Starting /dee2/code/volunteer_pipeline.sh SRR5986245 current disk space = 3088055095296 free memory = 1577186744 SRR5986245 SRAfilesize 3e69971251564fdd203997b0f0418964 SRR5986245.sra SRR5986245.sra file validated SRR5986245 is paired end SRR5986245 is conventional basespace SRR5986245 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986245_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.295 32.0 27.0 32.0 2.0 32.0 2 31.3275 32.0 32.0 32.0 32.0 32.0 3 33.2925 32.0 32.0 37.0 32.0 37.0 4 35.17 37.0 37.0 37.0 32.0 37.0 5 35.88375 37.0 37.0 37.0 32.0 37.0 6 39.25025 41.0 41.0 41.0 37.0 41.0 7 38.99125 41.0 37.0 41.0 32.0 41.0 8 39.426 41.0 41.0 41.0 37.0 41.0 9 39.6435 41.0 41.0 41.0 37.0 41.0 10-14 39.27615 41.0 41.0 41.0 37.0 41.0 15-19 39.3192 41.0 40.2 41.0 36.0 41.0 20-24 39.42274999999999 41.0 41.0 41.0 37.0 41.0 25-29 38.7824 41.0 39.4 41.0 35.0 41.0 30-34 38.85105 41.0 40.2 41.0 35.0 41.0 35-39 38.38315 41.0 38.6 41.0 32.0 41.0 40-44 38.31054999999999 41.0 38.6 41.0 31.0 41.0 45-49 37.36704999999999 41.0 37.0 41.0 27.0 41.0 50-54 36.68485 41.0 37.0 41.0 25.0 41.0 55-59 36.9956 41.0 37.0 41.0 26.0 41.0 60-64 37.12355 41.0 36.0 41.0 27.0 41.0 65-69 35.946000000000005 40.2 35.0 41.0 23.0 41.0 70-74 37.583299999999994 41.0 37.0 41.0 29.0 41.0 75-79 37.2388 41.0 37.0 41.0 28.0 41.0 80-84 34.681450000000005 38.6 32.0 41.0 18.0 41.0 85-89 35.793850000000006 41.0 34.0 41.0 20.0 41.0 90-94 36.74739999999999 41.0 37.0 41.0 25.0 41.0 95-99 35.468849999999996 40.2 33.0 41.0 21.0 41.0 100-104 31.899 36.8 25.0 41.0 14.0 41.0 105-109 33.82555000000001 38.6 30.0 41.0 16.0 41.0 110-114 33.959199999999996 38.6 30.0 41.0 18.0 41.0 115-119 35.457350000000005 40.2 34.0 41.0 22.0 41.0 120-124 32.39175 37.8 26.0 41.0 15.0 41.0 125-129 31.79135 36.0 25.0 40.2 12.0 41.0 130-134 30.9577 35.0 22.0 40.2 12.0 41.0 135-139 32.748900000000006 37.0 28.0 41.0 12.0 41.0 140-144 28.2723 31.0 20.0 37.6 11.2 41.0 145-149 31.2745 35.0 26.0 41.0 12.0 41.0 150 31.5235 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 1.0 20 6.0 21 9.0 22 13.0 23 29.0 24 32.0 25 57.0 26 71.0 27 96.0 28 90.0 29 130.0 30 160.0 31 157.0 32 178.0 33 206.0 34 242.0 35 276.0 36 323.0 37 353.0 38 460.0 39 607.0 40 503.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.308868501529055 20.091743119266056 17.951070336391435 34.64831804281345 2 24.925 27.075 33.25 14.75 3 22.336168084042022 30.115057528764382 26.738369184592298 20.810405202601302 4 21.975 37.824999999999996 20.125 20.075000000000003 5 22.7 36.825 21.85 18.625 6 16.8 38.7 23.225 21.275 7 15.575 17.0 47.199999999999996 20.225 8 19.525000000000002 21.3 28.249999999999996 30.925000000000004 9 18.375 24.349999999999998 29.425 27.85 10-14 20.965 29.885 26.924999999999997 22.225 15-19 21.955 28.694999999999997 27.66 21.69 20-24 21.529999999999998 28.98 27.735 21.755 25-29 21.615000000000002 29.24 27.12 22.025 30-34 20.95 29.57 27.71 21.77 35-39 21.240000000000002 28.09 27.855 22.814999999999998 40-44 21.715 28.49 28.01 21.785 45-49 21.215 28.7 27.900000000000002 22.185 50-54 22.03 28.994999999999997 27.084999999999997 21.89 55-59 21.475 28.63 27.425 22.470000000000002 60-64 21.34 28.815 27.48 22.365 65-69 21.695 28.360000000000003 28.110000000000003 21.834999999999997 70-74 21.709999999999997 28.02 27.905 22.365 75-79 21.435000000000002 28.439999999999998 28.139999999999997 21.985 80-84 21.665 28.625 27.315 22.395 85-89 22.03 28.285 27.47 22.215 90-94 21.94 28.945 27.275 21.84 95-99 21.665 28.449999999999996 27.905 21.98 100-104 22.445 27.93 28.299999999999997 21.325 105-109 21.685 28.345 28.325 21.645 110-114 21.13 29.03 27.76 22.08 115-119 21.795 28.060000000000002 28.62 21.525 120-124 22.53 27.71 28.63 21.13 125-129 21.695 28.435 28.410000000000004 21.46 130-134 22.055 28.595 28.46 20.89 135-139 22.535 28.015 27.779999999999998 21.67 140-144 22.755 28.4 28.835 20.01 145-149 22.43 28.77 27.165 21.634999999999998 150 20.875 27.800000000000004 28.475 22.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 3.5 24 3.0 25 2.0 26 3.5 27 7.5 28 14.5 29 21.5 30 25.0 31 31.5 32 47.5 33 57.0 34 69.5 35 92.0 36 106.5 37 121.0 38 143.0 39 167.0 40 199.0 41 232.5 42 246.5 43 244.0 44 255.0 45 275.5 46 255.0 47 221.5 48 202.5 49 174.5 50 154.0 51 132.0 52 97.5 53 81.5 54 69.0 55 55.0 56 47.0 57 35.5 58 25.5 59 17.5 60 13.5 61 12.0 62 9.5 63 6.5 64 5.0 65 3.5 66 1.0 67 0.5 68 1.5 69 1.0 70 0.5 71 1.0 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.25 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.55 #Duplication Level Percentage of deduplicated Percentage of total 1 95.42124542124543 91.175 2 4.500261643118786 8.6 3 0.07849293563579278 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.32499999999999996 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.575 0.0 0.0 0.0 0.0 126-127 0.65 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.9 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.35 0.0 0.0 0.0 0.0 138 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5986245 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986245_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.715 32.0 12.0 32.0 2.0 32.0 2 30.65375 32.0 32.0 32.0 27.0 32.0 3 32.0475 32.0 32.0 37.0 27.0 37.0 4 34.62625 37.0 32.0 37.0 32.0 37.0 5 35.5025 37.0 37.0 37.0 32.0 37.0 6 38.64575 41.0 37.0 41.0 32.0 41.0 7 33.252 37.0 32.0 41.0 12.0 41.0 8 37.74175 41.0 37.0 41.0 32.0 41.0 9 34.96975 41.0 32.0 41.0 12.0 41.0 10-14 36.51365 41.0 36.0 41.0 23.0 41.0 15-19 34.25535 38.4 30.0 41.0 20.0 41.0 20-24 35.2586 39.4 32.0 41.0 21.0 41.0 25-29 35.01795 39.4 33.0 41.0 21.0 41.0 30-34 30.08025 33.0 21.0 40.2 12.0 41.0 35-39 33.99225 38.4 31.0 41.0 18.0 41.0 40-44 29.4257 30.8 22.0 37.6 15.0 40.2 45-49 30.808 34.0 21.0 40.2 12.0 41.0 50-54 32.088 36.8 26.0 41.0 16.0 41.0 55-59 29.83065 33.0 17.0 39.4 14.0 41.0 60-64 29.219449999999995 32.0 19.0 40.2 14.0 41.0 65-69 26.968949999999996 27.0 16.0 38.4 12.0 40.2 70-74 27.6435 28.0 18.0 37.6 12.0 40.2 75-79 30.645000000000003 35.0 21.0 41.0 12.0 41.0 80-84 28.1415 31.0 16.0 39.2 12.0 41.0 85-89 29.563499999999998 33.0 20.0 40.2 12.0 41.0 90-94 24.75545 25.0 14.0 35.0 12.0 40.2 95-99 24.29225 24.0 12.0 35.0 12.0 39.4 100-104 23.7038 21.0 12.0 35.0 12.0 39.4 105-109 24.64475 25.0 12.0 35.0 12.0 39.4 110-114 25.84085 27.0 14.0 35.0 12.0 41.0 115-119 24.713749999999997 24.0 12.0 36.0 12.0 41.0 120-124 23.1824 22.0 12.0 33.0 12.0 40.2 125-129 21.97185 20.0 12.0 30.0 12.0 37.0 130-134 21.61625 19.0 12.0 31.0 12.0 38.6 135-139 21.182399999999998 18.0 12.0 29.0 12.0 37.0 140-144 21.470350000000003 20.0 12.0 30.0 12.0 37.0 145-149 19.11195 16.0 12.0 25.0 11.2 34.0 150 18.89525 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 10.0 16 53.0 17 100.0 18 142.0 19 156.0 20 171.0 21 212.0 22 168.0 23 182.0 24 181.0 25 173.0 26 194.0 27 199.0 28 198.0 29 215.0 30 214.0 31 207.0 32 223.0 33 203.0 34 210.0 35 187.0 36 172.0 37 132.0 38 73.0 39 23.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.153507392261716 20.666876376218937 17.20666876376219 33.97294746775716 2 24.275 26.400000000000002 34.8 14.524999999999999 3 20.875 31.5 26.875 20.75 4 22.85 36.3 20.125 20.724999999999998 5 22.2 38.4 21.625 17.775 6 15.8 38.824999999999996 25.074999999999996 20.3 7 17.125 16.900000000000002 44.25 21.725 8 19.025 22.525000000000002 29.775000000000002 28.675 9 21.224999999999998 23.825 28.849999999999998 26.1 10-14 21.54 29.604999999999997 27.105 21.75 15-19 22.43 28.345 27.97 21.255 20-24 21.975 29.354999999999997 27.415 21.255 25-29 21.375 29.615000000000002 28.005000000000003 21.005 30-34 22.259999999999998 29.74 28.62 19.38 35-39 21.915000000000003 29.525000000000002 28.115000000000002 20.445 40-44 22.85 30.330000000000002 29.125 17.695 45-49 22.54 28.89 28.355000000000004 20.215 50-54 22.24 28.87 28.13 20.76 55-59 22.965 29.349999999999998 29.225 18.459999999999997 60-64 22.735 29.395 29.104999999999997 18.765 65-69 22.86 29.865000000000002 29.580000000000002 17.695 70-74 23.47 30.04 28.29 18.2 75-79 21.825 28.470000000000002 29.53 20.175 80-84 21.62 30.125 29.92 18.335 85-89 21.64 28.915000000000003 30.035 19.41 90-94 22.325 29.455 31.28 16.939999999999998 95-99 23.255 29.65 30.064999999999998 17.03 100-104 23.119999999999997 29.794999999999998 29.935000000000002 17.150000000000002 105-109 22.145 29.439999999999998 31.185000000000002 17.23 110-114 22.655 28.470000000000002 30.145 18.73 115-119 22.189999999999998 28.7 29.975 19.134999999999998 120-124 22.395 28.645 30.645 18.315 125-129 23.01 28.58 31.175000000000004 17.235 130-134 23.02 28.08 31.405 17.495 135-139 23.49 28.610000000000003 30.990000000000002 16.91 140-144 23.674999999999997 28.23 30.055 18.04 145-149 24.275 28.43 31.445 15.85 150 23.325000000000003 28.625 33.025 15.024999999999999 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 2.5 21 3.5 22 3.5 23 6.5 24 12.0 25 10.0 26 12.5 27 21.0 28 26.0 29 38.5 30 51.0 31 65.0 32 69.0 33 83.5 34 111.5 35 121.5 36 152.5 37 184.5 38 186.0 39 205.0 40 222.5 41 219.5 42 228.5 43 233.0 44 229.5 45 227.0 46 202.5 47 184.0 48 167.0 49 136.0 50 118.0 51 101.5 52 76.0 53 63.5 54 57.5 55 42.5 56 33.0 57 27.0 58 19.5 59 8.5 60 6.5 61 8.0 62 4.5 63 4.0 64 4.0 65 2.5 66 2.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 20.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26952141057934 98.52499999999999 2 0.7052896725440806 1.4000000000000001 3 0.025188916876574305 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0125 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0125 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.037500000000000006 0.0 0.025 0.0 0.0 76-77 0.05 0.0 0.025 0.0 0.0 78-79 0.05 0.0 0.025 0.0 0.0 80-81 0.05 0.0 0.025 0.0 0.0 82-83 0.05 0.0 0.025 0.0 0.0 84-85 0.05 0.0 0.025 0.0 0.0 86-87 0.05 0.0 0.025 0.0 0.0 88-89 0.05 0.0 0.025 0.0 0.0 90-91 0.05 0.0 0.025 0.0 0.0 92-93 0.05 0.0 0.025 0.0 0.0 94-95 0.05 0.0 0.025 0.0 0.0 96-97 0.05 0.0 0.025 0.0 0.0 98-99 0.0625 0.0 0.025 0.0 0.0 100-101 0.1 0.0 0.025 0.0 0.0 102-103 0.125 0.0 0.025 0.0 0.0 104-105 0.125 0.0 0.025 0.0 0.0 106-107 0.125 0.0 0.025 0.0 0.0 108-109 0.16249999999999998 0.0 0.025 0.0 0.0 110-111 0.175 0.0 0.025 0.0 0.0 112-113 0.2 0.0 0.025 0.0 0.0 114-115 0.2375 0.0 0.025 0.0 0.0 116-117 0.2625 0.0 0.025 0.0 0.0 118-119 0.275 0.0 0.025 0.0 0.0 120-121 0.3 0.0 0.025 0.0 0.0 122-123 0.35 0.0 0.025 0.0 0.0 124-125 0.4 0.0 0.025 0.0 0.0 126-127 0.5 0.0 0.025 0.0 0.0 128-129 0.575 0.0 0.025 0.0 0.0 130-131 0.6375 0.0 0.025 0.0 0.0 132-133 0.775 0.0 0.025 0.0 0.0 134-135 0.8625 0.0 0.025 0.0 0.0 136-137 0.95 0.0 0.025 0.0 0.0 138 0.95 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra Read 1133670 spots for SRR5986245.sra Written 1133670 spots for SRR5986245.sra Read 1133662 spots for SRR5986245.sra Written 1133662 spots for SRR5986245.sra SRR ids: ['SRR5986245.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_se9f03n_ SRR5986245.sra spots: 22673248 blocks: [[1, 1133662], [1133663, 2267324], [2267325, 3400986], [3400987, 4534648], [4534649, 5668310], [5668311, 6801972], [6801973, 7935634], [7935635, 9069296], [9069297, 10202958], [10202959, 11336620], [11336621, 12470282], [12470283, 13603944], [13603945, 14737606], [14737607, 15871268], [15871269, 17004930], [17004931, 18138592], [18138593, 19272254], [19272255, 20405916], [20405917, 21539578], [21539579, 22673248]] SRR5986245 file size 7617235 SRR5986245 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986245 SRR5986245_1.fastq SRR5986245_2.fastq Input file: SRR5986245_1.fastq Paired file: SRR5986245_2.fastq trimmed: SRR5986245-trimmed-pair1.fastq, SRR5986245-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:48:09 2025 >> started Fri Feb 14 03:48:35 2025 >> done (25.041s) 22673248 read pairs processed; of these: 203 ( 0.00%) short read pairs filtered out after trimming by size control 380 ( 0.00%) empty read pairs filtered out after trimming by size control 22672665 (100.00%) read pairs available; of these: 2060815 ( 9.09%) trimmed read pairs available after processing 20611850 (90.91%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 23 0.00% 20 16 0.00% 21 29 0.00% 22 42 0.00% 23 31 0.00% 24 62 0.00% 25 53 0.00% 26 75 0.00% 27 58 0.00% 28 60 0.00% 29 88 0.00% 30 80 0.00% 31 93 0.00% 32 81 0.00% 33 90 0.00% 34 79 0.00% 35 96 0.00% 36 87 0.00% 37 103 0.00% 38 92 0.00% 39 96 0.00% 40 93 0.00% 41 90 0.00% 42 84 0.00% 43 91 0.00% 44 70 0.00% 45 96 0.00% 46 76 0.00% 47 103 0.00% 48 113 0.00% 49 120 0.00% 50 120 0.00% 51 133 0.00% 52 140 0.00% 53 138 0.00% 54 147 0.00% 55 155 0.00% 56 152 0.00% 57 125 0.00% 58 136 0.00% 59 141 0.00% 60 159 0.00% 61 169 0.00% 62 155 0.00% 63 159 0.00% 64 155 0.00% 65 183 0.00% 66 159 0.00% 67 207 0.00% 68 215 0.00% 69 204 0.00% 70 190 0.00% 71 216 0.00% 72 234 0.00% 73 250 0.00% 74 283 0.00% 75 263 0.00% 76 290 0.00% 77 255 0.00% 78 351 0.00% 79 393 0.00% 80 418 0.00% 81 397 0.00% 82 465 0.00% 83 493 0.00% 84 553 0.00% 85 560 0.00% 86 608 0.00% 87 672 0.00% 88 696 0.00% 89 784 0.00% 90 794 0.00% 91 955 0.00% 92 1055 0.00% 93 1134 0.01% 94 1261 0.01% 95 1407 0.01% 96 1488 0.01% 97 1659 0.01% 98 1748 0.01% 99 1833 0.01% 100 1968 0.01% 101 2218 0.01% 102 2444 0.01% 103 2633 0.01% 104 2816 0.01% 105 2866 0.01% 106 3237 0.01% 107 3369 0.01% 108 3553 0.02% 109 3820 0.02% 110 3958 0.02% 111 4363 0.02% 112 4690 0.02% 113 4906 0.02% 114 5301 0.02% 115 5657 0.02% 116 5924 0.03% 117 6374 0.03% 118 6667 0.03% 119 6881 0.03% 120 7300 0.03% 121 7756 0.03% 122 8363 0.04% 123 8724 0.04% 124 9431 0.04% 125 9838 0.04% 126 10209 0.05% 127 10549 0.05% 128 11300 0.05% 129 11660 0.05% 130 11995 0.05% 131 12741 0.06% 132 13421 0.06% 133 14290 0.06% 134 14776 0.07% 135 15834 0.07% 136 16204 0.07% 137 17588 0.08% 138 18039 0.08% 139 18513 0.08% 140 19235 0.08% 141 19877 0.09% 142 21182 0.09% 143 22603 0.10% 144 24126 0.11% 145 27295 0.12% 146 34039 0.15% 147 60286 0.27% 148 178988 0.79% 149 1293757 5.71% 150 20611850 90.91% 22672665 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=9.46 fanout-score-rank=8 prefix-density=0.43 prefix-fanout=3.9 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=13 fanout-score=24.89 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=9.6 sequence=TGGAGGTGGAGAGCTC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=8.59 fanout-score-rank=9 prefix-density=0.38 prefix-fanout=3.8 sequence=TGGCTGCAAGTG criterion=fanout-score sequence-density=0.07 sequence-density-rank=12 fanout-score=23.52 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=9.3 sequence=TGGAGGTGGAGAG SRR5986245 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:49:59 Started mapping on | Feb 14 03:49:59 Finished on | Feb 14 03:55:39 Mapping speed, Million of reads per hour | 240.06 Number of input reads | 22672665 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 18532843 Uniquely mapped reads % | 81.74% Average mapped length | 280.35 Number of splices: Total | 16658884 Number of splices: Annotated (sjdb) | 16127994 Number of splices: GT/AG | 16278628 Number of splices: GC/AG | 212566 Number of splices: AT/AC | 17315 Number of splices: Non-canonical | 150375 Mismatch rate per base, % | 2.16% Deletion rate per base | 0.14% Deletion average length | 3.16 Insertion rate per base | 0.09% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1059658 % of reads mapped to multiple loci | 4.67% Number of reads mapped to too many loci | 42383 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 13.18% % of reads unmapped: other | 0.22% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3080166 3080166 3080166 N_multimapping 1059658 1059658 1059658 N_noFeature 528336 9491142 9437344 N_ambiguous 324587 96318 96632 UnstrandedReadsAssigned:17679920 PositiveStrandReadsAssigned:8945383 NegativeStrandReadsAssigned:8998867 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR5986245 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986245-trimmed-pair1.fastq SRR5986245-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,672,665 reads, 18,484,153 reads pseudoaligned [quant] estimated average fragment length: 221.358 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR5986245.ke.tsv 34699 SRR5986245.se.tsv 87100 total ==> SRR5986245.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.64 948 22.7451 Potri.005G024800.1.v4.1 1035 814.642 444 23.5071 Potri.004G059700.1.v4.1 961 740.642 20 1.16467 Potri.007G009000.2.v4.1 1416 1195.64 0 0 Potri.003G141000.2.v4.1 2943 2722.64 378.109 5.98975 Potri.016G087400.1.v4.1 270 63.9981 868.377 585.226 Potri.015G069301.1.v4.1 564 343.723 0 0 Potri.010G195200.1.v4.1 1773 1552.64 152 4.22235 Potri.012G127500.1.v4.1 977 756.642 6938 395.482 ==> SRR5986245.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 47 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 223 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 25 SRR5986245 completed mapping pipeline successfully