Starting /dee2/code/volunteer_pipeline.sh SRR5986248 current disk space = 3086828081152 free memory = 1579902700 SRR5986248 SRAfilesize 05669a54cccee4b3fe442e74b0463e7b SRR5986248.sra SRR5986248.sra file validated SRR5986248 is paired end SRR5986248 is conventional basespace SRR5986248 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986248_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.45125 32.0 12.0 32.0 2.0 32.0 2 31.365 32.0 32.0 32.0 32.0 32.0 3 32.98875 32.0 32.0 37.0 27.0 37.0 4 35.1325 37.0 37.0 37.0 32.0 37.0 5 35.83875 37.0 37.0 37.0 32.0 37.0 6 39.1755 41.0 37.0 41.0 37.0 41.0 7 38.96525 41.0 37.0 41.0 37.0 41.0 8 39.3575 41.0 41.0 41.0 37.0 41.0 9 39.52475 41.0 41.0 41.0 37.0 41.0 10-14 39.18985 41.0 41.0 41.0 36.0 41.0 15-19 39.12165 41.0 40.2 41.0 36.0 41.0 20-24 39.33710000000001 41.0 41.0 41.0 37.0 41.0 25-29 38.580799999999996 41.0 39.4 41.0 32.0 41.0 30-34 38.681599999999996 41.0 39.4 41.0 34.0 41.0 35-39 38.12825 41.0 37.0 41.0 31.0 41.0 40-44 38.0252 41.0 37.0 41.0 31.0 41.0 45-49 37.1396 41.0 37.0 41.0 26.0 41.0 50-54 36.36295 41.0 36.0 41.0 24.0 41.0 55-59 36.547250000000005 41.0 36.0 41.0 25.0 41.0 60-64 36.73035 41.0 36.0 41.0 26.0 41.0 65-69 35.58105 40.2 33.0 41.0 21.0 41.0 70-74 37.277249999999995 41.0 37.0 41.0 27.0 41.0 75-79 36.9324 41.0 37.0 41.0 27.0 41.0 80-84 34.32815000000001 37.8 31.0 41.0 14.0 41.0 85-89 35.3682 40.2 32.0 41.0 20.0 41.0 90-94 36.40925000000001 41.0 35.0 41.0 24.0 41.0 95-99 35.12785 39.4 33.0 41.0 21.0 41.0 100-104 31.31345 34.0 25.0 41.0 14.0 41.0 105-109 33.362350000000006 37.8 28.0 41.0 16.0 41.0 110-114 33.636849999999995 37.8 29.0 41.0 18.0 41.0 115-119 35.10405 39.4 32.0 41.0 21.0 41.0 120-124 31.8154 36.8 25.0 41.0 14.0 41.0 125-129 31.486199999999997 36.0 25.0 40.2 12.0 41.0 130-134 30.90645 35.0 23.0 40.2 12.0 41.0 135-139 32.485699999999994 37.0 26.0 41.0 12.0 41.0 140-144 27.986649999999997 31.0 19.0 38.6 12.0 41.0 145-149 30.637800000000006 35.0 24.0 41.0 12.0 41.0 150 31.07575 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 1.0 19 0.0 20 6.0 21 9.0 22 20.0 23 24.0 24 53.0 25 61.0 26 65.0 27 87.0 28 123.0 29 132.0 30 167.0 31 193.0 32 183.0 33 243.0 34 263.0 35 279.0 36 321.0 37 330.0 38 402.0 39 559.0 40 478.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.871460388164177 19.599109131403118 18.61279032771238 33.916640152720326 2 23.925 27.325 33.975 14.774999999999999 3 20.455113778444613 31.207801950487625 26.63165791447862 21.705426356589147 4 22.95 37.275000000000006 20.625 19.15 5 22.2 37.574999999999996 22.775000000000002 17.45 6 16.725 38.15 24.875 20.25 7 15.425 16.525000000000002 45.7 22.35 8 18.2 22.425 27.825 31.55 9 20.150000000000002 22.275 30.0 27.575 10-14 21.14 30.654999999999998 26.69 21.515 15-19 21.355 28.32 28.09 22.235 20-24 21.615000000000002 28.82 27.589999999999996 21.975 25-29 20.695 28.799999999999997 27.694999999999997 22.81 30-34 21.075 29.505 27.625 21.795 35-39 21.315 28.99 27.150000000000002 22.545 40-44 21.145 29.075 27.595 22.185 45-49 21.115000000000002 28.58 28.09 22.215 50-54 21.099999999999998 28.63 28.015 22.255 55-59 21.095 28.689999999999998 27.38 22.835 60-64 21.43 28.854999999999997 27.450000000000003 22.264999999999997 65-69 21.310000000000002 28.375 27.750000000000004 22.564999999999998 70-74 21.65 28.999999999999996 26.66 22.689999999999998 75-79 20.785 28.744999999999997 27.68 22.79 80-84 21.36 28.865000000000002 27.939999999999998 21.834999999999997 85-89 21.18 28.499999999999996 28.194999999999997 22.125 90-94 21.685 28.09 27.474999999999998 22.75 95-99 21.6 27.950000000000003 28.025 22.425 100-104 21.765 27.834999999999997 28.58 21.82 105-109 21.634999999999998 28.215 28.375 21.775 110-114 21.785 28.43 27.800000000000004 21.985 115-119 21.785 28.060000000000002 27.99 22.165000000000003 120-124 21.375 28.965000000000003 28.23 21.43 125-129 21.83 28.095 28.875 21.2 130-134 21.91 28.615000000000002 28.194999999999997 21.279999999999998 135-139 21.65 28.49 27.96 21.9 140-144 21.685 28.835 28.694999999999997 20.785 145-149 22.025 28.525 27.495000000000005 21.955 150 20.775 28.125 29.425 21.675 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 2.5 22 6.0 23 4.5 24 3.5 25 5.0 26 6.0 27 8.0 28 14.0 29 19.5 30 29.0 31 34.0 32 43.5 33 55.5 34 72.0 35 94.0 36 100.5 37 116.5 38 149.0 39 188.0 40 207.5 41 224.5 42 235.5 43 247.0 44 243.5 45 242.5 46 253.5 47 230.5 48 205.0 49 173.0 50 149.0 51 129.5 52 118.5 53 97.0 54 68.5 55 59.5 56 43.5 57 32.5 58 22.5 59 14.0 60 11.0 61 10.0 62 10.0 63 5.5 64 2.5 65 1.5 66 1.0 67 1.0 68 1.5 69 1.0 70 0.0 71 1.0 72 1.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.425 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.75 #Duplication Level Percentage of deduplicated Percentage of total 1 95.74412532637075 91.675 2 4.073107049608355 7.8 3 0.18276762402088773 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0125 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.0875 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.2 0.0 0.0 0.0 0.0 114-115 0.2 0.0 0.0 0.0 0.0 116-117 0.3 0.0 0.0 0.0 0.0 118-119 0.3375 0.0 0.0 0.0 0.0 120-121 0.35 0.0 0.0 0.0 0.0 122-123 0.4125 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.5874999999999999 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.675 0.0 0.0 0.0 0.0 132-133 0.7625 0.0 0.0 0.0 0.0 134-135 0.7875000000000001 0.0 0.0 0.0 0.0 136-137 0.8625 0.0 0.0 0.0 0.0 138 0.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACATCCA 10 0.0070045046 143.7875 7 TCCACCT 10 0.0070045046 143.7875 7 AAAGCTA 10 0.0070045046 143.7875 2 ATTCATT 10 0.0070045046 143.7875 6 >>END_MODULE SRR5986248 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986248_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.7975 32.0 12.0 32.0 2.0 32.0 2 30.55375 32.0 32.0 32.0 27.0 32.0 3 31.4225 32.0 32.0 37.0 27.0 37.0 4 34.22 37.0 32.0 37.0 32.0 37.0 5 35.28875 37.0 37.0 37.0 32.0 37.0 6 38.56875 41.0 37.0 41.0 32.0 41.0 7 32.5455 37.0 27.0 41.0 12.0 41.0 8 37.60025 41.0 37.0 41.0 32.0 41.0 9 35.02725 41.0 32.0 41.0 12.0 41.0 10-14 36.28095 41.0 36.0 41.0 23.0 41.0 15-19 33.96855 37.6 28.0 41.0 20.0 41.0 20-24 34.936400000000006 39.4 32.0 41.0 21.0 41.0 25-29 34.77905 39.4 32.0 41.0 21.0 41.0 30-34 29.788999999999998 33.0 21.0 40.2 12.0 41.0 35-39 33.720800000000004 37.4 29.0 40.2 19.0 41.0 40-44 29.18735 30.8 22.0 37.6 15.0 40.2 45-49 30.80585 34.0 21.0 40.2 12.0 41.0 50-54 31.99835 35.8 25.0 41.0 16.0 41.0 55-59 29.750400000000003 32.0 17.0 39.4 14.0 41.0 60-64 29.28675 32.0 19.0 40.2 14.0 41.0 65-69 27.1502 27.0 18.0 38.4 12.0 40.2 70-74 27.75015 28.0 18.0 37.6 12.0 41.0 75-79 30.798249999999996 35.0 21.0 41.0 12.0 41.0 80-84 28.29685 32.0 16.0 39.2 12.0 41.0 85-89 29.542900000000003 33.0 20.0 40.2 12.0 41.0 90-94 24.781 25.0 14.0 35.0 12.0 40.2 95-99 24.4281 24.0 12.0 35.0 12.0 39.4 100-104 23.668800000000005 21.0 12.0 35.0 12.0 39.4 105-109 24.691200000000002 24.0 12.0 35.0 12.0 39.4 110-114 25.798750000000002 27.0 14.0 35.0 12.0 41.0 115-119 24.7555 25.0 12.0 36.0 12.0 41.0 120-124 23.097550000000002 22.0 12.0 33.0 12.0 40.2 125-129 22.2442 20.0 12.0 30.0 12.0 37.8 130-134 21.645950000000003 19.0 12.0 31.0 11.2 38.6 135-139 21.202499999999997 18.0 12.0 29.0 12.0 37.0 140-144 21.559250000000002 20.0 12.0 30.0 12.0 37.0 145-149 19.2628 16.0 12.0 25.0 11.2 34.0 150 18.99975 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 15.0 16 57.0 17 100.0 18 133.0 19 150.0 20 191.0 21 172.0 22 196.0 23 200.0 24 176.0 25 187.0 26 201.0 27 167.0 28 219.0 29 188.0 30 203.0 31 244.0 32 201.0 33 212.0 34 195.0 35 195.0 36 156.0 37 143.0 38 68.0 39 25.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.196721311475407 19.475409836065573 19.672131147540984 32.65573770491803 2 25.85 26.25 33.625 14.274999999999999 3 21.975 31.7 26.5 19.825 4 21.95 36.3 21.05 20.7 5 22.025 38.925 21.375 17.675 6 16.625 39.175 24.6 19.6 7 17.349999999999998 16.075 44.574999999999996 22.0 8 19.650000000000002 22.45 28.449999999999996 29.45 9 22.0 22.825 29.15 26.025 10-14 20.73 29.225 27.98 22.065 15-19 22.625 27.834999999999997 28.395 21.145 20-24 21.325 29.134999999999998 28.134999999999998 21.404999999999998 25-29 21.654999999999998 29.09 27.96 21.295 30-34 22.63 29.160000000000004 28.525 19.685 35-39 22.415 29.215000000000003 28.03 20.34 40-44 22.945 31.419999999999998 28.76 16.875 45-49 22.814999999999998 28.935 28.22 20.03 50-54 22.74 29.099999999999998 28.199999999999996 19.96 55-59 22.865 29.794999999999998 28.384999999999998 18.955 60-64 23.06 28.744999999999997 29.555 18.64 65-69 23.080000000000002 29.404999999999998 29.99 17.525 70-74 24.19 28.945 29.049999999999997 17.815 75-79 22.41 28.000000000000004 29.2 20.39 80-84 21.91 29.659999999999997 30.45 17.98 85-89 21.98 28.634999999999998 29.365000000000002 20.02 90-94 22.235 29.770000000000003 31.605 16.39 95-99 23.080000000000002 29.775000000000002 30.04 17.105 100-104 22.564999999999998 29.025000000000002 30.769999999999996 17.64 105-109 22.75 28.57 31.31 17.37 110-114 23.419999999999998 28.7 29.220000000000002 18.66 115-119 22.48 28.975 29.965000000000003 18.58 120-124 22.055 29.470000000000002 30.15 18.325 125-129 23.494999999999997 28.21 30.64 17.655 130-134 23.515 28.895 30.34 17.25 135-139 23.735 28.685 30.59 16.99 140-144 23.59 28.485 30.0 17.925 145-149 24.759999999999998 28.560000000000002 30.495 16.185 150 23.674999999999997 28.275 32.25 15.8 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.5 19 2.5 20 3.5 21 4.0 22 3.0 23 3.0 24 7.0 25 12.0 26 15.5 27 22.0 28 29.0 29 34.0 30 39.5 31 54.5 32 73.0 33 79.5 34 100.0 35 130.5 36 148.5 37 156.0 38 185.5 39 204.5 40 200.5 41 206.0 42 224.0 43 261.5 44 264.5 45 237.0 46 226.0 47 204.0 48 172.0 49 151.5 50 122.5 51 92.0 52 79.0 53 63.5 54 44.5 55 36.5 56 29.5 57 22.5 58 15.5 59 11.0 60 7.5 61 5.0 62 4.5 63 4.0 64 2.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44695827048768 98.9 2 0.5530417295123178 1.0999999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.025 0.0 0.0 0.0 0.0 108-109 0.025 0.0 0.0 0.0 0.0 110-111 0.025 0.0 0.0 0.0 0.0 112-113 0.025 0.0 0.0 0.0 0.0 114-115 0.025 0.0 0.0 0.0 0.0 116-117 0.125 0.0 0.0 0.0 0.0 118-119 0.15 0.0 0.0 0.0 0.0 120-121 0.175 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.3125 0.0 0.0 0.0 0.0 126-127 0.3875 0.0 0.0 0.0 0.0 128-129 0.4 0.0 0.0 0.0 0.0 130-131 0.425 0.0 0.0 0.0 0.0 132-133 0.4875 0.0 0.0 0.0 0.0 134-135 0.525 0.0 0.0 0.0 0.0 136-137 0.575 0.0 0.0 0.0 0.0 138 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263303 spots for SRR5986248.sra Written 1263303 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra Read 1263284 spots for SRR5986248.sra Written 1263284 spots for SRR5986248.sra SRR ids: ['SRR5986248.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_v95_r118 SRR5986248.sra spots: 25265699 blocks: [[1, 1263284], [1263285, 2526568], [2526569, 3789852], [3789853, 5053136], [5053137, 6316420], [6316421, 7579704], [7579705, 8842988], [8842989, 10106272], [10106273, 11369556], [11369557, 12632840], [12632841, 13896124], [13896125, 15159408], [15159409, 16422692], [16422693, 17685976], [17685977, 18949260], [18949261, 20212544], [20212545, 21475828], [21475829, 22739112], [22739113, 24002396], [24002397, 25265699]] SRR5986248 file size 8490668 SRR5986248 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986248 SRR5986248_1.fastq SRR5986248_2.fastq Input file: SRR5986248_1.fastq Paired file: SRR5986248_2.fastq trimmed: SRR5986248-trimmed-pair1.fastq, SRR5986248-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:04:51 2025 >> started Fri Feb 14 05:05:16 2025 >> done (25.978s) 25265699 read pairs processed; of these: 219 ( 0.00%) short read pairs filtered out after trimming by size control 215 ( 0.00%) empty read pairs filtered out after trimming by size control 25265265 (100.00%) read pairs available; of these: 2048944 ( 8.11%) trimmed read pairs available after processing 23216321 (91.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 24 0.00% 19 26 0.00% 20 34 0.00% 21 36 0.00% 22 30 0.00% 23 33 0.00% 24 26 0.00% 25 43 0.00% 26 53 0.00% 27 53 0.00% 28 75 0.00% 29 43 0.00% 30 68 0.00% 31 66 0.00% 32 53 0.00% 33 55 0.00% 34 57 0.00% 35 70 0.00% 36 63 0.00% 37 64 0.00% 38 65 0.00% 39 66 0.00% 40 57 0.00% 41 64 0.00% 42 59 0.00% 43 76 0.00% 44 63 0.00% 45 68 0.00% 46 86 0.00% 47 69 0.00% 48 71 0.00% 49 77 0.00% 50 78 0.00% 51 81 0.00% 52 95 0.00% 53 98 0.00% 54 91 0.00% 55 92 0.00% 56 89 0.00% 57 81 0.00% 58 103 0.00% 59 135 0.00% 60 106 0.00% 61 121 0.00% 62 127 0.00% 63 104 0.00% 64 133 0.00% 65 139 0.00% 66 130 0.00% 67 148 0.00% 68 165 0.00% 69 179 0.00% 70 174 0.00% 71 159 0.00% 72 196 0.00% 73 189 0.00% 74 243 0.00% 75 221 0.00% 76 274 0.00% 77 280 0.00% 78 283 0.00% 79 300 0.00% 80 317 0.00% 81 393 0.00% 82 416 0.00% 83 484 0.00% 84 519 0.00% 85 525 0.00% 86 531 0.00% 87 631 0.00% 88 642 0.00% 89 740 0.00% 90 826 0.00% 91 879 0.00% 92 937 0.00% 93 986 0.00% 94 1062 0.00% 95 1114 0.00% 96 1269 0.01% 97 1379 0.01% 98 1417 0.01% 99 1566 0.01% 100 1661 0.01% 101 1818 0.01% 102 1987 0.01% 103 2174 0.01% 104 2308 0.01% 105 2515 0.01% 106 2642 0.01% 107 2855 0.01% 108 2770 0.01% 109 3144 0.01% 110 3407 0.01% 111 3497 0.01% 112 3614 0.01% 113 3981 0.02% 114 4213 0.02% 115 4530 0.02% 116 4709 0.02% 117 4804 0.02% 118 5041 0.02% 119 5331 0.02% 120 5654 0.02% 121 6010 0.02% 122 6426 0.03% 123 6691 0.03% 124 7170 0.03% 125 7527 0.03% 126 7843 0.03% 127 8160 0.03% 128 8439 0.03% 129 8916 0.04% 130 9278 0.04% 131 9897 0.04% 132 10458 0.04% 133 10972 0.04% 134 11915 0.05% 135 12357 0.05% 136 13068 0.05% 137 13549 0.05% 138 13931 0.06% 139 14847 0.06% 140 15203 0.06% 141 16261 0.06% 142 16983 0.07% 143 17800 0.07% 144 19224 0.08% 145 21865 0.09% 146 29027 0.11% 147 54624 0.22% 148 180461 0.71% 149 1394347 5.52% 150 23216321 91.89% 25265265 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.2 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=354.30 fanout-score-rank=1 prefix-density=0.60 prefix-fanout=31.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=30 prefix-density=0.21 prefix-fanout=2.2 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=422.90 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=33.7 sequence=CTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAG SRR5986248 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:06:25 Started mapping on | Feb 14 05:06:25 Finished on | Feb 14 05:13:12 Mapping speed, Million of reads per hour | 223.48 Number of input reads | 25265265 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 21126386 Uniquely mapped reads % | 83.62% Average mapped length | 288.56 Number of splices: Total | 19276507 Number of splices: Annotated (sjdb) | 18672894 Number of splices: GT/AG | 18815551 Number of splices: GC/AG | 271959 Number of splices: AT/AC | 19296 Number of splices: Non-canonical | 169701 Mismatch rate per base, % | 2.14% Deletion rate per base | 0.14% Deletion average length | 3.21 Insertion rate per base | 0.09% Insertion average length | 2.87 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1199831 % of reads mapped to multiple loci | 4.75% Number of reads mapped to too many loci | 33823 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.26% % of reads unmapped: other | 0.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2939048 2939048 2939048 N_multimapping 1199831 1199831 1199831 N_noFeature 715316 10844782 10786072 N_ambiguous 424804 107053 108170 UnstrandedReadsAssigned:19986266 PositiveStrandReadsAssigned:10174551 NegativeStrandReadsAssigned:10232144 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986248 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986248-trimmed-pair1.fastq SRR5986248-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,265,265 reads, 20,305,583 reads pseudoaligned [quant] estimated average fragment length: 238.361 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR5986248.ke.tsv 34699 SRR5986248.se.tsv 87100 total ==> SRR5986248.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1780.64 1239 25.5387 Potri.005G024800.1.v4.1 1035 797.639 742 34.143 Potri.004G059700.1.v4.1 961 723.644 22 1.11584 Potri.007G009000.2.v4.1 1416 1178.64 1 0.0311403 Potri.003G141000.2.v4.1 2943 2705.64 320.125 4.34265 Potri.016G087400.1.v4.1 270 54.2097 819 554.512 Potri.015G069301.1.v4.1 564 326.766 0 0 Potri.010G195200.1.v4.1 1773 1535.64 68 1.62526 Potri.012G127500.1.v4.1 977 739.644 2156 106.987 ==> SRR5986248.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 7 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR5986248 completed mapping pipeline successfully