Starting /dee2/code/volunteer_pipeline.sh SRR5986247 current disk space = 3087488258048 free memory = 1582668164 SRR5986247 SRAfilesize bc8661292def7564e44ddd2d28834780 SRR5986247.sra SRR5986247.sra file validated SRR5986247 is paired end SRR5986247 is conventional basespace SRR5986247 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986247_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.06375 32.0 12.0 32.0 2.0 32.0 2 31.3575 32.0 32.0 32.0 32.0 32.0 3 33.01875 32.0 32.0 37.0 32.0 37.0 4 35.035 37.0 37.0 37.0 32.0 37.0 5 35.87125 37.0 37.0 37.0 32.0 37.0 6 39.23725 41.0 41.0 41.0 37.0 41.0 7 38.87925 41.0 37.0 41.0 32.0 41.0 8 39.1985 41.0 41.0 41.0 37.0 41.0 9 39.62575 41.0 41.0 41.0 37.0 41.0 10-14 39.24425 41.0 40.2 41.0 36.0 41.0 15-19 39.25765 41.0 40.2 41.0 36.0 41.0 20-24 39.39535 41.0 41.0 41.0 37.0 41.0 25-29 38.63755 41.0 39.4 41.0 33.0 41.0 30-34 38.7096 41.0 39.4 41.0 35.0 41.0 35-39 38.216750000000005 41.0 37.8 41.0 32.0 41.0 40-44 38.28295 41.0 38.6 41.0 32.0 41.0 45-49 37.3039 41.0 37.0 41.0 26.0 41.0 50-54 36.34779999999999 41.0 37.0 41.0 25.0 41.0 55-59 36.6469 41.0 36.0 41.0 26.0 41.0 60-64 36.6681 41.0 36.0 41.0 25.0 41.0 65-69 35.6671 40.2 34.0 41.0 22.0 41.0 70-74 37.3626 41.0 37.0 41.0 27.0 41.0 75-79 36.94035 41.0 37.0 41.0 27.0 41.0 80-84 34.338300000000004 37.8 31.0 41.0 18.0 41.0 85-89 35.42485 40.2 33.0 41.0 20.0 41.0 90-94 36.469699999999996 41.0 37.0 41.0 25.0 41.0 95-99 35.14150000000001 39.4 33.0 41.0 21.0 41.0 100-104 31.219450000000002 34.0 25.0 41.0 14.0 41.0 105-109 33.4112 37.8 29.0 41.0 14.0 41.0 110-114 33.7274 37.8 29.0 41.0 18.0 41.0 115-119 35.22474999999999 39.4 34.0 41.0 21.0 41.0 120-124 31.9638 36.8 25.0 41.0 15.0 41.0 125-129 31.705949999999994 36.0 25.0 40.2 12.0 41.0 130-134 31.000049999999998 35.0 23.0 40.2 12.0 41.0 135-139 32.58735 37.0 27.0 41.0 12.0 41.0 140-144 27.88345 31.0 18.0 37.6 12.0 41.0 145-149 30.89805 35.0 25.0 41.0 12.0 41.0 150 31.16175 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 5.0 21 14.0 22 13.0 23 28.0 24 35.0 25 65.0 26 73.0 27 97.0 28 115.0 29 126.0 30 150.0 31 163.0 32 200.0 33 229.0 34 270.0 35 279.0 36 340.0 37 362.0 38 451.0 39 533.0 40 452.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.09061488673139 18.899676375404532 18.867313915857604 34.14239482200647 2 26.1 25.674999999999997 33.925 14.299999999999999 3 21.675 30.4 26.75 21.175 4 22.325 36.0 20.974999999999998 20.7 5 22.375 37.425000000000004 21.775 18.425 6 17.275 37.15 24.0 21.575 7 15.0 16.650000000000002 44.65 23.7 8 18.975 22.85 27.925 30.25 9 19.975 22.650000000000002 29.475 27.900000000000002 10-14 20.34 29.915000000000003 27.089999999999996 22.655 15-19 20.9 28.77 27.415 22.915 20-24 21.505 29.56 26.93 22.005 25-29 20.79 29.7 27.055 22.455 30-34 20.995 29.044999999999998 27.650000000000002 22.31 35-39 21.740000000000002 28.95 27.785 21.525 40-44 21.13 28.689999999999998 27.675 22.505 45-49 21.785 28.494999999999997 27.755000000000003 21.965 50-54 22.439999999999998 28.42 27.62 21.52 55-59 21.965 28.349999999999998 27.16 22.525000000000002 60-64 21.279999999999998 28.235 28.03 22.455 65-69 22.335 28.28 27.355 22.03 70-74 21.535 29.03 27.534999999999997 21.9 75-79 21.595 28.37 27.68 22.355 80-84 21.67 28.09 28.01 22.23 85-89 22.045 28.610000000000003 27.115000000000002 22.23 90-94 22.08 28.475 27.76 21.685 95-99 22.63 27.595 28.144999999999996 21.63 100-104 22.35 28.185 27.355 22.11 105-109 22.435 27.750000000000004 27.935 21.88 110-114 21.6 27.87 28.43 22.1 115-119 21.945 28.305000000000003 27.88 21.87 120-124 21.834999999999997 28.439999999999998 28.52 21.205 125-129 22.16 28.33 28.325 21.185000000000002 130-134 22.125 28.82 27.87 21.185000000000002 135-139 22.31 27.965 27.860000000000003 21.865000000000002 140-144 22.36 28.51 28.92 20.21 145-149 21.975 28.185 27.515 22.325 150 23.1 28.349999999999998 27.650000000000002 20.9 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 1.0 23 1.0 24 1.5 25 2.0 26 5.0 27 12.0 28 14.5 29 23.0 30 27.0 31 31.0 32 43.5 33 50.0 34 59.0 35 82.0 36 103.5 37 125.0 38 147.5 39 170.5 40 201.0 41 230.0 42 239.5 43 241.5 44 257.5 45 259.5 46 247.5 47 239.5 48 203.5 49 166.0 50 161.5 51 142.5 52 109.5 53 83.5 54 71.0 55 60.0 56 43.0 57 31.5 58 26.0 59 22.0 60 16.0 61 10.5 62 10.0 63 8.0 64 3.5 65 2.0 66 2.0 67 2.0 68 1.0 69 1.5 70 1.5 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 22.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.33787323205867 91.0 2 4.557359874279728 8.7 3 0.10476689366160294 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.0875 0.0 0.0 0.0 0.0 112-113 0.1125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.175 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.2 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.5249999999999999 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.7125 0.0 0.0 0.0 0.0 134-135 0.8 0.0 0.0 0.0 0.0 136-137 0.9125 0.0 0.0 0.0 0.0 138 1.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5986247 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986247_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.51625 32.0 2.0 32.0 2.0 32.0 2 30.7875 32.0 32.0 32.0 27.0 32.0 3 31.49125 32.0 32.0 37.0 27.0 37.0 4 34.29375 37.0 32.0 37.0 32.0 37.0 5 35.1725 37.0 37.0 37.0 32.0 37.0 6 38.67275 41.0 37.0 41.0 32.0 41.0 7 33.0905 37.0 27.0 41.0 12.0 41.0 8 37.49375 41.0 37.0 41.0 32.0 41.0 9 34.9465 41.0 32.0 41.0 12.0 41.0 10-14 36.490899999999996 41.0 36.0 41.0 23.0 41.0 15-19 34.2787 38.4 30.0 41.0 20.0 41.0 20-24 35.1387 39.4 32.0 41.0 21.0 41.0 25-29 34.8968 39.4 33.0 41.0 20.0 41.0 30-34 29.978949999999998 33.0 22.0 40.2 12.0 41.0 35-39 33.866949999999996 38.4 30.0 40.2 18.0 41.0 40-44 29.319 30.8 22.0 37.6 14.0 40.2 45-49 30.860750000000003 34.0 21.0 40.2 12.0 41.0 50-54 31.860500000000002 35.8 25.0 41.0 16.0 41.0 55-59 29.593799999999998 32.0 17.0 39.4 14.0 41.0 60-64 29.096300000000003 32.0 19.0 40.2 14.0 41.0 65-69 26.73415 27.0 16.0 37.4 12.0 40.2 70-74 27.700649999999996 29.0 18.0 37.6 12.0 40.2 75-79 30.53355 34.0 21.0 41.0 12.0 41.0 80-84 27.999449999999996 31.0 14.0 39.2 12.0 41.0 85-89 29.283350000000002 33.0 20.0 40.2 12.0 41.0 90-94 24.745699999999996 24.0 14.0 35.0 12.0 40.2 95-99 24.267400000000002 24.0 12.0 35.0 12.0 40.2 100-104 23.5368 21.0 12.0 35.0 12.0 39.4 105-109 24.5922 24.0 12.0 35.0 12.0 39.4 110-114 25.637 27.0 14.0 35.0 12.0 41.0 115-119 24.26275 23.0 12.0 35.0 12.0 41.0 120-124 23.042650000000002 22.0 12.0 33.0 12.0 40.2 125-129 21.9571 20.0 12.0 30.0 12.0 37.0 130-134 21.507799999999996 17.0 12.0 30.0 11.2 38.6 135-139 20.994699999999998 18.0 12.0 29.0 12.0 37.0 140-144 21.2242 20.0 12.0 29.0 12.0 37.0 145-149 19.042849999999998 16.0 12.0 25.0 12.0 33.0 150 18.894 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 3.0 15 18.0 16 63.0 17 101.0 18 138.0 19 146.0 20 182.0 21 189.0 22 204.0 23 188.0 24 190.0 25 180.0 26 199.0 27 177.0 28 212.0 29 205.0 30 194.0 31 218.0 32 214.0 33 195.0 34 196.0 35 180.0 36 178.0 37 128.0 38 84.0 39 14.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.311497326203206 18.282085561497325 19.017379679144387 33.389037433155075 2 24.4 26.450000000000003 34.625 14.524999999999999 3 21.15 30.55 27.775 20.525 4 22.35 34.2 22.1 21.349999999999998 5 23.0 37.5 21.475 18.025 6 15.925 38.75 23.575 21.75 7 16.35 16.625 43.6 23.425 8 19.45 22.05 29.575000000000003 28.925 9 20.875 21.775 29.575000000000003 27.775 10-14 20.805 29.45 27.284999999999997 22.46 15-19 21.805 28.215 28.999999999999996 20.979999999999997 20-24 21.495 28.785 27.985 21.735 25-29 21.87 29.525000000000002 27.415 21.19 30-34 22.43 28.925 28.76 19.885 35-39 21.78 28.610000000000003 28.605000000000004 21.005 40-44 23.135 30.409999999999997 28.59 17.865000000000002 45-49 22.6 29.220000000000002 28.225 19.955000000000002 50-54 22.509999999999998 28.444999999999997 28.634999999999998 20.41 55-59 23.21 28.794999999999998 28.384999999999998 19.61 60-64 22.455 28.595 29.609999999999996 19.34 65-69 23.044999999999998 28.92 30.055 17.98 70-74 23.455000000000002 29.315 28.92 18.310000000000002 75-79 22.884999999999998 27.72 29.755 19.64 80-84 22.29 28.794999999999998 30.830000000000002 18.085 85-89 22.765 28.22 29.925 19.09 90-94 22.66 29.404999999999998 31.155 16.78 95-99 23.16 29.865000000000002 29.880000000000003 17.095 100-104 22.935 29.21 30.570000000000004 17.285 105-109 22.475 29.335 30.885 17.305 110-114 23.455000000000002 28.595 29.360000000000003 18.59 115-119 23.305 28.515 29.45 18.73 120-124 22.41 29.299999999999997 29.93 18.360000000000003 125-129 23.35 27.689999999999998 30.975 17.985 130-134 23.515 28.63 30.680000000000003 17.175 135-139 23.055 28.65 30.795 17.5 140-144 23.52 28.23 30.099999999999998 18.15 145-149 23.974999999999998 28.544999999999998 31.135 16.345000000000002 150 23.925 27.474999999999998 33.2 15.4 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.5 16 0.5 17 0.5 18 2.0 19 2.0 20 1.5 21 2.0 22 3.5 23 7.0 24 8.0 25 7.5 26 13.0 27 22.0 28 28.0 29 31.5 30 42.5 31 61.0 32 82.0 33 90.0 34 87.5 35 112.0 36 143.0 37 155.5 38 171.0 39 196.5 40 219.5 41 213.0 42 217.0 43 241.5 44 242.5 45 232.5 46 210.0 47 201.0 48 189.0 49 154.0 50 130.0 51 108.0 52 80.0 53 67.0 54 52.5 55 33.0 56 32.5 57 29.5 58 18.0 59 11.0 60 9.0 61 8.0 62 7.5 63 5.0 64 4.0 65 4.5 66 2.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 25.2 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.345582683111 98.675 2 0.6292474200855777 1.25 3 0.025169896803423106 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.0625 0.0 0.0 0.0 0.0 112-113 0.075 0.0 0.0 0.0 0.0 114-115 0.075 0.0 0.0 0.0 0.0 116-117 0.075 0.0 0.0 0.0 0.0 118-119 0.1 0.0 0.0 0.0 0.0 120-121 0.1 0.0 0.0 0.0 0.0 122-123 0.1375 0.0 0.0 0.0 0.0 124-125 0.2375 0.0 0.0 0.0 0.0 126-127 0.3125 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.5375 0.0 0.0 0.0 0.0 134-135 0.6 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCCA 10 0.0070099696 143.75 4 TAATTTC 10 0.0070099696 143.75 3 GTGACAT 10 0.0070099696 143.75 7 >>END_MODULE Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300700 spots for SRR5986247.sra Written 1300700 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra Read 1300692 spots for SRR5986247.sra Written 1300692 spots for SRR5986247.sra SRR ids: ['SRR5986247.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vfp27xf5 SRR5986247.sra spots: 26013848 blocks: [[1, 1300692], [1300693, 2601384], [2601385, 3902076], [3902077, 5202768], [5202769, 6503460], [6503461, 7804152], [7804153, 9104844], [9104845, 10405536], [10405537, 11706228], [11706229, 13006920], [13006921, 14307612], [14307613, 15608304], [15608305, 16908996], [16908997, 18209688], [18209689, 19510380], [19510381, 20811072], [20811073, 22111764], [22111765, 23412456], [23412457, 24713148], [24713149, 26013848]] SRR5986247 file size 8742730 SRR5986247 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986247 SRR5986247_1.fastq SRR5986247_2.fastq Input file: SRR5986247_1.fastq Paired file: SRR5986247_2.fastq trimmed: SRR5986247-trimmed-pair1.fastq, SRR5986247-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:31:11 2025 >> started Fri Feb 14 04:31:45 2025 >> done (33.355s) 26013848 read pairs processed; of these: 253 ( 0.00%) short read pairs filtered out after trimming by size control 366 ( 0.00%) empty read pairs filtered out after trimming by size control 26013229 (100.00%) read pairs available; of these: 2412789 ( 9.28%) trimmed read pairs available after processing 23600440 (90.72%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 30 0.00% 19 29 0.00% 20 42 0.00% 21 44 0.00% 22 54 0.00% 23 60 0.00% 24 74 0.00% 25 64 0.00% 26 75 0.00% 27 75 0.00% 28 98 0.00% 29 101 0.00% 30 101 0.00% 31 105 0.00% 32 114 0.00% 33 95 0.00% 34 97 0.00% 35 98 0.00% 36 115 0.00% 37 117 0.00% 38 151 0.00% 39 116 0.00% 40 107 0.00% 41 121 0.00% 42 115 0.00% 43 117 0.00% 44 131 0.00% 45 125 0.00% 46 121 0.00% 47 119 0.00% 48 142 0.00% 49 146 0.00% 50 168 0.00% 51 162 0.00% 52 181 0.00% 53 143 0.00% 54 139 0.00% 55 155 0.00% 56 178 0.00% 57 196 0.00% 58 199 0.00% 59 197 0.00% 60 209 0.00% 61 201 0.00% 62 195 0.00% 63 203 0.00% 64 193 0.00% 65 222 0.00% 66 214 0.00% 67 237 0.00% 68 264 0.00% 69 261 0.00% 70 258 0.00% 71 301 0.00% 72 260 0.00% 73 319 0.00% 74 353 0.00% 75 307 0.00% 76 367 0.00% 77 415 0.00% 78 392 0.00% 79 473 0.00% 80 488 0.00% 81 514 0.00% 82 589 0.00% 83 623 0.00% 84 692 0.00% 85 693 0.00% 86 740 0.00% 87 804 0.00% 88 888 0.00% 89 918 0.00% 90 1048 0.00% 91 1155 0.00% 92 1255 0.00% 93 1366 0.01% 94 1540 0.01% 95 1669 0.01% 96 1707 0.01% 97 1873 0.01% 98 1976 0.01% 99 2047 0.01% 100 2256 0.01% 101 2510 0.01% 102 2692 0.01% 103 3045 0.01% 104 3160 0.01% 105 3479 0.01% 106 3584 0.01% 107 3822 0.01% 108 4000 0.02% 109 4092 0.02% 110 4565 0.02% 111 4913 0.02% 112 5150 0.02% 113 5448 0.02% 114 6052 0.02% 115 6346 0.02% 116 6678 0.03% 117 7046 0.03% 118 7326 0.03% 119 7427 0.03% 120 7870 0.03% 121 8463 0.03% 122 9168 0.04% 123 9479 0.04% 124 10049 0.04% 125 10885 0.04% 126 11390 0.04% 127 11723 0.05% 128 12256 0.05% 129 12557 0.05% 130 13454 0.05% 131 13782 0.05% 132 14535 0.06% 133 15393 0.06% 134 16292 0.06% 135 16965 0.07% 136 17828 0.07% 137 18307 0.07% 138 19224 0.07% 139 19798 0.08% 140 20177 0.08% 141 21480 0.08% 142 22883 0.09% 143 23966 0.09% 144 25696 0.10% 145 29349 0.11% 146 37961 0.15% 147 69129 0.27% 148 215671 0.83% 149 1550422 5.96% 150 23600440 90.72% 26013229 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=6.25 fanout-score-rank=14 prefix-density=0.29 prefix-fanout=3.2 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=94.22 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=20.0 sequence=GGTGGTGGTGGAG criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=6.46 fanout-score-rank=17 prefix-density=0.27 prefix-fanout=3.3 sequence=TTGCAGCCATTCTCAGCACCAAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=131.59 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=19.2 sequence=GCAGCAGCAGCA SRR5986247 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:32:48 Started mapping on | Feb 14 04:32:49 Finished on | Feb 14 04:40:23 Mapping speed, Million of reads per hour | 206.27 Number of input reads | 26013229 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21422574 Uniquely mapped reads % | 82.35% Average mapped length | 287.87 Number of splices: Total | 20005833 Number of splices: Annotated (sjdb) | 19364794 Number of splices: GT/AG | 19559770 Number of splices: GC/AG | 252620 Number of splices: AT/AC | 19945 Number of splices: Non-canonical | 173498 Mismatch rate per base, % | 2.14% Deletion rate per base | 0.14% Deletion average length | 3.22 Insertion rate per base | 0.09% Insertion average length | 2.90 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1296951 % of reads mapped to multiple loci | 4.99% Number of reads mapped to too many loci | 44068 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.27% % of reads unmapped: other | 0.23% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3293704 3293704 3293704 N_multimapping 1296951 1296951 1296951 N_noFeature 518644 10935782 10850796 N_ambiguous 359582 102892 103204 UnstrandedReadsAssigned:20544348 PositiveStrandReadsAssigned:10383900 NegativeStrandReadsAssigned:10468574 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986247 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986247-trimmed-pair1.fastq SRR5986247-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 26,013,229 reads, 21,127,934 reads pseudoaligned [quant] estimated average fragment length: 235.021 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,194 rounds 52401 SRR5986247.ke.tsv 34699 SRR5986247.se.tsv 87100 total ==> SRR5986247.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1783.98 1132 24.0842 Potri.005G024800.1.v4.1 1035 800.979 484 22.9351 Potri.004G059700.1.v4.1 961 726.989 35 1.82733 Potri.007G009000.2.v4.1 1416 1181.98 0 0 Potri.003G141000.2.v4.1 2943 2708.98 442.103 6.19432 Potri.016G087400.1.v4.1 270 57.4377 965 637.685 Potri.015G069301.1.v4.1 564 330.095 0 0 Potri.010G195200.1.v4.1 1773 1538.98 231 5.69712 Potri.012G127500.1.v4.1 977 742.979 7296 372.721 ==> SRR5986247.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 91 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 258 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 44 SRR5986247 completed mapping pipeline successfully