Starting /dee2/code/volunteer_pipeline.sh SRR6031364 current disk space = 3086861078528 free memory = 1582435116 SRR6031364 SRAfilesize 5dc386ee1deea38096f232fbaacd4085 SRR6031364.sra SRR6031364.sra file validated SRR6031364 is paired end SRR6031364 is conventional basespace SRR6031364 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3965 34.0 33.0 34.0 33.0 34.0 2 33.5415 34.0 34.0 34.0 33.0 34.0 3 33.53075 34.0 34.0 34.0 33.0 34.0 4 33.536 34.0 34.0 34.0 33.0 34.0 5 33.48 34.0 34.0 34.0 33.0 34.0 6 37.3225 38.0 38.0 38.0 37.0 38.0 7 37.46375 38.0 38.0 38.0 37.0 38.0 8 37.57575 38.0 38.0 38.0 38.0 38.0 9 37.58025 38.0 38.0 38.0 38.0 38.0 10-14 37.557849999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.5678 38.0 38.0 38.0 38.0 38.0 20-24 37.60015 38.0 38.0 38.0 38.0 38.0 25-29 37.576800000000006 38.0 38.0 38.0 38.0 38.0 30-34 37.54215 38.0 38.0 38.0 37.6 38.0 35-39 37.5237 38.0 38.0 38.0 37.8 38.0 40-44 37.406150000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.33725 38.0 38.0 38.0 37.0 38.0 50-54 37.34755 38.0 38.0 38.0 37.0 38.0 55-59 37.326649999999994 38.0 38.0 38.0 37.0 38.0 60-64 37.277 38.0 38.0 38.0 37.0 38.0 65-69 37.23895 38.0 38.0 38.0 37.0 38.0 70-74 37.21169999999999 38.0 38.0 38.0 36.6 38.0 75-79 37.0564 38.0 38.0 38.0 36.0 38.0 80-84 37.01389999999999 38.0 38.0 38.0 36.4 38.0 85-89 37.0123 38.0 38.0 38.0 36.0 38.0 90-94 36.9043 38.0 38.0 38.0 36.0 38.0 95-99 36.84475 38.0 38.0 38.0 36.0 38.0 100-104 36.712399999999995 38.0 38.0 38.0 35.0 38.0 105-109 36.67155 38.0 38.0 38.0 35.0 38.0 110-114 36.5603 38.0 38.0 38.0 34.6 38.0 115-119 36.445550000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.26145 38.0 38.0 38.0 34.0 38.0 125-129 36.1503 38.0 38.0 38.0 33.8 38.0 130-134 36.0065 38.0 38.0 38.0 33.4 38.0 135-139 35.72705 38.0 37.0 38.0 32.6 38.0 140-144 35.42460000000001 38.0 36.2 38.0 31.4 38.0 145-149 34.57585 38.0 35.8 38.0 29.2 38.0 150 28.338 33.0 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 2.0 17 5.0 18 5.0 19 7.0 20 5.0 21 3.0 22 4.0 23 5.0 24 9.0 25 10.0 26 12.0 27 20.0 28 22.0 29 20.0 30 33.0 31 31.0 32 40.0 33 75.0 34 102.0 35 160.0 36 444.0 37 2984.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.251189581768095 14.52541948409717 4.858502379163536 51.3648885549712 2 15.85 16.725 49.875 17.549999999999997 3 14.674999999999999 20.375 32.75 32.2 4 20.375 28.65 25.374999999999996 25.6 5 21.05526381595399 36.23405851462866 25.63140785196299 17.079269817454364 6 17.150000000000002 35.3 26.974999999999998 20.575 7 12.675 24.075 45.65 17.599999999999998 8 15.775 23.575 33.7 26.950000000000003 9 15.325 20.474999999999998 37.55 26.650000000000002 10-14 19.509999999999998 28.73 27.175 24.585 15-19 19.525000000000002 27.905 28.689999999999998 23.880000000000003 20-24 19.580000000000002 28.74 28.044999999999998 23.635 25-29 19.56 28.48 28.155 23.805 30-34 19.615 28.549999999999997 27.665 24.169999999999998 35-39 19.900000000000002 28.035 28.189999999999998 23.875 40-44 19.53 29.13 27.485 23.855 45-49 20.225 28.43 27.529999999999998 23.815 50-54 19.975 29.25 27.21 23.565 55-59 20.035 28.810000000000002 27.894999999999996 23.26 60-64 20.21 28.605000000000004 27.66 23.525 65-69 19.865 28.22 28.305000000000003 23.61 70-74 19.72 28.625 28.04 23.615 75-79 20.235 28.810000000000002 27.54 23.415 80-84 20.330000000000002 29.015 27.439999999999998 23.215 85-89 20.515 28.165000000000003 27.950000000000003 23.369999999999997 90-94 20.06 28.415000000000003 27.975 23.549999999999997 95-99 19.830000000000002 28.599999999999998 28.244999999999997 23.325000000000003 100-104 20.150000000000002 29.62 27.115000000000002 23.115 105-109 20.1 28.215 27.839999999999996 23.845 110-114 20.275000000000002 28.62 27.47 23.635 115-119 21.27 28.555000000000003 26.96 23.215 120-124 20.424999999999997 28.51 27.91 23.155 125-129 20.265 28.515 27.245 23.974999999999998 130-134 20.935000000000002 28.255000000000003 27.11 23.7 135-139 20.630000000000003 28.51 27.189999999999998 23.669999999999998 140-144 20.474999999999998 27.884999999999998 27.67 23.97 145-149 20.724999999999998 28.060000000000002 27.400000000000002 23.815 150 20.730182545636406 28.032008002000502 27.481870467616904 23.755938984746187 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 3.0 24 2.5 25 2.5 26 3.5 27 8.5 28 11.0 29 10.0 30 15.5 31 21.0 32 31.0 33 51.5 34 60.0 35 67.5 36 90.0 37 113.0 38 146.5 39 182.5 40 210.5 41 222.5 42 255.0 43 278.5 44 276.5 45 277.0 46 281.5 47 269.0 48 229.5 49 192.0 50 154.5 51 131.5 52 103.0 53 75.0 54 61.5 55 45.5 56 35.0 57 29.0 58 17.5 59 10.0 60 7.5 61 4.0 62 2.0 63 3.0 64 1.5 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64779874213836 99.02499999999999 2 0.3018867924528302 0.6 3 0.025157232704402514 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025157232704402514 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCATTCATCTCGTATGC 12 0.3 TruSeq Adapter, Index 3 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.0625 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.7 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.8374999999999999 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.375 0.0 0.0 0.0 0.0 102-103 1.6125 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.275 0.0 0.0 0.0 0.0 110-111 2.5 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.525 0.0 0.0 0.0 0.0 118-119 3.9125 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.6125 0.0 0.0 0.0 0.0 124-125 5.125 0.0 0.0 0.0 0.0 126-127 5.475 0.0 0.0 0.0 0.0 128-129 5.887499999999999 0.0 0.0 0.0 0.0 130-131 6.35 0.0 0.0 0.0 0.0 132-133 6.800000000000001 0.0 0.0 0.0 0.0 134-135 7.199999999999999 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138 7.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAATGGG 10 0.006973645 144.0 6 >>END_MODULE SRR6031364 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031364_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74525 33.0 33.0 34.0 32.0 34.0 2 32.98 34.0 33.0 34.0 32.0 34.0 3 32.98925 34.0 33.0 34.0 32.0 34.0 4 32.92225 34.0 33.0 34.0 32.0 34.0 5 32.94825 34.0 33.0 34.0 32.0 34.0 6 37.20825 38.0 38.0 38.0 37.0 38.0 7 37.286 38.0 38.0 38.0 37.0 38.0 8 37.24375 38.0 38.0 38.0 37.0 38.0 9 37.2925 38.0 38.0 38.0 37.0 38.0 10-14 37.27405 38.0 38.0 38.0 37.0 38.0 15-19 37.216 38.0 38.0 38.0 37.0 38.0 20-24 37.294000000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.2707 38.0 38.0 38.0 37.0 38.0 30-34 37.252100000000006 38.0 38.0 38.0 37.0 38.0 35-39 37.04455 38.0 38.0 38.0 37.0 38.0 40-44 36.7989 38.0 38.0 38.0 37.0 38.0 45-49 37.1133 38.0 38.0 38.0 37.0 38.0 50-54 37.036199999999994 38.0 38.0 38.0 36.8 38.0 55-59 37.04025 38.0 38.0 38.0 37.0 38.0 60-64 37.0608 38.0 38.0 38.0 37.0 38.0 65-69 36.94045 38.0 38.0 38.0 36.4 38.0 70-74 36.964099999999995 38.0 38.0 38.0 37.0 38.0 75-79 36.874199999999995 38.0 38.0 38.0 36.2 38.0 80-84 36.36045 38.0 38.0 38.0 35.6 38.0 85-89 35.6293 38.0 38.0 38.0 34.0 38.0 90-94 35.705000000000005 38.0 38.0 38.0 34.0 38.0 95-99 35.652100000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.24135 38.0 38.0 38.0 34.2 38.0 105-109 36.3566 38.0 38.0 38.0 34.6 38.0 110-114 36.3328 38.0 38.0 38.0 34.8 38.0 115-119 36.1336 38.0 38.0 38.0 34.0 38.0 120-124 36.009550000000004 38.0 38.0 38.0 33.8 38.0 125-129 35.52885 38.0 38.0 38.0 32.0 38.0 130-134 34.359700000000004 38.0 36.6 38.0 25.2 38.0 135-139 33.265 38.0 36.0 38.0 13.8 38.0 140-144 33.013850000000005 38.0 35.2 38.0 13.0 38.0 145-149 32.48125 38.0 33.4 38.0 6.4 38.0 150 25.7455 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 0.0 5 1.0 6 1.0 7 0.0 8 2.0 9 1.0 10 1.0 11 1.0 12 2.0 13 0.0 14 6.0 15 10.0 16 8.0 17 12.0 18 4.0 19 4.0 20 6.0 21 3.0 22 12.0 23 16.0 24 20.0 25 43.0 26 15.0 27 32.0 28 39.0 29 44.0 30 56.0 31 47.0 32 53.0 33 118.0 34 103.0 35 161.0 36 416.0 37 2756.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.851591877663573 23.7152168463274 8.924542491852595 39.50864878415643 2 22.592778335005015 24.523570712136408 40.57171514543631 12.311935807422266 3 14.095811387007776 27.715073990469026 35.99197391522448 22.197140707298722 4 18.685728618008525 37.22096814647605 25.13167795334838 18.961625282167045 5 23.707977922729555 38.86101354741596 21.876567987957852 15.55444054189664 6 17.958979489744873 39.394697348674335 24.487243621810904 18.159079539769884 7 18.434217108554275 19.984992496248125 41.09554777388694 20.485242621310658 8 18.409204602301152 23.71185592796398 31.96598299149575 25.912956478239117 9 19.809904952476238 22.26113056528264 33.691845922961484 24.23711855927964 10-14 22.240568397878516 27.994596217352147 27.679375562894027 22.085459821875315 15-19 22.17608804402201 27.988994497248626 28.714357178589296 21.12056028014007 20-24 22.135494846392476 28.590013009106375 27.85950165115581 21.414990493345343 25-29 22.55804643714972 28.087469975980785 27.997397918334666 21.35708566853483 30-34 21.913626582595207 28.09888405144373 28.72441575339038 21.263073612570686 35-39 22.03568735863282 28.55993968333752 28.273435536566975 21.13093742146268 40-44 22.856709321733852 27.626321379798696 28.26867634414041 21.248292954327045 45-49 22.758206565252202 28.15252201761409 28.042433947157726 21.046837469975983 50-54 22.614752455401884 28.21707757065544 28.136901182601726 21.031268791340953 55-59 22.923138591041187 28.33951297725223 27.97374486421485 20.76360356749173 60-64 22.919065018269183 28.46989338805746 27.95935732519145 20.651684268481908 65-69 23.031821598596842 27.82260085191681 28.58431470809321 20.561262841393134 70-74 22.896095433812842 27.447245752092623 28.47977544985214 21.176883364242393 75-79 23.52705611453171 28.297542173499522 27.661811082745157 20.513590629223607 80-84 23.134290497691644 27.923494495459387 28.014814063213432 20.927400943635533 85-89 23.304581374928983 28.09255720262383 28.09255720262383 20.510304219823354 90-94 24.021772619903462 27.54955325048783 27.960357399609737 20.46831672999897 95-99 23.176053807054476 28.130615597884685 28.582430559121015 20.110900035939828 100-104 23.30389401846648 27.709755118426333 28.251706142111605 20.734644720995586 105-109 23.876108855811157 27.975742996040697 27.90557810855511 20.242570039593044 110-114 23.643469111678943 28.463349867227816 27.315997795480733 20.577183225612504 115-119 23.938649691744775 28.394566688386547 27.537466793644427 20.12931682622425 120-124 23.769423558897245 28.45614035087719 27.62907268170426 20.145363408521302 125-129 24.63914403956798 28.36883012011709 26.703341071969316 20.288684768345615 130-134 23.9647577092511 28.87794765483286 27.10028504793988 20.05700958797616 135-139 24.20321366070955 28.42976083152145 27.411571299782572 19.955454207986424 140-144 25.236543313709 28.36417157275021 27.12888982338099 19.270395290159797 145-149 24.261997275066864 28.213150325478125 27.774133319876874 19.75071907957814 150 25.426278836509532 28.635907723169506 26.930792377131397 19.00702106318957 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.0 19 0.5 20 0.5 21 0.0 22 1.5 23 3.0 24 4.5 25 3.0 26 2.5 27 6.5 28 15.0 29 19.0 30 20.5 31 29.5 32 33.5 33 38.5 34 53.0 35 75.0 36 99.5 37 123.5 38 147.5 39 179.0 40 221.0 41 263.0 42 267.5 43 264.0 44 280.5 45 280.0 46 265.0 47 251.0 48 234.5 49 191.0 50 144.5 51 122.5 52 92.5 53 69.5 54 56.0 55 36.0 56 30.0 57 22.5 58 12.5 59 12.0 60 9.0 61 4.0 62 4.0 63 3.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.27499999999999997 2 0.3 3 0.325 4 0.325 5 0.35000000000000003 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.06999999999999999 15-19 0.05 20-24 0.06999999999999999 25-29 0.08 30-34 0.08499999999999999 35-39 0.525 40-44 1.145 45-49 0.08 50-54 0.22 55-59 0.21 60-64 0.105 65-69 0.22499999999999998 70-74 0.245 75-79 0.11499999999999999 80-84 1.4449999999999998 85-89 3.195 90-94 2.63 95-99 2.6149999999999998 100-104 0.36 105-109 0.23500000000000001 110-114 0.20500000000000002 115-119 0.245 120-124 0.25 125-129 0.9299999999999999 130-134 3.5249999999999995 135-139 5.715 140-144 4.88 145-149 0.915 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57178841309823 98.825 2 0.3526448362720403 0.7000000000000001 3 0.025188916876574305 0.075 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025188916876574305 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 12 0.3 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.6000000000000001 0.0 0.0 0.0 0.0 92-93 0.7124999999999999 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9625 0.0 0.0 0.0 0.0 98-99 1.1 0.0 0.0 0.0 0.0 100-101 1.275 0.0 0.0 0.0 0.0 102-103 1.5125 0.0 0.0 0.0 0.0 104-105 1.675 0.0 0.0 0.0 0.0 106-107 2.0125 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 3.0625 0.0 0.0 0.0 0.0 116-117 3.4 0.0 0.0 0.0 0.0 118-119 3.7874999999999996 0.0 0.0 0.0 0.0 120-121 4.1 0.0 0.0 0.0 0.0 122-123 4.4625 0.0 0.0 0.0 0.0 124-125 4.975 0.0 0.0 0.0 0.0 126-127 5.325 0.0 0.0 0.0 0.0 128-129 5.7 0.0 0.0 0.0 0.0 130-131 6.1 0.0 0.0 0.0 0.0 132-133 6.5375 0.0 0.0 0.0 0.0 134-135 6.9125 0.0 0.0 0.0 0.0 136-137 7.2375 0.0 0.0 0.0 0.0 138 7.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCACATT 10 0.007352424 141.47499 2 >>END_MODULE Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076032 spots for SRR6031364.sra Written 1076032 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra Read 1076026 spots for SRR6031364.sra Written 1076026 spots for SRR6031364.sra SRR ids: ['SRR6031364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bx2ra8f_ SRR6031364.sra spots: 21520526 blocks: [[1, 1076026], [1076027, 2152052], [2152053, 3228078], [3228079, 4304104], [4304105, 5380130], [5380131, 6456156], [6456157, 7532182], [7532183, 8608208], [8608209, 9684234], [9684235, 10760260], [10760261, 11836286], [11836287, 12912312], [12912313, 13988338], [13988339, 15064364], [15064365, 16140390], [16140391, 17216416], [17216417, 18292442], [18292443, 19368468], [19368469, 20444494], [20444495, 21520526]] SRR6031364 file size 7228867 SRR6031364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031364 SRR6031364_1.fastq SRR6031364_2.fastq Input file: SRR6031364_1.fastq Paired file: SRR6031364_2.fastq trimmed: SRR6031364-trimmed-pair1.fastq, SRR6031364-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:59:38 2025 >> started Fri Feb 14 05:00:00 2025 >> done (22.681s) 21520526 read pairs processed; of these: 21015 ( 0.10%) short read pairs filtered out after trimming by size control 79393 ( 0.37%) empty read pairs filtered out after trimming by size control 21420118 (99.53%) read pairs available; of these: 9379021 (43.79%) trimmed read pairs available after processing 12041097 (56.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 15 0.00% 20 13 0.00% 21 16 0.00% 22 18 0.00% 23 12 0.00% 24 31 0.00% 25 19 0.00% 26 20 0.00% 27 32 0.00% 28 30 0.00% 29 25 0.00% 30 36 0.00% 31 25 0.00% 32 28 0.00% 33 35 0.00% 34 34 0.00% 35 34 0.00% 36 40 0.00% 37 41 0.00% 38 64 0.00% 39 74 0.00% 40 78 0.00% 41 62 0.00% 42 101 0.00% 43 128 0.00% 44 107 0.00% 45 308 0.00% 46 130 0.00% 47 134 0.00% 48 173 0.00% 49 207 0.00% 50 245 0.00% 51 258 0.00% 52 297 0.00% 53 310 0.00% 54 358 0.00% 55 366 0.00% 56 410 0.00% 57 450 0.00% 58 505 0.00% 59 651 0.00% 60 612 0.00% 61 728 0.00% 62 800 0.00% 63 928 0.00% 64 1003 0.00% 65 1089 0.01% 66 1293 0.01% 67 1426 0.01% 68 1638 0.01% 69 2439 0.01% 70 2544 0.01% 71 2164 0.01% 72 2466 0.01% 73 2837 0.01% 74 3061 0.01% 75 3309 0.02% 76 3540 0.02% 77 3795 0.02% 78 4127 0.02% 79 4599 0.02% 80 5240 0.02% 81 5876 0.03% 82 6465 0.03% 83 7385 0.03% 84 8802 0.04% 85 9846 0.05% 86 10287 0.05% 87 10874 0.05% 88 11459 0.05% 89 12439 0.06% 90 13258 0.06% 91 14255 0.07% 92 15585 0.07% 93 16670 0.08% 94 18126 0.08% 95 18934 0.09% 96 20050 0.09% 97 21726 0.10% 98 24142 0.11% 99 22128 0.10% 100 23303 0.11% 101 24220 0.11% 102 26078 0.12% 103 27377 0.13% 104 28967 0.14% 105 30189 0.14% 106 31673 0.15% 107 32912 0.15% 108 33031 0.15% 109 34492 0.16% 110 34823 0.16% 111 36034 0.17% 112 37513 0.18% 113 39244 0.18% 114 40352 0.19% 115 42100 0.20% 116 42991 0.20% 117 44124 0.21% 118 45635 0.21% 119 46509 0.22% 120 47545 0.22% 121 48964 0.23% 122 49965 0.23% 123 51456 0.24% 124 54099 0.25% 125 57216 0.27% 126 58385 0.27% 127 59040 0.28% 128 61080 0.29% 129 62673 0.29% 130 64081 0.30% 131 66456 0.31% 132 69439 0.32% 133 72219 0.34% 134 75292 0.35% 135 79899 0.37% 136 83514 0.39% 137 89923 0.42% 138 95650 0.45% 139 101336 0.47% 140 105939 0.49% 141 113504 0.53% 142 119845 0.56% 143 131946 0.62% 144 151617 0.71% 145 181814 0.85% 146 235375 1.10% 147 354757 1.66% 148 718115 3.35% 149 4892427 22.84% 150 12041097 56.21% 21420118 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=3.4 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=834.73 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=24.2 sequence=CAGCAGCAAGACAAACCGAATTATTCATAAGTACCAATAAAATAAGCATTGCGCAAAAGGGATAGGATAAATCACTCTTAAGCTTGAGGCTTCTCCCATTTGAGGGGCTTGACAACTTCCCAGGTGAAGTCTGGGTCATCCCTTCCAAAATGTCCGTATGCAGCTGTCTTCAAGAACCT criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.33 fanout-score-rank=30 prefix-density=0.60 prefix-fanout=2.8 sequence=TCTCCTTTCTTCTCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=393.11 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=32.4 sequence=AAGAAGAAGAAA SRR6031364 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:00:42 Started mapping on | Feb 14 05:00:43 Finished on | Feb 14 05:03:10 Mapping speed, Million of reads per hour | 524.57 Number of input reads | 21420118 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 20330460 Uniquely mapped reads % | 94.91% Average mapped length | 291.34 Number of splices: Total | 19624122 Number of splices: Annotated (sjdb) | 19282371 Number of splices: GT/AG | 19304584 Number of splices: GC/AG | 248840 Number of splices: AT/AC | 11748 Number of splices: Non-canonical | 58950 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 747726 % of reads mapped to multiple loci | 3.49% Number of reads mapped to too many loci | 22508 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.46% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 356143 356143 356143 N_multimapping 747726 747726 747726 N_noFeature 542583 20092673 662620 N_ambiguous 243559 846 125340 UnstrandedReadsAssigned:19544318 PositiveStrandReadsAssigned:236941 NegativeStrandReadsAssigned:19542500 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031364 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031364-trimmed-pair1.fastq SRR6031364-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,420,118 reads, 19,557,750 reads pseudoaligned [quant] estimated average fragment length: 246.53 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,023 rounds 52401 SRR6031364.ke.tsv 34699 SRR6031364.se.tsv 87100 total ==> SRR6031364.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.47 340 9.86604 Potri.005G024800.1.v4.1 1035 789.47 135 8.7951 Potri.004G059700.1.v4.1 961 715.504 10 0.718838 Potri.007G009000.2.v4.1 1416 1170.47 0 0 Potri.003G141000.2.v4.1 2943 2697.47 505.112 9.63106 Potri.016G087400.1.v4.1 270 84.5708 1825 1109.9 Potri.015G069301.1.v4.1 564 325.728 0 0 Potri.010G195200.1.v4.1 1773 1527.47 63.4465 2.13638 Potri.012G127500.1.v4.1 977 731.48 2198 154.55 ==> SRR6031364.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 633 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 730 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 20 SRR6031364 completed mapping pipeline successfully