Starting /dee2/code/volunteer_pipeline.sh SRR5986249 current disk space = 3088142438400 free memory = 1415944612 SRR5986249 SRAfilesize ba2df6400a32337c17072681257602d9 SRR5986249.sra SRR5986249.sra file validated SRR5986249 is paired end SRR5986249 is conventional basespace SRR5986249 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986249_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.455 32.0 27.0 32.0 2.0 32.0 2 31.41375 32.0 32.0 32.0 32.0 32.0 3 33.37125 32.0 32.0 37.0 32.0 37.0 4 35.20625 37.0 37.0 37.0 32.0 37.0 5 35.93125 37.0 37.0 37.0 32.0 37.0 6 39.27075 41.0 41.0 41.0 37.0 41.0 7 39.10075 41.0 41.0 41.0 37.0 41.0 8 39.55525 41.0 41.0 41.0 37.0 41.0 9 39.63575 41.0 41.0 41.0 37.0 41.0 10-14 39.333749999999995 41.0 41.0 41.0 37.0 41.0 15-19 39.3132 41.0 41.0 41.0 36.0 41.0 20-24 39.482949999999995 41.0 41.0 41.0 37.0 41.0 25-29 38.924400000000006 41.0 39.4 41.0 35.0 41.0 30-34 38.9399 41.0 40.2 41.0 35.0 41.0 35-39 38.45465 41.0 38.6 41.0 32.0 41.0 40-44 38.5026 41.0 40.2 41.0 33.0 41.0 45-49 37.558749999999996 41.0 37.0 41.0 29.0 41.0 50-54 36.8466 41.0 37.0 41.0 26.0 41.0 55-59 37.148799999999994 41.0 37.0 41.0 26.0 41.0 60-64 37.11735 41.0 36.0 41.0 27.0 41.0 65-69 36.117399999999996 40.2 35.0 41.0 23.0 41.0 70-74 37.71015 41.0 37.0 41.0 30.0 41.0 75-79 37.398700000000005 41.0 37.0 41.0 28.0 41.0 80-84 34.82605 39.4 33.0 41.0 18.0 41.0 85-89 35.9286 41.0 36.0 41.0 22.0 41.0 90-94 36.837599999999995 41.0 37.0 41.0 26.0 41.0 95-99 35.59655 40.2 33.0 41.0 22.0 41.0 100-104 32.1015 36.8 25.0 41.0 14.0 41.0 105-109 33.98524999999999 38.6 30.0 41.0 16.0 41.0 110-114 34.2545 39.4 30.0 41.0 18.0 41.0 115-119 35.632349999999995 40.2 34.0 41.0 23.0 41.0 120-124 32.549600000000005 37.8 26.0 41.0 15.0 41.0 125-129 32.010999999999996 36.0 26.0 40.2 12.0 41.0 130-134 31.3986 36.0 23.0 40.2 12.0 41.0 135-139 33.08285 37.0 29.0 41.0 12.0 41.0 140-144 28.628700000000002 32.0 21.0 37.6 12.0 41.0 145-149 31.6178 36.0 26.0 41.0 12.0 41.0 150 31.82425 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 3.0 21 9.0 22 10.0 23 21.0 24 43.0 25 38.0 26 77.0 27 76.0 28 97.0 29 120.0 30 130.0 31 177.0 32 156.0 33 240.0 34 251.0 35 273.0 36 324.0 37 354.0 38 447.0 39 590.0 40 562.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.66087221713937 19.12168344007319 19.09118633729796 34.12625800548948 2 23.849999999999998 26.125 35.0 15.024999999999999 3 19.984992496248125 30.890445222611305 28.8144072036018 20.31015507753877 4 22.15 36.449999999999996 21.4 20.0 5 23.825 36.575 21.825 17.775 6 16.675 38.525 24.425 20.375 7 16.05 17.299999999999997 43.775 22.875 8 20.3 21.65 28.9 29.15 9 20.424999999999997 22.725 29.875 26.974999999999998 10-14 21.18 29.735 26.965 22.12 15-19 21.3 27.76 28.68 22.259999999999998 20-24 21.09 29.125 27.839999999999996 21.945 25-29 21.545 28.93 27.644999999999996 21.88 30-34 20.985 28.715000000000003 28.634999999999998 21.665 35-39 20.66 28.939999999999998 27.584999999999997 22.814999999999998 40-44 21.015 28.79 28.335 21.86 45-49 21.305 28.465 27.775 22.455 50-54 20.965 29.160000000000004 27.52 22.355 55-59 20.995 28.794999999999998 27.42 22.79 60-64 21.665 28.58 27.584999999999997 22.17 65-69 21.795 28.255000000000003 27.63 22.32 70-74 21.72 28.51 27.3 22.470000000000002 75-79 21.605 28.87 27.73 21.795 80-84 21.295 28.084999999999997 28.660000000000004 21.959999999999997 85-89 22.075 28.275 27.375 22.275 90-94 21.154999999999998 28.675 28.105000000000004 22.065 95-99 21.565 28.46 28.32 21.654999999999998 100-104 21.565 28.749999999999996 28.144999999999996 21.54 105-109 21.725 27.88 27.73 22.665 110-114 21.765 28.560000000000002 28.275 21.4 115-119 21.895 27.83 28.955 21.32 120-124 22.155 27.93 28.525 21.39 125-129 21.8 28.384999999999998 28.705000000000002 21.11 130-134 21.675 28.384999999999998 29.2 20.74 135-139 21.95 27.82 28.175 22.055 140-144 21.795 29.255 29.189999999999998 19.759999999999998 145-149 21.81 28.499999999999996 27.744999999999997 21.945 150 21.275 28.375 29.049999999999997 21.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.5 17 1.5 18 0.0 19 0.0 20 0.5 21 1.5 22 3.0 23 2.0 24 3.5 25 5.5 26 7.0 27 8.5 28 12.0 29 18.5 30 24.5 31 30.0 32 35.5 33 47.0 34 62.0 35 85.0 36 116.0 37 135.5 38 152.5 39 177.5 40 202.5 41 230.0 42 250.5 43 267.5 44 275.0 45 260.0 46 260.5 47 230.5 48 185.5 49 157.0 50 142.0 51 137.0 52 109.0 53 82.0 54 62.5 55 58.0 56 43.0 57 27.0 58 22.0 59 16.0 60 12.0 61 8.5 62 7.0 63 6.0 64 3.0 65 1.5 66 1.5 67 0.5 68 0.5 69 1.0 70 0.5 71 1.0 72 2.5 73 1.5 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 18.025 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.75072540226853 89.8 2 4.985491954629386 9.45 3 0.2637826431020839 0.75 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0125 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.175 0.0 0.0 0.0 0.0 116-117 0.2 0.0 0.0 0.0 0.0 118-119 0.25 0.0 0.0 0.0 0.0 120-121 0.3125 0.0 0.0 0.0 0.0 122-123 0.325 0.0 0.0 0.0 0.0 124-125 0.3625 0.0 0.0 0.0 0.0 126-127 0.4125 0.0 0.0 0.0 0.0 128-129 0.5375 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.8374999999999999 0.0 0.0 0.0 0.0 136-137 0.8875 0.0 0.0 0.0 0.0 138 0.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGACTT 10 0.006997227 143.8375 2 >>END_MODULE SRR5986249 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986249_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.885 32.0 12.0 32.0 2.0 32.0 2 30.72125 32.0 32.0 32.0 32.0 32.0 3 32.145 32.0 32.0 37.0 27.0 37.0 4 34.87125 37.0 32.0 37.0 32.0 37.0 5 35.69875 37.0 37.0 37.0 32.0 37.0 6 38.9035 41.0 37.0 41.0 37.0 41.0 7 33.6595 37.0 32.0 41.0 12.0 41.0 8 38.04725 41.0 37.0 41.0 32.0 41.0 9 35.53025 41.0 32.0 41.0 22.0 41.0 10-14 36.8435 41.0 36.0 41.0 25.0 41.0 15-19 34.6132 39.4 32.0 41.0 21.0 41.0 20-24 35.58345 39.4 32.0 41.0 21.0 41.0 25-29 35.4449 40.2 33.0 41.0 21.0 41.0 30-34 30.4536 34.8 22.0 40.2 14.0 41.0 35-39 34.332300000000004 39.2 31.0 41.0 20.0 41.0 40-44 29.7211 32.8 23.0 37.6 15.0 40.2 45-49 31.328149999999994 35.8 24.0 40.2 12.0 41.0 50-54 32.5644 37.8 26.0 41.0 16.0 41.0 55-59 30.306 34.0 18.0 41.0 14.0 41.0 60-64 29.8296 33.0 19.0 40.2 14.0 41.0 65-69 27.648649999999996 28.0 18.0 38.4 12.0 40.2 70-74 28.1091 29.0 19.0 37.6 12.0 40.2 75-79 31.16735 35.0 22.0 41.0 14.0 41.0 80-84 28.688299999999998 32.0 18.0 39.2 12.0 41.0 85-89 30.06175 34.0 20.0 40.2 12.0 41.0 90-94 25.2164 25.0 14.0 35.0 12.0 40.2 95-99 24.9777 24.0 14.0 36.0 12.0 41.0 100-104 24.3635 23.0 12.0 36.0 12.0 40.2 105-109 25.1115 26.0 14.0 35.0 12.0 40.2 110-114 26.17815 28.0 16.0 35.0 12.0 41.0 115-119 25.070249999999998 26.0 12.0 36.0 12.0 41.0 120-124 23.708949999999998 22.0 12.0 34.0 12.0 40.2 125-129 22.6279 21.0 12.0 32.0 12.0 37.8 130-134 22.17845 20.0 12.0 31.0 12.0 38.6 135-139 21.577000000000005 20.0 12.0 29.0 12.0 37.0 140-144 21.865750000000002 20.0 12.0 31.0 12.0 37.0 145-149 19.345599999999997 16.0 12.0 27.0 11.2 33.0 150 19.4125 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 8.0 16 38.0 17 86.0 18 124.0 19 175.0 20 152.0 21 179.0 22 181.0 23 189.0 24 178.0 25 159.0 26 178.0 27 162.0 28 191.0 29 216.0 30 227.0 31 200.0 32 220.0 33 241.0 34 211.0 35 220.0 36 188.0 37 158.0 38 95.0 39 21.0 40 3.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.903327055869433 18.89516635279347 19.02071563088512 34.18079096045198 2 24.2 25.8 35.25 14.75 3 21.175 30.075000000000003 28.625 20.125 4 22.425 34.975 22.650000000000002 19.950000000000003 5 22.875 36.475 22.625 18.025 6 15.775 38.324999999999996 24.525 21.375 7 17.575 17.175 43.325 21.925 8 19.6 21.825 28.275 30.3 9 20.375 23.925 29.849999999999998 25.85 10-14 21.015 30.104999999999997 26.495 22.384999999999998 15-19 22.185 28.634999999999998 28.34 20.84 20-24 21.92 28.754999999999995 28.175 21.15 25-29 21.86 29.485 27.54 21.115000000000002 30-34 21.755 29.580000000000002 28.720000000000002 19.945 35-39 21.995 29.165000000000003 28.435 20.405 40-44 22.435 30.81 29.134999999999998 17.62 45-49 22.725 29.205 28.499999999999996 19.57 50-54 21.834999999999997 29.25 28.225 20.69 55-59 22.555 29.835 28.025 19.585 60-64 22.115000000000002 29.770000000000003 28.93 19.185 65-69 22.845 29.805 29.054999999999996 18.295 70-74 24.175 29.42 28.13 18.275 75-79 22.085 28.465 29.509999999999998 19.939999999999998 80-84 21.765 29.315 30.69 18.23 85-89 22.235 27.994999999999997 29.735 20.035 90-94 21.584999999999997 30.095 31.7 16.619999999999997 95-99 22.48 29.54 30.135 17.845 100-104 22.939999999999998 29.24 30.335 17.485 105-109 21.87 28.95 31.155 18.025 110-114 22.42 29.330000000000002 29.459999999999997 18.790000000000003 115-119 22.68 28.895 29.935000000000002 18.490000000000002 120-124 22.145 29.34 29.94 18.575 125-129 22.66 28.884999999999998 30.415 18.04 130-134 23.32 28.360000000000003 30.85 17.47 135-139 23.25 28.754999999999995 30.89 17.105 140-144 23.23 28.804999999999996 30.06 17.904999999999998 145-149 23.75 28.595 30.975 16.68 150 22.5 28.975 33.7 14.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.5 17 1.5 18 1.0 19 3.0 20 3.0 21 3.5 22 4.5 23 4.0 24 10.5 25 12.0 26 10.5 27 18.0 28 29.5 29 34.0 30 36.5 31 48.5 32 72.0 33 96.5 34 100.5 35 107.5 36 145.0 37 182.0 38 196.5 39 215.5 40 229.5 41 230.0 42 222.5 43 227.0 44 240.0 45 243.0 46 222.0 47 195.5 48 164.0 49 128.0 50 113.5 51 98.5 52 75.5 53 56.0 54 48.5 55 42.5 56 30.0 57 20.5 58 20.0 59 13.5 60 9.5 61 7.5 62 4.5 63 5.0 64 3.5 65 2.0 66 2.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 1.5 74 1.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 20.349999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.83662114314619 97.7 2 1.163378856853819 2.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.025 0.0 0.0 0.0 0.0 98-99 0.025 0.0 0.0 0.0 0.0 100-101 0.037500000000000006 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.05 0.0 0.0 0.0 0.0 106-107 0.05 0.0 0.0 0.0 0.0 108-109 0.05 0.0 0.0 0.0 0.0 110-111 0.1 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.125 0.0 0.0 0.0 0.0 116-117 0.15 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.2625 0.0 0.0 0.0 0.0 122-123 0.275 0.0 0.0 0.0 0.0 124-125 0.2875 0.0 0.0 0.0 0.0 126-127 0.325 0.0 0.0 0.0 0.0 128-129 0.38749999999999996 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.4875 0.0 0.0 0.0 0.0 134-135 0.5 0.0 0.0 0.0 0.0 136-137 0.5625 0.0 0.0 0.0 0.0 138 0.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra Read 1060101 spots for SRR5986249.sra Written 1060101 spots for SRR5986249.sra Read 1060084 spots for SRR5986249.sra Written 1060084 spots for SRR5986249.sra SRR ids: ['SRR5986249.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_as0dm1iq SRR5986249.sra spots: 21201697 blocks: [[1, 1060084], [1060085, 2120168], [2120169, 3180252], [3180253, 4240336], [4240337, 5300420], [5300421, 6360504], [6360505, 7420588], [7420589, 8480672], [8480673, 9540756], [9540757, 10600840], [10600841, 11660924], [11660925, 12721008], [12721009, 13781092], [13781093, 14841176], [14841177, 15901260], [15901261, 16961344], [16961345, 18021428], [18021429, 19081512], [19081513, 20141596], [20141597, 21201697]] SRR5986249 file size 7121449 SRR5986249 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986249 SRR5986249_1.fastq SRR5986249_2.fastq Input file: SRR5986249_1.fastq Paired file: SRR5986249_2.fastq trimmed: SRR5986249-trimmed-pair1.fastq, SRR5986249-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 03:44:37 2025 >> started Fri Feb 14 03:45:14 2025 >> done (36.711s) 21201697 read pairs processed; of these: 266 ( 0.00%) short read pairs filtered out after trimming by size control 255 ( 0.00%) empty read pairs filtered out after trimming by size control 21201176 (100.00%) read pairs available; of these: 1734369 ( 8.18%) trimmed read pairs available after processing 19466807 (91.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 27 0.00% 20 33 0.00% 21 31 0.00% 22 41 0.00% 23 33 0.00% 24 46 0.00% 25 32 0.00% 26 42 0.00% 27 64 0.00% 28 62 0.00% 29 44 0.00% 30 46 0.00% 31 52 0.00% 32 53 0.00% 33 60 0.00% 34 60 0.00% 35 63 0.00% 36 47 0.00% 37 60 0.00% 38 73 0.00% 39 54 0.00% 40 66 0.00% 41 68 0.00% 42 48 0.00% 43 56 0.00% 44 78 0.00% 45 79 0.00% 46 57 0.00% 47 66 0.00% 48 57 0.00% 49 75 0.00% 50 77 0.00% 51 83 0.00% 52 76 0.00% 53 108 0.00% 54 98 0.00% 55 81 0.00% 56 77 0.00% 57 99 0.00% 58 111 0.00% 59 107 0.00% 60 97 0.00% 61 110 0.00% 62 114 0.00% 63 100 0.00% 64 112 0.00% 65 94 0.00% 66 119 0.00% 67 132 0.00% 68 137 0.00% 69 147 0.00% 70 153 0.00% 71 173 0.00% 72 167 0.00% 73 163 0.00% 74 173 0.00% 75 196 0.00% 76 211 0.00% 77 221 0.00% 78 213 0.00% 79 263 0.00% 80 244 0.00% 81 279 0.00% 82 287 0.00% 83 339 0.00% 84 347 0.00% 85 369 0.00% 86 419 0.00% 87 453 0.00% 88 479 0.00% 89 527 0.00% 90 614 0.00% 91 665 0.00% 92 748 0.00% 93 809 0.00% 94 817 0.00% 95 911 0.00% 96 1021 0.00% 97 1121 0.01% 98 1128 0.01% 99 1307 0.01% 100 1365 0.01% 101 1480 0.01% 102 1733 0.01% 103 1800 0.01% 104 2005 0.01% 105 2085 0.01% 106 2178 0.01% 107 2395 0.01% 108 2502 0.01% 109 2808 0.01% 110 2871 0.01% 111 3144 0.01% 112 3315 0.02% 113 3593 0.02% 114 3935 0.02% 115 4159 0.02% 116 4446 0.02% 117 4543 0.02% 118 4859 0.02% 119 5067 0.02% 120 5260 0.02% 121 5624 0.03% 122 6131 0.03% 123 6594 0.03% 124 7069 0.03% 125 7470 0.04% 126 7878 0.04% 127 8207 0.04% 128 8505 0.04% 129 8949 0.04% 130 9317 0.04% 131 9702 0.05% 132 10334 0.05% 133 11121 0.05% 134 11784 0.06% 135 12561 0.06% 136 13078 0.06% 137 13998 0.07% 138 14214 0.07% 139 15028 0.07% 140 15879 0.07% 141 16393 0.08% 142 17666 0.08% 143 18382 0.09% 144 19799 0.09% 145 22207 0.10% 146 28544 0.13% 147 48930 0.23% 148 148545 0.70% 149 1126325 5.31% 150 19466807 91.82% 21201176 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=33 prefix-density=0.19 prefix-fanout=2.1 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=459.64 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=35.0 sequence=CTTCTTCTTTTTATTTATTATAGTTCCATAAAACTGCTTGGTTGGAGCCATGCGGCGACGTTTTCTCATTTGCAGGAGCATGGATCACAGGTGCAGTTTGATCCACATTTGCAGCCATTCTCAGCACCAAAG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.32 fanout-score-rank=28 prefix-density=0.20 prefix-fanout=2.2 sequence=TAAGCTTAATCAATCAATCATCATGTCTAGCGCCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACTCTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAAGTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTACCATGTGTGATGTGGGAT criterion=fanout-score sequence-density=0.04 sequence-density-rank=22 fanout-score=422.11 fanout-score-rank=1 prefix-density=0.53 prefix-fanout=36.1 sequence=TTCTTCTTCTTT SRR5986249 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 03:47:16 Started mapping on | Feb 14 03:47:17 Finished on | Feb 14 03:54:21 Mapping speed, Million of reads per hour | 180.01 Number of input reads | 21201176 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 17522917 Uniquely mapped reads % | 82.65% Average mapped length | 281.08 Number of splices: Total | 15540742 Number of splices: Annotated (sjdb) | 15044790 Number of splices: GT/AG | 15167934 Number of splices: GC/AG | 218339 Number of splices: AT/AC | 15265 Number of splices: Non-canonical | 139204 Mismatch rate per base, % | 2.14% Deletion rate per base | 0.13% Deletion average length | 3.17 Insertion rate per base | 0.09% Insertion average length | 2.84 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 964963 % of reads mapped to multiple loci | 4.55% Number of reads mapped to too many loci | 82695 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.06% % of reads unmapped: other | 0.35% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2713297 2713297 2713297 N_multimapping 964963 964963 964963 N_noFeature 655763 9037169 8978829 N_ambiguous 345550 91618 92343 UnstrandedReadsAssigned:16521604 PositiveStrandReadsAssigned:8394130 NegativeStrandReadsAssigned:8451745 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR5986249 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986249-trimmed-pair1.fastq SRR5986249-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,201,176 reads, 17,065,544 reads pseudoaligned [quant] estimated average fragment length: 222.155 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,128 rounds 52401 SRR5986249.ke.tsv 34699 SRR5986249.se.tsv 87100 total ==> SRR5986249.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1796.84 1256 31.5347 Potri.005G024800.1.v4.1 1035 813.845 668 37.0292 Potri.004G059700.1.v4.1 961 739.855 33 2.01223 Potri.007G009000.2.v4.1 1416 1194.84 2 0.0755141 Potri.003G141000.2.v4.1 2943 2721.84 259 4.29285 Potri.016G087400.1.v4.1 270 62.4794 592 427.459 Potri.015G069301.1.v4.1 564 342.977 0 0 Potri.010G195200.1.v4.1 1773 1551.84 30 0.872133 Potri.012G127500.1.v4.1 977 755.855 1584 94.5423 ==> SRR5986249.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 8 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR5986249 completed mapping pipeline successfully