Starting /dee2/code/volunteer_pipeline.sh SRR5986251 current disk space = 3086495301632 free memory = 1574936176 SRR5986251 SRAfilesize 37ae84e07e664d3ce810dc996d90c4f3 SRR5986251.sra SRR5986251.sra file validated SRR5986251 is paired end SRR5986251 is conventional basespace SRR5986251 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986251_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.51125 32.0 12.0 32.0 2.0 32.0 2 31.3425 32.0 32.0 32.0 32.0 32.0 3 33.215 32.0 32.0 37.0 32.0 37.0 4 35.145 37.0 37.0 37.0 32.0 37.0 5 35.865 37.0 37.0 37.0 32.0 37.0 6 39.31825 41.0 41.0 41.0 37.0 41.0 7 39.04975 41.0 37.0 41.0 37.0 41.0 8 39.439 41.0 41.0 41.0 37.0 41.0 9 39.61225 41.0 41.0 41.0 37.0 41.0 10-14 39.29355 41.0 41.0 41.0 36.0 41.0 15-19 39.331649999999996 41.0 41.0 41.0 36.0 41.0 20-24 39.4798 41.0 41.0 41.0 37.0 41.0 25-29 38.756150000000005 41.0 39.4 41.0 34.0 41.0 30-34 38.84335 41.0 39.4 41.0 35.0 41.0 35-39 38.35535 41.0 38.6 41.0 33.0 41.0 40-44 38.336 41.0 39.4 41.0 32.0 41.0 45-49 37.37475 41.0 37.0 41.0 28.0 41.0 50-54 36.6716 41.0 37.0 41.0 25.0 41.0 55-59 36.895050000000005 41.0 37.0 41.0 26.0 41.0 60-64 37.00625000000001 41.0 36.0 41.0 26.0 41.0 65-69 35.964150000000004 40.2 35.0 41.0 23.0 41.0 70-74 37.58710000000001 41.0 37.0 41.0 29.0 41.0 75-79 37.185 41.0 37.0 41.0 28.0 41.0 80-84 34.604699999999994 38.6 32.0 41.0 18.0 41.0 85-89 35.78635 41.0 35.0 41.0 22.0 41.0 90-94 36.79605 41.0 37.0 41.0 25.0 41.0 95-99 35.42015 39.4 33.0 41.0 21.0 41.0 100-104 31.652549999999998 35.0 25.0 41.0 14.0 41.0 105-109 33.72045000000001 38.6 30.0 41.0 16.0 41.0 110-114 33.904 37.8 30.0 41.0 16.0 41.0 115-119 35.36515 40.2 34.0 41.0 23.0 41.0 120-124 32.1082 36.8 26.0 41.0 15.0 41.0 125-129 31.824650000000002 36.0 26.0 40.2 12.0 41.0 130-134 31.1466 36.0 25.0 40.2 12.0 41.0 135-139 32.8458 37.0 28.0 41.0 12.0 41.0 140-144 28.219600000000003 31.0 20.0 37.6 12.0 41.0 145-149 31.3039 35.0 25.0 41.0 12.0 41.0 150 31.6405 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 1.0 19 0.0 20 4.0 21 7.0 22 22.0 23 18.0 24 40.0 25 58.0 26 72.0 27 75.0 28 111.0 29 124.0 30 135.0 31 154.0 32 189.0 33 232.0 34 252.0 35 282.0 36 328.0 37 378.0 38 446.0 39 585.0 40 486.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.630573248407643 19.23566878980892 18.949044585987263 33.18471337579618 2 23.849999999999998 26.224999999999998 35.475 14.45 3 21.705426356589147 30.107526881720432 27.206801700425103 20.980245061265315 4 22.475 36.325 21.925 19.275000000000002 5 21.8 38.25 23.05 16.900000000000002 6 17.075000000000003 38.15 23.7 21.075 7 15.375 16.725 45.2 22.7 8 19.8 22.525000000000002 29.475 28.199999999999996 9 21.3 22.575 28.325 27.800000000000004 10-14 20.59 30.654999999999998 26.674999999999997 22.08 15-19 20.974999999999998 28.48 28.249999999999996 22.295 20-24 20.830000000000002 29.5 27.744999999999997 21.925 25-29 21.295 28.549999999999997 28.444999999999997 21.709999999999997 30-34 21.224999999999998 29.145 27.82 21.81 35-39 21.46 28.975 27.54 22.025 40-44 21.375 28.375 27.860000000000003 22.39 45-49 21.61 28.165000000000003 28.38 21.845 50-54 21.165 28.53 28.225 22.08 55-59 21.355 29.01 27.935 21.7 60-64 21.375 28.794999999999998 27.715 22.115000000000002 65-69 21.634999999999998 28.125 28.18 22.06 70-74 20.825 28.720000000000002 28.04 22.415 75-79 20.95 28.775000000000002 27.705000000000002 22.57 80-84 21.255 28.675 28.43 21.64 85-89 21.185000000000002 28.415000000000003 28.205000000000002 22.195 90-94 21.275 28.485 28.125 22.115000000000002 95-99 21.515 28.77 28.155 21.560000000000002 100-104 21.845 28.715000000000003 28.470000000000002 20.97 105-109 21.285 28.365000000000002 28.189999999999998 22.16 110-114 21.959999999999997 27.925 28.27 21.845 115-119 21.765 28.249999999999996 28.595 21.39 120-124 21.645 27.925 28.73 21.7 125-129 22.15 28.439999999999998 28.494999999999997 20.915 130-134 22.45 28.315 28.735 20.5 135-139 21.94 28.985 27.48 21.595 140-144 21.765 28.845 29.035 20.355 145-149 21.87 28.999999999999996 27.900000000000002 21.23 150 22.15 27.575 27.200000000000003 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.5 23 3.5 24 5.0 25 5.0 26 9.0 27 14.5 28 18.0 29 22.5 30 26.0 31 37.5 32 49.5 33 58.5 34 67.5 35 92.5 36 118.0 37 124.5 38 156.0 39 196.0 40 221.5 41 232.5 42 212.5 43 225.5 44 266.5 45 266.0 46 234.5 47 221.0 48 205.5 49 169.0 50 161.0 51 139.0 52 104.0 53 83.0 54 56.0 55 43.5 56 45.0 57 32.5 58 15.0 59 12.0 60 14.5 61 11.0 62 6.0 63 3.0 64 1.5 65 0.5 66 1.5 67 2.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 21.5 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.475 #Duplication Level Percentage of deduplicated Percentage of total 1 94.54882243979888 89.325 2 5.080709182323366 9.6 3 0.3440063508864779 0.975 4 0.02646202699126753 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.075 0.0 0.0 0.0 0.0 100-101 0.075 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.1 0.0 0.0 0.0 0.0 106-107 0.15 0.0 0.0 0.0 0.0 108-109 0.16249999999999998 0.0 0.0 0.0 0.0 110-111 0.175 0.0 0.0 0.0 0.0 112-113 0.175 0.0 0.0 0.0 0.0 114-115 0.225 0.0 0.0 0.0 0.0 116-117 0.2375 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.525 0.0 0.0 0.0 0.0 124-125 0.6375 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8374999999999999 0.0 0.0 0.0 0.0 130-131 0.9875 0.0 0.0 0.0 0.0 132-133 1.075 0.0 0.0 0.0 0.0 134-135 1.2000000000000002 0.0 0.0 0.0 0.0 136-137 1.2875 0.0 0.0 0.0 0.0 138 1.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAGGC 10 0.0033930484 182.58731 1 TTTTTTT 30 0.0015161748 23.964584 50-54 >>END_MODULE SRR5986251 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR5986251_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 41 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.945 32.0 12.0 32.0 2.0 32.0 2 30.87375 32.0 32.0 32.0 32.0 32.0 3 31.8775 32.0 32.0 37.0 27.0 37.0 4 34.50125 37.0 32.0 37.0 32.0 37.0 5 35.4275 37.0 37.0 37.0 32.0 37.0 6 38.8745 41.0 37.0 41.0 32.0 41.0 7 33.387 37.0 32.0 41.0 12.0 41.0 8 37.79 41.0 37.0 41.0 32.0 41.0 9 35.2575 41.0 32.0 41.0 12.0 41.0 10-14 36.7543 41.0 36.0 41.0 25.0 41.0 15-19 34.4032 39.4 30.0 41.0 20.0 41.0 20-24 35.3908 39.4 32.0 41.0 21.0 41.0 25-29 35.1487 39.4 33.0 41.0 21.0 41.0 30-34 30.2875 33.0 24.0 40.2 14.0 41.0 35-39 34.1786 39.2 31.0 41.0 20.0 41.0 40-44 29.2685 30.8 22.0 37.6 15.0 40.2 45-49 30.99425 34.0 22.0 40.2 12.0 41.0 50-54 32.1952 36.8 26.0 41.0 16.0 41.0 55-59 30.0079 33.0 18.0 39.4 14.0 41.0 60-64 29.3534 32.0 19.0 40.2 14.0 41.0 65-69 27.16805 27.0 18.0 38.4 12.0 40.2 70-74 27.7688 28.0 18.0 37.6 12.0 40.2 75-79 30.724349999999998 35.0 21.0 41.0 12.0 41.0 80-84 28.1027 32.0 16.0 39.2 12.0 41.0 85-89 29.724349999999998 34.0 20.0 40.2 12.0 41.0 90-94 24.7924 25.0 14.0 35.0 12.0 40.2 95-99 24.6044 24.0 14.0 36.0 12.0 40.2 100-104 23.7046 20.0 12.0 35.0 12.0 39.4 105-109 24.7184 24.0 12.0 35.0 12.0 39.4 110-114 25.8148 27.0 14.0 35.0 12.0 41.0 115-119 24.574399999999997 25.0 12.0 35.0 12.0 41.0 120-124 23.250850000000003 22.0 12.0 33.0 12.0 40.2 125-129 22.090849999999996 20.0 12.0 30.0 12.0 37.0 130-134 21.583800000000004 19.0 12.0 31.0 12.0 38.6 135-139 21.174599999999998 18.0 12.0 29.0 12.0 37.0 140-144 21.34775 20.0 12.0 30.0 12.0 37.0 145-149 19.1428 16.0 12.0 25.0 12.0 33.0 150 19.15475 12.0 12.0 27.0 12.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 3.0 15 13.0 16 44.0 17 93.0 18 132.0 19 139.0 20 186.0 21 189.0 22 191.0 23 197.0 24 184.0 25 177.0 26 187.0 27 197.0 28 186.0 29 220.0 30 210.0 31 206.0 32 223.0 33 226.0 34 206.0 35 196.0 36 172.0 37 134.0 38 68.0 39 21.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.380170715692714 19.79645436638214 20.32173342087984 32.501641497045306 2 25.35 28.449999999999996 32.324999999999996 13.875000000000002 3 22.075 31.95 26.375 19.6 4 22.900000000000002 35.55 21.425 20.125 5 22.775000000000002 37.85 22.175 17.2 6 16.675 39.125 23.425 20.775 7 16.775000000000002 17.275 44.224999999999994 21.725 8 19.6 22.3 29.825000000000003 28.275 9 19.525000000000002 24.4 28.999999999999996 27.075 10-14 21.23 29.830000000000002 27.325 21.615000000000002 15-19 21.575 27.71 29.01 21.705 20-24 21.740000000000002 29.13 28.16 20.97 25-29 21.54 29.835 27.87 20.755000000000003 30-34 22.27 29.310000000000002 28.765 19.655 35-39 21.529999999999998 29.845 28.075 20.549999999999997 40-44 22.58 30.825000000000003 28.970000000000002 17.625 45-49 22.28 29.65 29.349999999999998 18.72 50-54 21.95 29.294999999999998 28.365000000000002 20.39 55-59 22.86 29.349999999999998 29.035 18.755 60-64 22.78 28.9 29.409999999999997 18.91 65-69 23.055 29.825000000000003 29.49 17.630000000000003 70-74 24.22 29.34 28.205000000000002 18.235 75-79 21.9 28.26 29.95 19.89 80-84 22.245 30.09 29.995 17.669999999999998 85-89 22.275 28.389999999999997 29.845 19.49 90-94 22.84 29.04 31.900000000000002 16.220000000000002 95-99 22.855 29.765000000000004 30.25 17.130000000000003 100-104 23.215 29.15 30.020000000000003 17.615 105-109 22.259999999999998 28.765 31.44 17.535 110-114 22.755 28.78 30.0 18.465 115-119 22.57 28.744999999999997 29.959999999999997 18.725 120-124 22.065 29.29 30.615 18.029999999999998 125-129 22.759999999999998 28.355000000000004 30.775000000000002 18.11 130-134 23.205000000000002 28.915000000000003 30.555 17.325 135-139 23.555 27.73 31.705 17.01 140-144 23.135 27.99 30.615 18.26 145-149 24.14 28.810000000000002 31.345 15.705 150 23.150000000000002 28.625 33.225 15.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 1.0 18 2.0 19 3.0 20 3.0 21 2.5 22 4.0 23 4.5 24 5.5 25 9.0 26 15.5 27 23.0 28 28.5 29 39.5 30 53.0 31 59.5 32 65.0 33 83.5 34 110.5 35 127.0 36 145.5 37 173.5 38 188.0 39 213.5 40 253.0 41 256.0 42 237.0 43 228.5 44 225.0 45 223.0 46 202.5 47 174.5 48 158.5 49 138.0 50 116.0 51 97.5 52 77.0 53 60.5 54 43.5 55 32.0 56 29.0 57 19.0 58 13.5 59 14.0 60 8.5 61 5.5 62 6.5 63 5.0 64 4.0 65 2.0 66 1.0 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 1.0 75 1.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content fail #Base N-Count 1 23.849999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98989898989899 98.0 2 1.0101010101010102 2.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.05 0.0 0.0 0.0 0.0 104-105 0.075 0.0 0.0 0.0 0.0 106-107 0.1 0.0 0.0 0.0 0.0 108-109 0.1125 0.0 0.0 0.0 0.0 110-111 0.125 0.0 0.0 0.0 0.0 112-113 0.125 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.16249999999999998 0.0 0.0 0.0 0.0 118-119 0.225 0.0 0.0 0.0 0.0 120-121 0.275 0.0 0.0 0.0 0.0 122-123 0.2875 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.4375 0.0 0.0 0.0 0.0 128-129 0.5125 0.0 0.0 0.0 0.0 130-131 0.625 0.0 0.0 0.0 0.0 132-133 0.7 0.0 0.0 0.0 0.0 134-135 0.7875000000000001 0.0 0.0 0.0 0.0 136-137 0.8374999999999999 0.0 0.0 0.0 0.0 138 0.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGCTTTA 10 0.0070081474 143.7625 4 >>END_MODULE Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242569 spots for SRR5986251.sra Written 1242569 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra Read 1242556 spots for SRR5986251.sra Written 1242556 spots for SRR5986251.sra SRR ids: ['SRR5986251.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u5m0v0o2 SRR5986251.sra spots: 24851133 blocks: [[1, 1242556], [1242557, 2485112], [2485113, 3727668], [3727669, 4970224], [4970225, 6212780], [6212781, 7455336], [7455337, 8697892], [8697893, 9940448], [9940449, 11183004], [11183005, 12425560], [12425561, 13668116], [13668117, 14910672], [14910673, 16153228], [16153229, 17395784], [17395785, 18638340], [18638341, 19880896], [19880897, 21123452], [21123453, 22366008], [22366009, 23608564], [23608565, 24851133]] SRR5986251 file size 8350995 SRR5986251 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR5986251 SRR5986251_1.fastq SRR5986251_2.fastq Input file: SRR5986251_1.fastq Paired file: SRR5986251_2.fastq trimmed: SRR5986251-trimmed-pair1.fastq, SRR5986251-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:08:45 2025 >> started Fri Feb 14 05:09:10 2025 >> done (25.053s) 24851133 read pairs processed; of these: 192 ( 0.00%) short read pairs filtered out after trimming by size control 570 ( 0.00%) empty read pairs filtered out after trimming by size control 24850371 (100.00%) read pairs available; of these: 2249855 ( 9.05%) trimmed read pairs available after processing 22600516 (90.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 27 0.00% 20 36 0.00% 21 33 0.00% 22 45 0.00% 23 54 0.00% 24 52 0.00% 25 44 0.00% 26 62 0.00% 27 98 0.00% 28 81 0.00% 29 118 0.00% 30 82 0.00% 31 97 0.00% 32 81 0.00% 33 94 0.00% 34 85 0.00% 35 103 0.00% 36 82 0.00% 37 100 0.00% 38 77 0.00% 39 82 0.00% 40 91 0.00% 41 81 0.00% 42 94 0.00% 43 91 0.00% 44 92 0.00% 45 125 0.00% 46 92 0.00% 47 103 0.00% 48 92 0.00% 49 94 0.00% 50 106 0.00% 51 132 0.00% 52 114 0.00% 53 120 0.00% 54 134 0.00% 55 128 0.00% 56 135 0.00% 57 143 0.00% 58 143 0.00% 59 163 0.00% 60 151 0.00% 61 175 0.00% 62 173 0.00% 63 182 0.00% 64 202 0.00% 65 186 0.00% 66 214 0.00% 67 223 0.00% 68 233 0.00% 69 224 0.00% 70 294 0.00% 71 268 0.00% 72 255 0.00% 73 313 0.00% 74 333 0.00% 75 404 0.00% 76 388 0.00% 77 424 0.00% 78 493 0.00% 79 479 0.00% 80 548 0.00% 81 647 0.00% 82 688 0.00% 83 808 0.00% 84 873 0.00% 85 848 0.00% 86 892 0.00% 87 1041 0.00% 88 1159 0.00% 89 1291 0.01% 90 1373 0.01% 91 1485 0.01% 92 1625 0.01% 93 1822 0.01% 94 2035 0.01% 95 2156 0.01% 96 2267 0.01% 97 2496 0.01% 98 2533 0.01% 99 2905 0.01% 100 3048 0.01% 101 3333 0.01% 102 3662 0.01% 103 3969 0.02% 104 4113 0.02% 105 4409 0.02% 106 4677 0.02% 107 5048 0.02% 108 5379 0.02% 109 5503 0.02% 110 6023 0.02% 111 6318 0.03% 112 6836 0.03% 113 7067 0.03% 114 7592 0.03% 115 7889 0.03% 116 8197 0.03% 117 8788 0.04% 118 9323 0.04% 119 9383 0.04% 120 10091 0.04% 121 10561 0.04% 122 11173 0.04% 123 11965 0.05% 124 12583 0.05% 125 13055 0.05% 126 13762 0.06% 127 14335 0.06% 128 14821 0.06% 129 15485 0.06% 130 15839 0.06% 131 16842 0.07% 132 17481 0.07% 133 18532 0.07% 134 19414 0.08% 135 20520 0.08% 136 21110 0.08% 137 21738 0.09% 138 22786 0.09% 139 23379 0.09% 140 24537 0.10% 141 25780 0.10% 142 26689 0.11% 143 28097 0.11% 144 29995 0.12% 145 32539 0.13% 146 39376 0.16% 147 64603 0.26% 148 180485 0.73% 149 1312793 5.28% 150 22600516 90.95% 24850371 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=5.46 fanout-score-rank=20 prefix-density=0.16 prefix-fanout=3.5 sequence=TCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCAACTCCGGCAATGATCGTCTGACTTGTGGTGGTCTCGGAGAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=226.90 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=26.0 sequence=GCTGCTGCTGCT criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.10 prefix-fanout=1.9 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=24 fanout-score=266.42 fanout-score-rank=1 prefix-density=0.48 prefix-fanout=26.4 sequence=AGAAGAAGAAGA SRR5986251 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:10:34 Started mapping on | Feb 14 05:10:34 Finished on | Feb 14 05:16:31 Mapping speed, Million of reads per hour | 250.59 Number of input reads | 24850371 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20559020 Uniquely mapped reads % | 82.73% Average mapped length | 284.44 Number of splices: Total | 18571673 Number of splices: Annotated (sjdb) | 18008244 Number of splices: GT/AG | 18137487 Number of splices: GC/AG | 249267 Number of splices: AT/AC | 19796 Number of splices: Non-canonical | 165123 Mismatch rate per base, % | 2.12% Deletion rate per base | 0.14% Deletion average length | 3.20 Insertion rate per base | 0.09% Insertion average length | 2.88 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1105741 % of reads mapped to multiple loci | 4.45% Number of reads mapped to too many loci | 60300 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.31% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3185610 3185610 3185610 N_multimapping 1105741 1105741 1105741 N_noFeature 682113 10553782 10515466 N_ambiguous 381864 104868 106219 UnstrandedReadsAssigned:19495043 PositiveStrandReadsAssigned:9900370 NegativeStrandReadsAssigned:9937335 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR5986251 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR5986251-trimmed-pair1.fastq SRR5986251-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,850,371 reads, 20,094,233 reads pseudoaligned [quant] estimated average fragment length: 227.27 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52401 SRR5986251.ke.tsv 34699 SRR5986251.se.tsv 87100 total ==> SRR5986251.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1791.73 999 21.9181 Potri.005G024800.1.v4.1 1035 808.73 580 28.1925 Potri.004G059700.1.v4.1 961 734.73 12 0.642041 Potri.007G009000.2.v4.1 1416 1189.73 1 0.0330416 Potri.003G141000.2.v4.1 2943 2716.73 370.634 5.363 Potri.016G087400.1.v4.1 270 61.9184 830.788 527.449 Potri.015G069301.1.v4.1 564 337.876 0 0 Potri.010G195200.1.v4.1 1773 1546.73 159 4.04103 Potri.012G127500.1.v4.1 977 750.73 9059 474.358 ==> SRR5986251.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 45 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 283 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 7 SRR5986251 completed mapping pipeline successfully