Starting /dee2/code/volunteer_pipeline.sh SRR5986250 current disk space = 3087707967488 free memory = 1487648228 SRR5986250 SRAfilesize b837dbee271ca0154ffe0005e2d9dafd SRR5986250.sra SRR5986250.sra file validated SRR5986250 is paired end SRR5986250 is conventional basespace SRR5986250 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986250_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.04125 32.0 12.0 32.0 2.0 32.0 2 31.5 32.0 32.0 32.0 32.0 32.0 3 33.06875 32.0 32.0 37.0 27.0 37.0 4 35.095 37.0 37.0 37.0 32.0 37.0 5 35.91625 37.0 37.0 37.0 32.0 37.0 6 39.2425 41.0 41.0 41.0 37.0 41.0 7 39.13925 41.0 37.0 41.0 37.0 41.0 8 39.38575 41.0 41.0 41.0 37.0 41.0 9 39.63 41.0 41.0 41.0 37.0 41.0 10-14 39.32985 41.0 41.0 41.0 36.0 41.0 15-19 39.41645 41.0 41.0 41.0 36.0 41.0 20-24 39.5178 41.0 41.0 41.0 37.0 41.0 25-29 38.965250000000005 41.0 39.4 41.0 35.0 41.0 30-34 38.9003 41.0 39.4 41.0 35.0 41.0 35-39 38.43775 41.0 38.6 41.0 33.0 41.0 40-44 38.425749999999994 41.0 39.4 41.0 33.0 41.0 45-49 37.50645 41.0 37.0 41.0 29.0 41.0 50-54 36.6362 41.0 37.0 41.0 25.0 41.0 55-59 36.96725 41.0 37.0 41.0 26.0 41.0 60-64 37.18225 41.0 36.0 41.0 28.0 41.0 65-69 35.9602 40.2 35.0 41.0 22.0 41.0 70-74 37.6179 41.0 37.0 41.0 30.0 41.0 75-79 37.31365 41.0 37.0 41.0 28.0 41.0 80-84 34.7564 39.4 32.0 41.0 18.0 41.0 85-89 35.7176 40.2 33.0 41.0 22.0 41.0 90-94 36.8381 41.0 37.0 41.0 26.0 41.0 95-99 35.432249999999996 39.4 33.0 41.0 22.0 41.0 100-104 31.783050000000003 36.8 25.0 41.0 14.0 41.0 105-109 33.7901 38.6 30.0 41.0 16.0 41.0 110-114 34.071000000000005 38.6 30.0 41.0 18.0 41.0 115-119 35.553399999999996 40.2 34.0 41.0 23.0 41.0 120-124 32.246050000000004 37.8 26.0 41.0 15.0 41.0 125-129 31.942499999999995 36.0 25.0 40.2 12.0 41.0 130-134 31.31325 36.0 25.0 40.2 12.0 41.0 135-139 32.77415 37.0 28.0 41.0 12.0 41.0 140-144 28.12135 31.0 20.0 37.6 12.0 41.0 145-149 31.2957 35.0 25.0 41.0 12.0 41.0 150 31.2525 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 5.0 21 6.0 22 16.0 23 24.0 24 36.0 25 53.0 26 61.0 27 85.0 28 101.0 29 141.0 30 127.0 31 159.0 32 181.0 33 222.0 34 244.0 35 286.0 36 335.0 37 378.0 38 480.0 39 568.0 40 490.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.85491216655823 18.31489915419649 18.73780091086532 34.092387768379965 2 24.675 25.55 34.9 14.875 3 22.88072018004501 29.80745186296574 26.506626656664167 20.80520130032508 4 23.275000000000002 36.375 20.9 19.45 5 22.900000000000002 37.4 23.225 16.475 6 17.45 38.224999999999994 23.474999999999998 20.849999999999998 7 16.425 16.975 43.425000000000004 23.175 8 18.525 22.175 29.9 29.4 9 20.849999999999998 22.975 28.799999999999997 27.375 10-14 20.76 29.805 27.439999999999998 21.995 15-19 21.13 28.49 28.294999999999998 22.085 20-24 21.085 28.985 28.125 21.805 25-29 20.34 29.32 28.444999999999997 21.895 30-34 21.43 29.595 27.08 21.895 35-39 21.17 29.37 27.810000000000002 21.65 40-44 21.060000000000002 29.439999999999998 27.384999999999998 22.115000000000002 45-49 21.485000000000003 28.349999999999998 28.01 22.155 50-54 21.175 29.79 27.595 21.44 55-59 20.89 29.185 27.715 22.21 60-64 20.97 28.754999999999995 28.115000000000002 22.16 65-69 21.39 28.98 27.685 21.945 70-74 21.645 28.715000000000003 27.735 21.905 75-79 21.265 28.744999999999997 27.85 22.14 80-84 21.654999999999998 28.675 28.23 21.44 85-89 21.89 28.144999999999996 28.125 21.84 90-94 21.735 28.349999999999998 27.744999999999997 22.17 95-99 21.17 28.02 29.415000000000003 21.395 100-104 21.95 28.660000000000004 28.23 21.16 105-109 21.375 28.199999999999996 28.555000000000003 21.87 110-114 22.32 28.884999999999998 27.36 21.435000000000002 115-119 21.65 28.235 28.835 21.279999999999998 120-124 21.795 28.305000000000003 28.610000000000003 21.29 125-129 21.89 29.154999999999998 27.925 21.029999999999998 130-134 21.915000000000003 28.625 28.4 21.060000000000002 135-139 21.88 28.565 27.61 21.945 140-144 21.98 28.965000000000003 29.099999999999998 19.955000000000002 145-149 22.08 28.49 27.765 21.665 150 22.15 27.800000000000004 28.050000000000004 22.0 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.0 14 0.5 15 0.5 16 1.0 17 0.5 18 0.0 19 1.5 20 2.5 21 1.5 22 1.0 23 3.5 24 6.5 25 6.5 26 12.0 27 14.0 28 12.5 29 19.0 30 24.0 31 33.5 32 48.0 33 57.0 34 64.0 35 80.5 36 111.5 37 141.0 38 172.5 39 192.5 40 213.5 41 226.0 42 238.5 43 267.0 44 263.0 45 258.0 46 242.0 47 218.0 48 196.0 49 159.0 50 138.0 51 132.5 52 106.0 53 74.0 54 64.5 55 51.0 56 37.5 57 27.0 58 19.5 59 15.5 60 10.0 61 11.0 62 9.0 63 3.5 64 1.5 65 0.5 66 0.5 67 1.0 68 1.0 69 1.0 70 0.5 71 1.5 72 2.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.150000000000002 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.46883184913567 91.125 2 4.295442640125721 8.200000000000001 3 0.23572551073860662 0.675 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.30000000000000004 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.575 0.0 0.0 0.0 0.0 116-117 0.6375 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.9375 0.0 0.0 0.0 0.0 124-125 0.9874999999999999 0.0 0.0 0.0 0.0 126-127 1.0625 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.375 0.0 0.0 0.0 0.0 134-135 1.4875 0.0 0.0 0.0 0.0 136-137 1.6 0.0 0.0 0.0 0.0 138 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR5986250 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986250_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.52125 32.0 2.0 32.0 2.0 32.0 2 30.89375 32.0 32.0 32.0 32.0 32.0 3 31.95625 32.0 32.0 37.0 27.0 37.0 4 34.8275 37.0 32.0 37.0 32.0 37.0 5 35.55375 37.0 37.0 37.0 32.0 37.0 6 39.02575 41.0 37.0 41.0 37.0 41.0 7 33.48575 37.0 32.0 41.0 12.0 41.0 8 38.08725 41.0 37.0 41.0 32.0 41.0 9 35.63675 41.0 37.0 41.0 22.0 41.0 10-14 36.8845 41.0 36.0 41.0 25.0 41.0 15-19 34.6839 39.4 32.0 41.0 21.0 41.0 20-24 35.5235 39.4 32.0 41.0 23.0 41.0 25-29 35.4013 40.2 33.0 41.0 21.0 41.0 30-34 30.60985 34.8 22.0 40.2 14.0 41.0 35-39 34.5251 39.2 31.0 41.0 21.0 41.0 40-44 29.750149999999998 32.8 23.0 37.6 15.0 40.2 45-49 31.06355 34.0 21.0 40.2 12.0 41.0 50-54 32.59205000000001 37.8 26.0 41.0 17.0 41.0 55-59 30.250799999999998 34.0 18.0 40.2 14.0 41.0 60-64 29.623700000000003 33.0 19.0 40.2 14.0 41.0 65-69 27.3205 27.0 18.0 38.4 12.0 40.2 70-74 28.05985 30.0 19.0 37.6 12.0 41.0 75-79 31.02285 35.0 21.0 41.0 12.0 41.0 80-84 28.41205 32.0 16.0 39.2 12.0 41.0 85-89 29.885399999999997 34.0 20.0 40.2 12.0 41.0 90-94 25.122999999999998 25.0 14.0 35.0 12.0 40.2 95-99 24.900199999999998 24.0 14.0 36.0 12.0 40.2 100-104 24.20395 23.0 12.0 35.0 12.0 39.4 105-109 24.9969 26.0 12.0 35.0 12.0 39.4 110-114 26.281650000000003 28.0 16.0 35.0 12.0 41.0 115-119 24.879949999999997 25.0 12.0 36.0 12.0 41.0 120-124 23.5944 22.0 12.0 33.0 12.0 40.2 125-129 22.516200000000005 21.0 12.0 31.0 12.0 37.8 130-134 21.97795 20.0 12.0 31.0 12.0 38.6 135-139 21.4725 20.0 12.0 29.0 12.0 37.0 140-144 21.769150000000003 20.0 12.0 31.0 12.0 37.0 145-149 19.2799 16.0 12.0 25.0 12.0 34.0 150 18.9875 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 15.0 16 37.0 17 90.0 18 108.0 19 166.0 20 158.0 21 190.0 22 166.0 23 182.0 24 175.0 25 187.0 26 173.0 27 191.0 28 208.0 29 189.0 30 225.0 31 217.0 32 247.0 33 233.0 34 219.0 35 181.0 36 167.0 37 166.0 38 82.0 39 23.0 40 2.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.648285137861468 21.385339609952926 19.031607262945528 30.93476798924008 2 23.5 26.200000000000003 35.099999999999994 15.2 3 22.125 30.375000000000004 27.1 20.4 4 22.400000000000002 35.6 21.4 20.599999999999998 5 23.674999999999997 37.974999999999994 21.625 16.725 6 16.075 38.875 24.675 20.375 7 17.25 17.075000000000003 44.25 21.425 8 17.625 22.3 29.5 30.575000000000003 9 21.7 23.549999999999997 29.2 25.55 10-14 20.93 29.080000000000002 28.165000000000003 21.825 15-19 22.195 28.065 28.37 21.37 20-24 22.145 28.865000000000002 28.1 20.89 25-29 21.965 29.42 28.21 20.405 30-34 22.900000000000002 29.035 28.27 19.794999999999998 35-39 21.385 29.21 29.235 20.169999999999998 40-44 22.735 30.625000000000004 29.37 17.27 45-49 22.875 29.609999999999996 28.15 19.365 50-54 22.715 28.315 28.560000000000002 20.41 55-59 22.875 29.73 28.499999999999996 18.895 60-64 22.54 28.67 29.654999999999998 19.134999999999998 65-69 23.165 29.455 29.49 17.89 70-74 23.68 29.349999999999998 29.175 17.794999999999998 75-79 21.755 28.48 29.409999999999997 20.355 80-84 22.145 29.125 30.855 17.875 85-89 21.78 28.499999999999996 30.31 19.41 90-94 22.605 29.69 31.505 16.2 95-99 23.205000000000002 29.785 30.035 16.975 100-104 23.315 29.110000000000003 30.395 17.18 105-109 22.325 28.625 31.39 17.66 110-114 23.169999999999998 28.82 29.57 18.44 115-119 22.715 28.904999999999998 29.45 18.93 120-124 22.415 29.525000000000002 30.15 17.91 125-129 22.945 27.925 31.335 17.794999999999998 130-134 23.51 29.025000000000002 30.654999999999998 16.81 135-139 23.195 28.525 31.59 16.689999999999998 140-144 23.150000000000002 28.13 30.605 18.115000000000002 145-149 24.46 28.59 31.09 15.86 150 23.775 28.050000000000004 32.95 15.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 2.0 18 2.0 19 3.0 20 2.5 21 1.5 22 4.0 23 4.5 24 6.0 25 8.5 26 13.0 27 26.0 28 32.5 29 37.0 30 48.5 31 60.0 32 73.0 33 88.5 34 102.0 35 123.0 36 143.0 37 166.5 38 195.5 39 200.0 40 217.0 41 239.5 42 260.0 43 257.0 44 221.0 45 221.0 46 204.5 47 181.5 48 179.0 49 148.0 50 117.5 51 81.5 52 63.0 53 63.0 54 48.0 55 36.5 56 24.5 57 20.5 58 21.5 59 15.0 60 10.5 61 8.5 62 5.0 63 3.0 64 2.5 65 2.5 66 2.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 25.650000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.09136799596163 98.15 2 0.8581524482584554 1.7000000000000002 3 0.05047955577990913 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.3 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.875 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279442 spots for SRR5986250.sra Written 1279442 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra Read 1279426 spots for SRR5986250.sra Written 1279426 spots for SRR5986250.sra SRR ids: ['SRR5986250.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_52nsyk2g SRR5986250.sra spots: 25588536 blocks: [[1, 1279426], [1279427, 2558852], [2558853, 3838278], [3838279, 5117704], [5117705, 6397130], [6397131, 7676556], [7676557, 8955982], [8955983, 10235408], [10235409, 11514834], [11514835, 12794260], [12794261, 14073686], [14073687, 15353112], [15353113, 16632538], [16632539, 17911964], [17911965, 19191390], [19191391, 20470816], [20470817, 21750242], [21750243, 23029668], [23029669, 24309094], [24309095, 25588536]] SRR5986250 file size 8599437 SRR5986250 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986250 SRR5986250_1.fastq SRR5986250_2.fastq Input file: SRR5986250_1.fastq Paired file: SRR5986250_2.fastq trimmed: SRR5986250-trimmed-pair1.fastq, SRR5986250-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:18:08 2025 >> started Fri Feb 14 04:18:35 2025 >> done (27.020s) 25588536 read pairs processed; of these: 255 ( 0.00%) short read pairs filtered out after trimming by size control 565 ( 0.00%) empty read pairs filtered out after trimming by size control 25587716 (100.00%) read pairs available; of these: 2440444 ( 9.54%) trimmed read pairs available after processing 23147272 (90.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 29 0.00% 20 30 0.00% 21 36 0.00% 22 49 0.00% 23 67 0.00% 24 56 0.00% 25 57 0.00% 26 54 0.00% 27 66 0.00% 28 74 0.00% 29 107 0.00% 30 81 0.00% 31 78 0.00% 32 63 0.00% 33 65 0.00% 34 78 0.00% 35 67 0.00% 36 83 0.00% 37 92 0.00% 38 110 0.00% 39 67 0.00% 40 74 0.00% 41 75 0.00% 42 79 0.00% 43 94 0.00% 44 83 0.00% 45 100 0.00% 46 90 0.00% 47 101 0.00% 48 104 0.00% 49 108 0.00% 50 94 0.00% 51 104 0.00% 52 106 0.00% 53 106 0.00% 54 96 0.00% 55 131 0.00% 56 133 0.00% 57 127 0.00% 58 133 0.00% 59 134 0.00% 60 131 0.00% 61 163 0.00% 62 147 0.00% 63 149 0.00% 64 170 0.00% 65 185 0.00% 66 176 0.00% 67 200 0.00% 68 209 0.00% 69 217 0.00% 70 235 0.00% 71 267 0.00% 72 243 0.00% 73 279 0.00% 74 316 0.00% 75 326 0.00% 76 339 0.00% 77 392 0.00% 78 424 0.00% 79 435 0.00% 80 448 0.00% 81 523 0.00% 82 627 0.00% 83 624 0.00% 84 719 0.00% 85 806 0.00% 86 852 0.00% 87 919 0.00% 88 1025 0.00% 89 1084 0.00% 90 1131 0.00% 91 1293 0.01% 92 1467 0.01% 93 1651 0.01% 94 1780 0.01% 95 1983 0.01% 96 2143 0.01% 97 2369 0.01% 98 2438 0.01% 99 2788 0.01% 100 3006 0.01% 101 3309 0.01% 102 3538 0.01% 103 3917 0.02% 104 4427 0.02% 105 4641 0.02% 106 5034 0.02% 107 5245 0.02% 108 5665 0.02% 109 6088 0.02% 110 6547 0.03% 111 6820 0.03% 112 7624 0.03% 113 8178 0.03% 114 8721 0.03% 115 9533 0.04% 116 9768 0.04% 117 10644 0.04% 118 10987 0.04% 119 11445 0.04% 120 11908 0.05% 121 13243 0.05% 122 13595 0.05% 123 14699 0.06% 124 15657 0.06% 125 16857 0.07% 126 17405 0.07% 127 18091 0.07% 128 19006 0.07% 129 19948 0.08% 130 20505 0.08% 131 21522 0.08% 132 23266 0.09% 133 24318 0.10% 134 25990 0.10% 135 26905 0.11% 136 28181 0.11% 137 29009 0.11% 138 30127 0.12% 139 31533 0.12% 140 32736 0.13% 141 33908 0.13% 142 35918 0.14% 143 37381 0.15% 144 39026 0.15% 145 43098 0.17% 146 50434 0.20% 147 74197 0.29% 148 189187 0.74% 149 1312471 5.13% 150 23147272 90.46% 25587716 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=36 prefix-density=0.10 prefix-fanout=2.0 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=310.03 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=23.1 sequence=AAGAAGAAGAAA criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=35 prefix-density=0.10 prefix-fanout=2.0 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=286.72 fanout-score-rank=1 prefix-density=0.64 prefix-fanout=21.6 sequence=AAGAAGAAGAAA SRR5986250 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:19:40 Started mapping on | Feb 14 04:19:40 Finished on | Feb 14 04:26:36 Mapping speed, Million of reads per hour | 221.43 Number of input reads | 25587716 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 21426833 Uniquely mapped reads % | 83.74% Average mapped length | 288.18 Number of splices: Total | 19557610 Number of splices: Annotated (sjdb) | 18954365 Number of splices: GT/AG | 19096493 Number of splices: GC/AG | 261055 Number of splices: AT/AC | 21823 Number of splices: Non-canonical | 178239 Mismatch rate per base, % | 2.10% Deletion rate per base | 0.14% Deletion average length | 3.19 Insertion rate per base | 0.09% Insertion average length | 2.86 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1180979 % of reads mapped to multiple loci | 4.62% Number of reads mapped to too many loci | 46107 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 11.21% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2979904 2979904 2979904 N_multimapping 1180979 1180979 1180979 N_noFeature 707954 10994703 10965419 N_ambiguous 375597 100536 101476 UnstrandedReadsAssigned:20343282 PositiveStrandReadsAssigned:10331594 NegativeStrandReadsAssigned:10359938 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986250 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986250-trimmed-pair1.fastq SRR5986250-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,587,716 reads, 20,748,824 reads pseudoaligned [quant] estimated average fragment length: 221.27 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR5986250.ke.tsv 34699 SRR5986250.se.tsv 87100 total ==> SRR5986250.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.73 1034 21.6467 Potri.005G024800.1.v4.1 1035 814.73 595 27.4853 Potri.004G059700.1.v4.1 961 740.735 21 1.06697 Potri.007G009000.2.v4.1 1416 1195.73 0 0 Potri.003G141000.2.v4.1 2943 2722.73 353 4.8794 Potri.016G087400.1.v4.1 270 63.4363 839 497.761 Potri.015G069301.1.v4.1 564 343.837 0 0 Potri.010G195200.1.v4.1 1773 1552.73 179 4.33864 Potri.012G127500.1.v4.1 977 756.73 9965 495.602 ==> SRR5986250.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 81 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 292 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR5986250 completed mapping pipeline successfully