Starting /dee2/code/volunteer_pipeline.sh SRR5986246 current disk space = 3087638446080 free memory = 1582836228 SRR5986246 SRAfilesize 946e007ba7e3502b9fb3197d29e842e0 SRR5986246.sra SRR5986246.sra file validated SRR5986246 is paired end SRR5986246 is conventional basespace SRR5986246 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986246_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.68375 32.0 12.0 32.0 2.0 32.0 2 31.465 32.0 32.0 32.0 32.0 32.0 3 33.17875 32.0 32.0 37.0 32.0 37.0 4 35.165 37.0 37.0 37.0 32.0 37.0 5 35.945 37.0 37.0 37.0 32.0 37.0 6 39.30475 41.0 41.0 41.0 37.0 41.0 7 39.17125 41.0 41.0 41.0 37.0 41.0 8 39.61075 41.0 41.0 41.0 37.0 41.0 9 39.72875 41.0 41.0 41.0 37.0 41.0 10-14 39.3718 41.0 41.0 41.0 37.0 41.0 15-19 39.406099999999995 41.0 41.0 41.0 36.0 41.0 20-24 39.4936 41.0 41.0 41.0 37.0 41.0 25-29 38.769349999999996 41.0 39.4 41.0 35.0 41.0 30-34 38.91225 41.0 40.2 41.0 35.0 41.0 35-39 38.4796 41.0 38.6 41.0 33.0 41.0 40-44 38.3125 41.0 38.6 41.0 32.0 41.0 45-49 37.4808 41.0 37.0 41.0 29.0 41.0 50-54 36.6626 41.0 37.0 41.0 25.0 41.0 55-59 36.9802 41.0 37.0 41.0 26.0 41.0 60-64 37.16865 41.0 36.0 41.0 27.0 41.0 65-69 36.0011 40.2 35.0 41.0 23.0 41.0 70-74 37.53465 41.0 37.0 41.0 28.0 41.0 75-79 37.2668 41.0 37.0 41.0 28.0 41.0 80-84 34.7411 39.4 32.0 41.0 18.0 41.0 85-89 35.78835 41.0 35.0 41.0 22.0 41.0 90-94 36.77775 41.0 37.0 41.0 25.0 41.0 95-99 35.33715 39.4 33.0 41.0 21.0 41.0 100-104 31.6452 35.8 25.0 41.0 14.0 41.0 105-109 33.8352 38.6 30.0 41.0 16.0 41.0 110-114 34.03695 38.6 30.0 41.0 18.0 41.0 115-119 35.431050000000006 40.2 34.0 41.0 22.0 41.0 120-124 32.2198 37.8 26.0 41.0 15.0 41.0 125-129 31.9089 36.0 25.0 41.0 12.0 41.0 130-134 31.222450000000002 36.0 25.0 40.2 12.0 41.0 135-139 32.75015 37.0 28.0 41.0 12.0 41.0 140-144 28.17405 31.0 19.0 37.6 12.0 41.0 145-149 31.242600000000003 35.0 25.0 41.0 12.0 41.0 150 31.29375 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 3.0 20 5.0 21 11.0 22 12.0 23 23.0 24 41.0 25 55.0 26 59.0 27 100.0 28 90.0 29 135.0 30 130.0 31 171.0 32 185.0 33 216.0 34 234.0 35 281.0 36 322.0 37 383.0 38 448.0 39 586.0 40 508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.949399114484503 19.038583175205567 18.722327640733713 32.28969006957622 2 23.125 26.150000000000002 34.725 16.0 3 20.40510127531883 29.857464366091524 28.93223305826457 20.80520130032508 4 21.775 36.475 20.599999999999998 21.15 5 22.55 38.1 20.775 18.575 6 16.775000000000002 38.75 23.825 20.65 7 15.375 15.8 44.35 24.474999999999998 8 18.5 22.5 28.875 30.125 9 20.8 23.7 28.725 26.775 10-14 20.215 29.925 27.27 22.59 15-19 20.95 27.97 28.410000000000004 22.67 20-24 21.565 28.95 27.689999999999998 21.795 25-29 21.63 29.085 27.644999999999996 21.64 30-34 20.695 29.409999999999997 28.125 21.77 35-39 21.654999999999998 29.23 26.884999999999998 22.23 40-44 21.825 29.035 27.644999999999996 21.495 45-49 22.08 28.87 27.0 22.05 50-54 22.295 28.555000000000003 27.150000000000002 22.0 55-59 21.845 28.605000000000004 27.750000000000004 21.8 60-64 22.215 28.82 27.04 21.925 65-69 21.495 28.410000000000004 27.91 22.185 70-74 22.48 28.335 27.279999999999998 21.905 75-79 21.905 28.560000000000002 27.58 21.955 80-84 21.884999999999998 28.799999999999997 27.534999999999997 21.78 85-89 22.09 28.37 27.495000000000005 22.045 90-94 21.33 28.59 27.694999999999997 22.384999999999998 95-99 22.18 27.98 28.139999999999997 21.7 100-104 21.77 28.62 28.525 21.085 105-109 21.67 28.59 27.68 22.06 110-114 21.634999999999998 28.32 28.055000000000003 21.990000000000002 115-119 21.675 28.63 28.299999999999997 21.395 120-124 22.03 28.255000000000003 28.78 20.935000000000002 125-129 22.045 28.025 28.444999999999997 21.485000000000003 130-134 22.05 28.24 28.720000000000002 20.990000000000002 135-139 21.65 28.375 28.04 21.935 140-144 22.48 28.375 28.865000000000002 20.28 145-149 22.14 27.810000000000002 28.285 21.765 150 21.349999999999998 28.65 26.950000000000003 23.05 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.5 19 1.5 20 0.0 21 1.0 22 1.5 23 0.5 24 2.5 25 5.5 26 6.5 27 9.0 28 15.5 29 25.0 30 27.0 31 31.0 32 43.5 33 51.5 34 71.5 35 86.0 36 100.0 37 129.0 38 148.5 39 175.0 40 201.5 41 222.5 42 251.0 43 262.5 44 256.5 45 245.5 46 230.0 47 214.0 48 190.5 49 174.0 50 165.0 51 137.5 52 107.0 53 94.0 54 82.5 55 59.5 56 43.0 57 35.0 58 24.0 59 16.5 60 10.0 61 7.5 62 7.0 63 5.0 64 6.0 65 6.0 66 3.5 67 2.5 68 2.5 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 20.95 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.35 #Duplication Level Percentage of deduplicated Percentage of total 1 95.22810697430519 90.8 2 4.667016255899319 8.9 3 0.1048767697954903 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.1125 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.25 0.0 0.0 0.0 0.0 118-119 0.2875 0.0 0.0 0.0 0.0 120-121 0.325 0.0 0.0 0.0 0.0 122-123 0.3875 0.0 0.0 0.0 0.0 124-125 0.425 0.0 0.0 0.0 0.0 126-127 0.5249999999999999 0.0 0.0 0.0 0.0 128-129 0.7 0.0 0.0 0.0 0.0 130-131 0.825 0.0 0.0 0.0 0.0 132-133 0.9625 0.0 0.0 0.0 0.0 134-135 1.0875 0.0 0.0 0.0 0.0 136-137 1.1375 0.0 0.0 0.0 0.0 138 1.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5986246 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986246_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.23 32.0 12.0 32.0 2.0 32.0 2 30.78 32.0 32.0 32.0 27.0 32.0 3 31.575 32.0 32.0 37.0 27.0 37.0 4 34.7425 37.0 32.0 37.0 32.0 37.0 5 35.68375 37.0 37.0 37.0 32.0 37.0 6 38.56375 41.0 37.0 41.0 32.0 41.0 7 33.22575 37.0 27.0 41.0 12.0 41.0 8 37.946 41.0 37.0 41.0 32.0 41.0 9 35.321 41.0 32.0 41.0 12.0 41.0 10-14 36.65155 41.0 36.0 41.0 24.0 41.0 15-19 34.2939 38.4 30.0 41.0 20.0 41.0 20-24 35.295500000000004 39.4 32.0 41.0 21.0 41.0 25-29 35.0 39.4 33.0 41.0 21.0 41.0 30-34 30.1099 33.0 21.0 40.2 14.0 41.0 35-39 34.0607 38.4 31.0 41.0 19.0 41.0 40-44 29.188350000000003 30.8 22.0 37.6 14.0 40.2 45-49 30.78445 34.0 21.0 40.2 12.0 41.0 50-54 31.92685 35.8 23.0 41.0 16.0 41.0 55-59 29.626200000000004 32.0 17.0 39.4 14.0 41.0 60-64 29.0173 32.0 17.0 40.2 14.0 41.0 65-69 26.85085 27.0 16.0 37.4 12.0 40.2 70-74 27.39565 27.0 18.0 37.6 12.0 40.2 75-79 30.35745 34.0 21.0 41.0 12.0 41.0 80-84 27.912950000000002 31.0 14.0 39.2 12.0 41.0 85-89 29.3072 34.0 20.0 40.2 12.0 41.0 90-94 24.56915 24.0 14.0 35.0 12.0 40.2 95-99 24.148 24.0 14.0 35.0 12.0 39.4 100-104 23.48605 20.0 12.0 35.0 12.0 39.4 105-109 24.3698 23.0 12.0 35.0 12.0 39.4 110-114 25.7029 27.0 14.0 35.0 12.0 40.2 115-119 24.323 24.0 12.0 35.0 12.0 41.0 120-124 22.956 22.0 12.0 33.0 12.0 40.2 125-129 21.83695 18.0 12.0 30.0 12.0 37.0 130-134 21.4119 17.0 12.0 30.0 12.0 38.6 135-139 20.835050000000003 18.0 12.0 29.0 12.0 37.0 140-144 21.143 20.0 12.0 29.0 12.0 37.0 145-149 18.975600000000004 16.0 12.0 25.0 11.2 33.0 150 18.6255 12.0 12.0 27.0 12.0 32.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 19.0 16 53.0 17 90.0 18 147.0 19 166.0 20 178.0 21 197.0 22 202.0 23 206.0 24 158.0 25 196.0 26 198.0 27 190.0 28 182.0 29 218.0 30 217.0 31 193.0 32 189.0 33 216.0 34 191.0 35 212.0 36 179.0 37 104.0 38 74.0 39 23.0 40 1.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.469288267793306 19.174520636984074 20.604484887877803 31.751706207344814 2 24.175 26.6 35.05 14.174999999999999 3 20.5 30.425 27.950000000000003 21.125 4 21.525 36.725 20.4 21.349999999999998 5 21.099999999999998 37.3 23.45 18.15 6 15.875 38.675 25.025 20.424999999999997 7 16.675 16.525000000000002 44.324999999999996 22.475 8 18.95 22.325 28.449999999999996 30.275000000000002 9 20.599999999999998 23.025000000000002 30.3 26.075 10-14 21.39 29.325000000000003 27.315 21.97 15-19 21.84 28.525 27.900000000000002 21.735 20-24 21.875 28.27 28.275 21.58 25-29 21.55 29.425 27.950000000000003 21.075 30-34 21.875 29.445 28.765 19.915 35-39 22.115000000000002 29.425 27.96 20.5 40-44 22.884999999999998 30.620000000000005 29.03 17.465 45-49 22.41 29.035 28.705000000000002 19.85 50-54 22.405 28.89 28.43 20.275000000000002 55-59 23.44 29.07 28.189999999999998 19.3 60-64 22.945 29.310000000000002 28.854999999999997 18.89 65-69 23.14 29.09 29.98 17.79 70-74 23.875 28.994999999999997 28.78 18.35 75-79 22.29 28.044999999999998 29.849999999999998 19.814999999999998 80-84 22.02 29.415000000000003 30.75 17.815 85-89 21.83 28.685 29.609999999999996 19.875 90-94 22.185 30.305 31.045 16.465 95-99 23.0 29.310000000000002 30.535 17.155 100-104 23.05 29.304999999999996 30.335 17.31 105-109 22.59 29.225 30.845 17.34 110-114 22.895 28.325 29.615000000000002 19.165 115-119 22.745 28.749999999999996 30.145 18.360000000000003 120-124 22.36 29.12 30.630000000000003 17.89 125-129 22.830000000000002 28.435 30.514999999999997 18.22 130-134 23.064999999999998 28.884999999999998 30.680000000000003 17.37 135-139 23.52 28.845 30.56 17.075000000000003 140-144 22.95 28.21 30.275000000000002 18.565 145-149 24.42 28.71 30.91 15.959999999999999 150 23.45 29.475 33.15 13.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 2.0 19 3.0 20 3.0 21 2.0 22 4.0 23 7.5 24 10.5 25 14.0 26 17.5 27 16.5 28 21.5 29 31.0 30 38.5 31 56.5 32 76.0 33 97.5 34 115.0 35 128.5 36 154.5 37 154.5 38 158.5 39 193.5 40 221.0 41 227.0 42 232.0 43 246.5 44 234.0 45 225.0 46 218.0 47 188.0 48 159.0 49 141.0 50 128.0 51 106.5 52 84.0 53 77.5 54 58.0 55 29.5 56 26.0 57 26.5 58 16.5 59 11.5 60 10.5 61 6.0 62 3.0 63 2.0 64 2.0 65 2.0 66 2.0 67 1.0 68 0.5 69 0.5 70 1.0 71 1.0 72 0.5 73 0.5 74 0.5 75 0.0 76 1.0 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.075000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21894683799447 98.45 2 0.781053162005543 1.55 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.4 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.475 0.0 0.0 0.0 0.0 126-127 0.5125 0.0 0.0 0.0 0.0 128-129 0.625 0.0 0.0 0.0 0.0 130-131 0.7 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.825 0.0 0.0 0.0 0.0 138 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra Read 1283984 spots for SRR5986246.sra Written 1283984 spots for SRR5986246.sra SRR ids: ['SRR5986246.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_lay_fzww SRR5986246.sra spots: 25679680 blocks: [[1, 1283984], [1283985, 2567968], [2567969, 3851952], [3851953, 5135936], [5135937, 6419920], [6419921, 7703904], [7703905, 8987888], [8987889, 10271872], [10271873, 11555856], [11555857, 12839840], [12839841, 14123824], [14123825, 15407808], [15407809, 16691792], [16691793, 17975776], [17975777, 19259760], [19259761, 20543744], [20543745, 21827728], [21827729, 23111712], [23111713, 24395696], [24395697, 25679680]] SRR5986246 file size 8630144 SRR5986246 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986246 SRR5986246_1.fastq SRR5986246_2.fastq Input file: SRR5986246_1.fastq Paired file: SRR5986246_2.fastq trimmed: SRR5986246-trimmed-pair1.fastq, SRR5986246-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:24:20 2025 >> started Fri Feb 14 04:24:47 2025 >> done (26.891s) 25679680 read pairs processed; of these: 255 ( 0.00%) short read pairs filtered out after trimming by size control 537 ( 0.00%) empty read pairs filtered out after trimming by size control 25678888 (100.00%) read pairs available; of these: 2461650 ( 9.59%) trimmed read pairs available after processing 23217238 (90.41%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 31 0.00% 19 24 0.00% 20 32 0.00% 21 49 0.00% 22 47 0.00% 23 53 0.00% 24 58 0.00% 25 53 0.00% 26 71 0.00% 27 68 0.00% 28 105 0.00% 29 106 0.00% 30 97 0.00% 31 79 0.00% 32 91 0.00% 33 100 0.00% 34 103 0.00% 35 77 0.00% 36 118 0.00% 37 105 0.00% 38 108 0.00% 39 93 0.00% 40 118 0.00% 41 95 0.00% 42 114 0.00% 43 109 0.00% 44 97 0.00% 45 108 0.00% 46 127 0.00% 47 105 0.00% 48 125 0.00% 49 125 0.00% 50 153 0.00% 51 124 0.00% 52 149 0.00% 53 122 0.00% 54 145 0.00% 55 156 0.00% 56 161 0.00% 57 170 0.00% 58 171 0.00% 59 164 0.00% 60 195 0.00% 61 182 0.00% 62 178 0.00% 63 192 0.00% 64 206 0.00% 65 227 0.00% 66 233 0.00% 67 216 0.00% 68 196 0.00% 69 238 0.00% 70 298 0.00% 71 268 0.00% 72 312 0.00% 73 322 0.00% 74 329 0.00% 75 342 0.00% 76 391 0.00% 77 425 0.00% 78 415 0.00% 79 471 0.00% 80 481 0.00% 81 544 0.00% 82 592 0.00% 83 683 0.00% 84 760 0.00% 85 758 0.00% 86 769 0.00% 87 890 0.00% 88 895 0.00% 89 977 0.00% 90 1068 0.00% 91 1183 0.00% 92 1360 0.01% 93 1550 0.01% 94 1723 0.01% 95 1836 0.01% 96 1832 0.01% 97 2151 0.01% 98 2228 0.01% 99 2484 0.01% 100 2616 0.01% 101 2906 0.01% 102 3117 0.01% 103 3497 0.01% 104 3707 0.01% 105 3944 0.02% 106 4387 0.02% 107 4554 0.02% 108 4687 0.02% 109 4947 0.02% 110 5303 0.02% 111 5591 0.02% 112 6119 0.02% 113 6567 0.03% 114 6924 0.03% 115 7516 0.03% 116 7999 0.03% 117 8348 0.03% 118 8739 0.03% 119 9184 0.04% 120 9503 0.04% 121 10048 0.04% 122 10918 0.04% 123 11678 0.05% 124 12433 0.05% 125 13193 0.05% 126 13621 0.05% 127 14293 0.06% 128 14722 0.06% 129 15412 0.06% 130 15921 0.06% 131 16822 0.07% 132 17392 0.07% 133 18464 0.07% 134 19515 0.08% 135 20539 0.08% 136 21671 0.08% 137 22315 0.09% 138 23370 0.09% 139 24207 0.09% 140 25131 0.10% 141 25850 0.10% 142 27166 0.11% 143 28760 0.11% 144 30921 0.12% 145 34299 0.13% 146 43169 0.17% 147 72763 0.28% 148 212790 0.83% 149 1489406 5.80% 150 23217238 90.41% 25678888 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.65 fanout-score-rank=11 prefix-density=0.30 prefix-fanout=3.2 sequence=TTGCAGCCATTCTCAGCACCAAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=93.66 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=19.8 sequence=GGTGGTGGTGGAG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.09 fanout-score-rank=16 prefix-density=0.28 prefix-fanout=3.1 sequence=TTGCAGCCATTCTCAGCACCAAAG criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=93.15 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=19.5 sequence=GGTGGTGGTGGAG SRR5986246 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:25:54 Started mapping on | Feb 14 04:25:54 Finished on | Feb 14 04:33:38 Mapping speed, Million of reads per hour | 199.23 Number of input reads | 25678888 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21165466 Uniquely mapped reads % | 82.42% Average mapped length | 287.81 Number of splices: Total | 19694566 Number of splices: Annotated (sjdb) | 19061728 Number of splices: GT/AG | 19250514 Number of splices: GC/AG | 249079 Number of splices: AT/AC | 20347 Number of splices: Non-canonical | 174626 Mismatch rate per base, % | 2.13% Deletion rate per base | 0.14% Deletion average length | 3.19 Insertion rate per base | 0.09% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1252233 % of reads mapped to multiple loci | 4.88% Number of reads mapped to too many loci | 48370 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.27% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3261189 3261189 3261189 N_multimapping 1252233 1252233 1252233 N_noFeature 568186 10816980 10762699 N_ambiguous 351143 98552 99717 UnstrandedReadsAssigned:20246137 PositiveStrandReadsAssigned:10249934 NegativeStrandReadsAssigned:10303050 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986246 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986246-trimmed-pair1.fastq SRR5986246-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,678,888 reads, 20,913,928 reads pseudoaligned [quant] estimated average fragment length: 227.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,120 rounds 52401 SRR5986246.ke.tsv 34699 SRR5986246.se.tsv 87100 total ==> SRR5986246.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.45 1023 21.2324 Potri.005G024800.1.v4.1 1035 808.454 507 23.3175 Potri.004G059700.1.v4.1 961 734.454 46 2.32875 Potri.007G009000.2.v4.1 1416 1189.45 0 0 Potri.003G141000.2.v4.1 2943 2716.45 434.104 5.94185 Potri.016G087400.1.v4.1 270 60.2439 1013.36 625.434 Potri.015G069301.1.v4.1 564 337.535 0 0 Potri.010G195200.1.v4.1 1773 1546.45 187 4.49609 Potri.012G127500.1.v4.1 977 750.454 7771 385.02 ==> SRR5986246.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 102 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 207 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 22 SRR5986246 completed mapping pipeline successfully