67 2.0 68 2.0 69 1.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 19.075 2 0.0 3 0.17500000000000002 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.675 #Duplication Level Percentage of deduplicated Percentage of total 1 94.53393187219436 89.5 2 5.30763137047795 10.05 3 0.15843675732770002 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2125 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.32499999999999996 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.5625 0.0 0.0 0.0 0.0 110-111 0.65 0.0 0.0 0.0 0.0 112-113 0.7625 0.0 0.0 0.0 0.0 114-115 0.85 0.0 0.0 0.0 0.0 116-117 0.95 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2000000000000002 0.0 0.0 0.0 0.0 122-123 1.3375 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.6 0.0 0.0 0.0 0.0 128-129 1.8625 0.0 0.0 0.0 0.0 130-131 2.0125 0.0 0.0 0.0 0.0 132-133 2.2249999999999996 0.0 0.0 0.0 0.0 134-135 2.4375 0.0 0.0 0.0 0.0 136-137 2.675 0.0 0.0 0.0 0.0 138 2.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTGACA 10 0.0037292608 177.0 1 AAATATG 10 0.0070008645 143.8125 2 >>END_MODULE SRR5986244 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986244_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.60875 32.0 12.0 32.0 2.0 32.0 2 31.01625 32.0 32.0 32.0 32.0 32.0 3 32.16875 32.0 32.0 37.0 27.0 37.0 4 34.81375 37.0 32.0 37.0 32.0 37.0 5 35.67375 37.0 37.0 37.0 32.0 37.0 6 39.07575 41.0 37.0 41.0 37.0 41.0 7 33.742 37.0 32.0 41.0 12.0 41.0 8 38.12275 41.0 37.0 41.0 32.0 41.0 9 35.66875 41.0 32.0 41.0 22.0 41.0 10-14 36.974199999999996 41.0 36.0 41.0 25.0 41.0 15-19 34.7101 39.4 32.0 41.0 22.0 41.0 20-24 35.70484999999999 39.4 33.0 41.0 23.0 41.0 25-29 35.43105 40.2 33.0 41.0 21.0 41.0 30-34 30.589050000000004 34.8 22.0 40.2 14.0 41.0 35-39 34.47345 39.2 31.0 41.0 20.0 41.0 40-44 29.740049999999997 32.8 22.0 37.6 15.0 40.2 45-49 31.46555 35.8 24.0 40.2 12.0 41.0 50-54 32.68115 37.8 27.0 41.0 17.0 41.0 55-59 30.36295 35.0 19.0 41.0 14.0 41.0 60-64 29.8036 33.0 19.0 40.2 14.0 41.0 65-69 27.59235 27.0 18.0 38.4 12.0 40.2 70-74 28.2524 30.0 19.0 38.4 12.0 41.0 75-79 31.16365 35.0 21.0 41.0 14.0 41.0 80-84 28.6278 32.0 19.0 39.2 12.0 41.0 85-89 29.983600000000003 34.0 20.0 40.2 12.0 41.0 90-94 25.38555 25.0 14.0 35.0 12.0 40.2 95-99 24.9745 24.0 14.0 36.0 12.0 41.0 100-104 24.314700000000002 23.0 12.0 36.0 12.0 40.2 105-109 25.295800000000003 26.0 14.0 35.0 12.0 40.2 110-114 26.302550000000004 28.0 16.0 35.0 12.0 41.0 115-119 25.18765 26.0 12.0 36.0 12.0 41.0 120-124 23.68515 22.0 12.0 33.0 12.0 40.2 125-129 22.540250000000004 21.0 12.0 30.0 12.0 37.0 130-134 21.9785 19.0 12.0 31.0 12.0 38.6 135-139 21.615199999999998 20.0 12.0 30.0 12.0 37.0 140-144 21.94675 20.0 12.0 31.0 12.0 37.0 145-149 19.455099999999998 16.0 12.0 26.0 12.0 35.0 150 19.24475 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 7.0 16 41.0 17 72.0 18 144.0 19 155.0 20 146.0 21 171.0 22 192.0 23 191.0 24 170.0 25 166.0 26 164.0 27 199.0 28 169.0 29 221.0 30 214.0 31 203.0 32 233.0 33 235.0 34 210.0 35 212.0 36 219.0 37 152.0 38 80.0 39 32.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.69083359948898 20.121366975407216 20.76014053018205 31.427658894921752 2 23.974999999999998 27.025 34.849999999999994 14.149999999999999 3 20.95 31.35 27.500000000000004 20.200000000000003 4 22.475 35.375 21.5 20.65 5 20.3 38.95 22.2 18.55 6 15.525 38.675 24.325 21.475 7 16.3 17.025000000000002 44.025 22.650000000000002 8 18.675 22.575 28.675 30.075000000000003 9 20.025000000000002 23.025000000000002 30.65 26.3 10-14 20.935000000000002 29.775000000000002 27.235 22.055 15-19 21.815 28.34 28.13 21.715 20-24 21.790000000000003 29.26 27.750000000000004 21.2 25-29 21.615000000000002 29.349999999999998 27.72 21.315 30-34 22.13 29.659999999999997 28.38 19.830000000000002 35-39 21.715 29.565 28.22 20.5 40-44 23.03 30.29 29.160000000000004 17.52 45-49 22.475 29.154999999999998 28.549999999999997 19.82 50-54 22.43 28.405 28.634999999999998 20.53 55-59 22.795 29.535 28.74 18.93 60-64 22.515 29.78 28.9 18.805 65-69 23.085 29.580000000000002 28.910000000000004 18.425 70-74 23.674999999999997 29.625 28.660000000000004 18.04 75-79 22.81 27.894999999999996 29.205 20.09 80-84 21.525 29.475 30.915 18.085 85-89 22.365 28.549999999999997 29.409999999999997 19.675 90-94 22.35 29.720000000000002 31.509999999999998 16.42 95-99 22.975 30.025000000000002 30.165 16.835 100-104 23.51 29.304999999999996 30.4 16.785 105-109 22.235 29.28 31.014999999999997 17.47 110-114 23.14 29.04 28.720000000000002 19.1 115-119 22.66 28.410000000000004 30.099999999999998 18.83 120-124 23.21 28.79 30.520000000000003 17.48 125-129 23.43 28.349999999999998 30.049999999999997 18.17 130-134 23.175 28.475 30.97 17.380000000000003 135-139 23.395 28.610000000000003 31.514999999999997 16.48 140-144 23.544999999999998 29.025000000000002 29.715000000000003 17.715 145-149 24.490000000000002 28.535 31.415 15.559999999999999 150 24.2 28.575 31.474999999999998 15.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 0.0 20 1.0 21 3.0 22 3.5 23 7.5 24 11.5 25 11.5 26 15.0 27 16.0 28 19.5 29 25.5 30 44.0 31 67.0 32 74.5 33 85.0 34 103.5 35 128.5 36 151.5 37 176.5 38 185.5 39 207.5 40 235.0 41 232.5 42 230.0 43 248.5 44 252.0 45 230.0 46 202.5 47 169.0 48 158.0 49 145.5 50 125.5 51 103.5 52 76.0 53 60.0 54 45.5 55 34.5 56 24.0 57 16.0 58 15.5 59 13.0 60 10.0 61 6.5 62 8.0 63 7.0 64 3.5 65 2.0 66 1.5 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11727616645649 98.25 2 0.8827238335435058 1.7500000000000002 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5249999999999999 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.675 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.875 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.1875 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.675 0.0 0.0 0.0 0.0 134-135 1.7875 0.0 0.0 0.0 0.0 136-137 1.975 0.0 0.0 0.0 0.0 138 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTGCAC 10 0.0070045046 143.7875 5 >>END_MODULE Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101665 spots for SRR5986244.sra Written 1101665 spots for SRR5986244.sra Read 1101666 spots for SRR5986244.sra Written 1101666 spots for SRR5986244.sra SRR ids: ['SRR5986244.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fpf84m65 SRR5986244.sra spots: 22033301 blocks: [[1, 1101665], [1101666, 2203330], [2203331, 3304995], [3304996, 4406660], [4406661, 5508325], [5508326, 6609990], [6609991, 7711655], [7711656, 8813320], [8813321, 9914985], [9914986, 11016650], [11016651, 12118315], [12118316, 13219980], [13219981, 14321645], [14321646, 15423310], [15423311, 16524975], [16524976, 17626640], [17626641, 18728305], [18728306, 19829970], [19829971, 20931635], [20931636, 22033301]] SRR5986244 file size 7401628 SRR5986244 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986244 SRR5986244_1.fastq SRR5986244_2.fastq Input file: SRR5986244_1.fastq Paired file: SRR5986244_2.fastq trimmed: SRR5986244-trimmed-pair1.fastq, SRR5986244-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:23:12 2025 >> started Fri Feb 14 03:23:39 2025 >> done (26.277s) 22033301 read pairs processed; of these: 261 ( 0.00%) short read pairs filtered out after trimming by size control 529 ( 0.00%) empty read pairs filtered out after trimming by size control 22032511 (100.00%) read pairs available; of these: 2672101 (12.13%) trimmed read pairs available after processing 19360410 (87.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 22 0.00% 20 30 0.00% 21 38 0.00% 22 37 0.00% 23 49 0.00% 24 54 0.00% 25 45 0.00% 26 47 0.00% 27 54 0.00% 28 48 0.00% 29 66 0.00% 30 68 0.00% 31 54 0.00% 32 43 0.00% 33 59 0.00% 34 62 0.00% 35 39 0.00% 36 61 0.00% 37 62 0.00% 38 53 0.00% 39 45 0.00% 40 45 0.00% 41 58 0.00% 42 60 0.00% 43 62 0.00% 44 48 0.00% 45 56 0.00% 46 60 0.00% 47 75 0.00% 48 72 0.00% 49 78 0.00% 50 52 0.00% 51 85 0.00% 52 97 0.00% 53 96 0.00% 54 85 0.00% 55 106 0.00% 56 89 0.00% 57 123 0.00% 58 142 0.00% 59 129 0.00% 60 145 0.00% 61 175 0.00% 62 192 0.00% 63 195 0.00% 64 234 0.00% 65 202 0.00% 66 238 0.00% 67 291 0.00% 68 323 0.00% 69 317 0.00% 70 390 0.00% 71 406 0.00% 72 447 0.00% 73 498 0.00% 74 528 0.00% 75 622 0.00% 76 649 0.00% 77 688 0.00% 78 774 0.00% 79 796 0.00% 80 946 0.00% 81 1074 0.00% 82 1219 0.01% 83 1473 0.01% 84 1577 0.01% 85 1744 0.01% 86 1801 0.01% 87 2042 0.01% 88 2125 0.01% 89 2317 0.01% 90 2583 0.01% 91 2968 0.01% 92 3419 0.02% 93 3684 0.02% 94 4179 0.02% 95 4400 0.02% 96 4646 0.02% 97 4986 0.02% 98 5149 0.02% 99 5681 0.03% 100 6188 0.03% 101 6788 0.03% 102 7190 0.03% 103 7832 0.04% 104 8688 0.04% 105 9343 0.04% 106 9608 0.04% 107 9994 0.05% 108 10292 0.05% 109 10783 0.05% 110 11621 0.05% 111 12345 0.06% 112 13139 0.06% 113 14409 0.07% 114 15116 0.07% 115 16180 0.07% 116 16780 0.08% 117 17180 0.08% 118 17851 0.08% 119 18406 0.08% 120 19255 0.09% 121 19993 0.09% 122 21349 0.10% 123 22482 0.10% 124 24509 0.11% 125 25064 0.11% 126 26270 0.12% 127 27055 0.12% 128 27686 0.13% 129 28025 0.13% 130 29505 0.13% 131 30436 0.14% 132 31419 0.14% 133 33606 0.15% 134 35162 0.16% 135 36758 0.17% 136 38142 0.17% 137 38799 0.18% 138 40083 0.18% 139 40662 0.18% 140 41563 0.19% 141 42386 0.19% 142 44385 0.20% 143 46476 0.21% 144 49436 0.22% 145 53035 0.24% 146 60206 0.27% 147 81477 0.37% 148 183730 0.83% 149 1164612 5.29% 150 19360410 87.87% 22032511 reads passed initial QC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=33 prefix-density=0.12 prefix-fanout=2.2 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=232.86 fanout-score-rank=1 prefix-density=0.49 prefix-fanout=26.5 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=34 prefix-density=0.11 prefix-fanout=2.2 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=309.25 fanout-score-rank=1 prefix-density=0.67 prefix-fanout=22.7 sequence=AAGAAGAAGAAA SRR5986244 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:24:39 Started mapping on | Feb 14 03:24:39 Finished on | Feb 14 03:31:13 Mapping speed, Million of reads per hour | 201.31 Number of input reads | 22032511 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 18387746 Uniquely mapped reads % | 83.46% Average mapped length | 287.15 Number of splices: Total | 16892284 Number of splices: Annotated (sjdb) | 16370308 Number of splices: GT/AG | 16496653 Number of splices: GC/AG | 224510 Number of splices: AT/AC | 18544 Number of splices: Non-canonical | 152577 Mismatch rate per base, % | 2.10% Deletion rate per base | 0.14% Deletion average length | 3.18 Insertion rate per base | 0.09% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1011601 % of reads mapped to multiple loci | 4.59% Number of reads mapped to too many loci | 52655 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.43% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2633164 2633164 2633164 N_multimapping 1011601 1011601 1011601 N_noFeature 585801 9437138 9389162 N_ambiguous 318025 85837 85837 UnstrandedReadsAssigned:17483920 PositiveStrandReadsAssigned:8864771 NegativeStrandReadsAssigned:8912747 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986244 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986244-trimmed-pair1.fastq SRR5986244-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,032,511 reads, 17,914,986 reads pseudoaligned [quant] estimated average fragment length: 213.419 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52401 SRR5986244.ke.tsv 34699 SRR5986244.se.tsv 87100 total ==> SRR5986244.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1805.58 884 21.8437 Potri.005G024800.1.v4.1 1035 822.581 493 26.7399 Potri.004G059700.1.v4.1 961 748.581 11 0.655609 Potri.007G009000.2.v4.1 1416 1203.58 0 0 Potri.003G141000.2.v4.1 2943 2730.58 298 4.86914 Potri.016G087400.1.v4.1 270 69.3147 813 523.307 Potri.015G069301.1.v4.1 564 351.66 0 0 Potri.010G195200.1.v4.1 1773 1560.58 157 4.48853 Potri.012G127500.1.v4.1 977 764.581 8728 509.31 ==> SRR5986244.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 56 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 20 SRR5986244 completed mapping pipeline successfully