Starting /dee2/code/volunteer_pipeline.sh SRR6031365 current disk space = 3087836188672 free memory = 1466963652 SRR6031365 SRAfilesize 237363de7896287545a61a4313e0f2c3 SRR6031365.sra SRR6031365.sra file validated SRR6031365 is paired end SRR6031365 is conventional basespace SRR6031365 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7605 34.0 33.0 34.0 33.0 34.0 2 33.32025 34.0 33.0 34.0 33.0 34.0 3 33.40325 34.0 34.0 34.0 33.0 34.0 4 33.452 34.0 34.0 34.0 33.0 34.0 5 33.371 34.0 34.0 34.0 33.0 34.0 6 37.195 38.0 38.0 38.0 36.0 38.0 7 37.3625 38.0 38.0 38.0 37.0 38.0 8 37.508 38.0 38.0 38.0 37.0 38.0 9 37.601 38.0 38.0 38.0 38.0 38.0 10-14 37.5238 38.0 38.0 38.0 37.8 38.0 15-19 37.5295 38.0 38.0 38.0 37.8 38.0 20-24 37.514250000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.471199999999996 38.0 38.0 38.0 37.8 38.0 30-34 37.391450000000006 38.0 38.0 38.0 37.2 38.0 35-39 37.3424 38.0 38.0 38.0 37.0 38.0 40-44 37.20309999999999 38.0 38.0 38.0 36.8 38.0 45-49 37.130100000000006 38.0 38.0 38.0 36.0 38.0 50-54 37.0828 38.0 38.0 38.0 36.0 38.0 55-59 37.00429999999999 38.0 38.0 38.0 36.0 38.0 60-64 37.015699999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.97885 38.0 38.0 38.0 36.0 38.0 70-74 36.91015 38.0 38.0 38.0 36.0 38.0 75-79 36.78325 38.0 38.0 38.0 35.2 38.0 80-84 36.710699999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.663850000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.51475000000001 38.0 38.0 38.0 34.0 38.0 95-99 36.48979999999999 38.0 38.0 38.0 34.0 38.0 100-104 36.37415 38.0 38.0 38.0 34.0 38.0 105-109 36.19315 38.0 38.0 38.0 33.8 38.0 110-114 36.00455 38.0 37.4 38.0 33.2 38.0 115-119 35.9865 38.0 37.2 38.0 33.0 38.0 120-124 35.6659 38.0 37.0 38.0 31.0 38.0 125-129 35.459199999999996 38.0 36.6 38.0 31.0 38.0 130-134 35.131750000000004 38.0 36.0 38.0 28.8 38.0 135-139 34.82945000000001 38.0 35.8 38.0 28.0 38.0 140-144 34.422399999999996 38.0 35.0 38.0 26.8 38.0 145-149 33.66135 38.0 33.4 38.0 22.4 38.0 150 26.205 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 4.0 11 1.0 12 1.0 13 3.0 14 2.0 15 0.0 16 2.0 17 4.0 18 6.0 19 5.0 20 4.0 21 4.0 22 5.0 23 6.0 24 6.0 25 12.0 26 23.0 27 27.0 28 29.0 29 23.0 30 46.0 31 54.0 32 69.0 33 75.0 34 175.0 35 235.0 36 572.0 37 2607.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.390405715743814 15.565195202857874 6.608828782852768 47.43557029854555 2 16.825000000000003 15.6 48.125 19.45 3 13.725000000000001 21.0 33.2 32.074999999999996 4 20.424999999999997 28.799999999999997 26.35 24.425 5 21.238716148445334 36.033099297893685 24.37311935807422 18.35506519558676 6 16.05 36.15 27.224999999999998 20.575 7 12.875 24.85 46.075 16.2 8 13.8 24.15 36.325 25.724999999999998 9 15.125 22.175 37.7 25.0 10-14 19.29 30.14 27.525 23.044999999999998 15-19 19.185 28.994999999999997 27.955000000000002 23.865 20-24 18.89 29.225 27.625 24.26 25-29 19.145 29.409999999999997 27.644999999999996 23.799999999999997 30-34 19.1 29.349999999999998 27.644999999999996 23.905 35-39 19.105 28.895 28.24 23.76 40-44 19.75 28.685 27.894999999999996 23.669999999999998 45-49 19.2 28.794999999999998 27.884999999999998 24.12 50-54 19.82 28.88 27.85 23.45 55-59 19.1 28.955 28.78 23.165 60-64 19.805 28.884999999999998 27.815 23.494999999999997 65-69 19.715 29.18 27.83 23.275000000000002 70-74 19.675 28.845 27.944999999999997 23.535 75-79 19.775000000000002 28.62 28.194999999999997 23.41 80-84 19.5 29.09 27.685 23.724999999999998 85-89 19.775000000000002 28.185 28.205000000000002 23.835 90-94 19.735 28.89 27.675 23.7 95-99 19.89 29.085 27.87 23.155 100-104 20.01 29.085 27.334999999999997 23.57 105-109 20.185 28.92 27.77 23.125 110-114 20.43 28.7 27.950000000000003 22.919999999999998 115-119 20.47 28.999999999999996 27.115000000000002 23.415 120-124 19.57 29.505 27.245 23.68 125-129 20.369999999999997 28.125 27.72 23.785 130-134 20.555 28.835 27.544999999999998 23.064999999999998 135-139 20.76 29.185 26.555 23.5 140-144 20.805 28.33 27.245 23.62 145-149 20.424999999999997 29.45 27.21 22.915 150 20.245552493109496 28.639438737158606 27.261338010523676 23.853670759208217 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 2.5 23 3.5 24 4.5 25 5.0 26 9.0 27 13.5 28 17.0 29 20.5 30 24.0 31 33.0 32 39.5 33 47.5 34 68.0 35 87.0 36 101.5 37 120.5 38 141.0 39 165.0 40 210.5 41 245.0 42 255.5 43 273.5 44 280.0 45 275.0 46 263.5 47 234.0 48 208.0 49 190.5 50 158.5 51 130.0 52 106.5 53 76.5 54 50.0 55 37.0 56 28.0 57 17.0 58 15.5 59 11.5 60 5.5 61 4.5 62 3.5 63 2.0 64 1.0 65 1.0 66 0.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64859437751004 99.25 2 0.30120481927710846 0.6 3 0.0502008032128514 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.037500000000000006 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.0625 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.75 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.225 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.6625 0.0 0.0 0.0 0.0 118-119 2.975 0.0 0.0 0.0 0.0 120-121 3.2 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.7125 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.6625 0.0 0.0 0.0 0.0 130-131 5.1125 0.0 0.0 0.0 0.0 132-133 5.5875 0.0 0.0 0.0 0.0 134-135 5.9375 0.0 0.0 0.0 0.0 136-137 6.362500000000001 0.0 0.0 0.0 0.0 138 6.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCAGAA 10 0.006721726 145.75949 1 TTACGAA 10 0.0069827023 143.9375 6 >>END_MODULE SRR6031365 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031365_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.61525 33.0 33.0 34.0 32.0 34.0 2 32.87125 33.0 33.0 34.0 32.0 34.0 3 32.9455 33.0 33.0 34.0 32.0 34.0 4 32.87975 34.0 33.0 34.0 32.0 34.0 5 32.955 34.0 33.0 34.0 32.0 34.0 6 37.083 38.0 38.0 38.0 37.0 38.0 7 37.118 38.0 38.0 38.0 37.0 38.0 8 37.1595 38.0 38.0 38.0 37.0 38.0 9 37.12425 38.0 38.0 38.0 37.0 38.0 10-14 37.084250000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.004450000000006 38.0 38.0 38.0 37.0 38.0 20-24 37.01705 38.0 38.0 38.0 36.4 38.0 25-29 37.01915 38.0 38.0 38.0 36.6 38.0 30-34 37.0421 38.0 38.0 38.0 36.8 38.0 35-39 36.69895 38.0 38.0 38.0 36.2 38.0 40-44 36.56375 38.0 38.0 38.0 36.0 38.0 45-49 36.8135 38.0 38.0 38.0 36.0 38.0 50-54 36.894850000000005 38.0 38.0 38.0 36.0 38.0 55-59 36.78415 38.0 38.0 38.0 36.0 38.0 60-64 36.8212 38.0 38.0 38.0 36.0 38.0 65-69 36.8039 38.0 38.0 38.0 36.0 38.0 70-74 36.73365 38.0 38.0 38.0 36.0 38.0 75-79 36.60705 38.0 38.0 38.0 35.4 38.0 80-84 36.03159999999999 38.0 38.0 38.0 34.0 38.0 85-89 35.314550000000004 38.0 38.0 38.0 32.4 38.0 90-94 35.46655 38.0 38.0 38.0 32.6 38.0 95-99 35.4116 38.0 38.0 38.0 33.0 38.0 100-104 35.87115 38.0 38.0 38.0 32.2 38.0 105-109 36.1637 38.0 38.0 38.0 34.0 38.0 110-114 36.00285 38.0 38.0 38.0 33.8 38.0 115-119 35.85085 38.0 38.0 38.0 33.2 38.0 120-124 35.55455 38.0 37.4 38.0 31.6 38.0 125-129 34.81835 38.0 36.8 38.0 28.2 38.0 130-134 33.589600000000004 38.0 36.0 38.0 16.2 38.0 135-139 32.6652 38.0 33.6 38.0 13.0 38.0 140-144 32.449149999999996 38.0 33.0 38.0 10.8 38.0 145-149 31.497650000000004 38.0 33.0 38.0 2.0 38.0 150 23.57175 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 5.0 6 1.0 7 2.0 8 2.0 9 1.0 10 3.0 11 2.0 12 4.0 13 3.0 14 3.0 15 2.0 16 3.0 17 8.0 18 3.0 19 4.0 20 12.0 21 15.0 22 18.0 23 27.0 24 13.0 25 38.0 26 45.0 27 37.0 28 41.0 29 40.0 30 49.0 31 74.0 32 83.0 33 119.0 34 117.0 35 226.0 36 475.0 37 2516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.67225419064298 25.769326995246434 11.358518889166875 33.19989992494371 2 24.675 22.575 39.875 12.875 3 15.55 27.875 37.15 19.425 4 20.325 35.425000000000004 26.424999999999997 17.825 5 23.925 38.95 20.925 16.2 6 19.400000000000002 40.725 23.175 16.7 7 18.825 20.150000000000002 41.525 19.5 8 16.975 24.85 31.05 27.125 9 18.8 23.625 33.074999999999996 24.5 10-14 23.175 28.335 27.615000000000002 20.875 15-19 22.384999999999998 27.63 29.175 20.810000000000002 20-24 22.465 28.15 28.360000000000003 21.025 25-29 22.32 28.325 28.720000000000002 20.635 30-34 22.55563890972743 27.671917979494875 28.862215553888472 20.91022755688922 35-39 22.916561506233908 28.181313411740955 28.206551915602446 20.695573166422694 40-44 22.900647511129097 27.84297855119385 28.763658437879403 20.492715499797654 45-49 22.740933680625126 27.875175315568022 28.396113003406132 20.987778000400723 50-54 23.135 27.715 28.144999999999996 21.005 55-59 22.455 28.275 28.685 20.585 60-64 23.494999999999997 28.144999999999996 28.015 20.345 65-69 23.255 27.915 28.499999999999996 20.330000000000002 70-74 23.175 27.825 28.64 20.36 75-79 22.410338609497092 28.416149068322984 28.130635143257866 21.04287717892206 80-84 23.03390778303086 28.249707691525593 28.493721722332367 20.22266280311118 85-89 23.588281047446202 27.736582836401347 28.327715841327457 20.347420274824994 90-94 22.926202108511184 27.92491643095912 28.75803548470044 20.39084597582926 95-99 23.093569661995055 27.823577906018137 28.49340478153339 20.589447650453423 100-104 23.43333835871149 28.338107442585052 28.001407105884716 20.227147092818733 105-109 23.595 28.28 27.845 20.28 110-114 23.52 27.944999999999997 28.125 20.41 115-119 23.98 27.834999999999997 28.050000000000004 20.135 120-124 23.95 28.03 28.205000000000002 19.814999999999998 125-129 24.21934501142422 27.804011170347803 28.118811881188122 19.857831937039858 130-134 24.07233197449566 28.263823560154698 27.83526706386537 19.828577401484267 135-139 23.74820411855478 28.72346086308732 28.16474219124142 19.36359282711648 140-144 24.55058252939006 27.945595445200063 27.98776951868839 19.516052506721493 145-149 24.56672224748623 28.19968672628973 27.659036935981003 19.57455409024304 150 25.100908173562058 27.547931382441977 27.01816347124117 20.332996972754795 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 3.0 21 2.0 22 2.0 23 3.5 24 4.5 25 9.5 26 9.5 27 8.0 28 14.0 29 21.5 30 25.5 31 26.5 32 38.5 33 56.5 34 68.5 35 78.0 36 98.5 37 135.5 38 159.5 39 167.5 40 198.5 41 236.5 42 247.0 43 267.0 44 283.0 45 290.0 46 278.0 47 249.5 48 215.0 49 173.5 50 146.0 51 121.5 52 96.0 53 73.0 54 60.5 55 39.0 56 22.5 57 19.0 58 16.0 59 9.5 60 5.5 61 6.5 62 4.5 63 2.0 64 1.0 65 1.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.025 35-39 0.9450000000000001 40-44 1.16 45-49 0.18 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.18 80-84 1.645 85-89 3.5749999999999997 90-94 2.775 95-99 2.96 100-104 0.505 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.525 130-134 4.33 135-139 6.035 140-144 5.155 145-149 1.045 150 0.8999999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.025 0.0 18-19 0.025 0.0 0.0 0.025 0.0 20-21 0.025 0.0 0.0 0.025 0.0 22-23 0.025 0.0 0.0 0.025 0.0 24-25 0.025 0.0 0.0 0.025 0.0 26-27 0.025 0.0 0.0 0.025 0.0 28-29 0.025 0.0 0.0 0.025 0.0 30-31 0.025 0.0 0.0 0.025 0.0 32-33 0.025 0.0 0.0 0.025 0.0 34-35 0.025 0.0 0.0 0.025 0.0 36-37 0.025 0.0 0.0 0.025 0.0 38-39 0.025 0.0 0.0 0.025 0.0 40-41 0.025 0.0 0.0 0.025 0.0 42-43 0.025 0.0 0.0 0.025 0.0 44-45 0.025 0.0 0.0 0.025 0.0 46-47 0.025 0.0 0.0 0.025 0.0 48-49 0.025 0.0 0.0 0.025 0.0 50-51 0.037500000000000006 0.0 0.0 0.025 0.0 52-53 0.05 0.0 0.0 0.025 0.0 54-55 0.05 0.0 0.0 0.025 0.0 56-57 0.05 0.0 0.0 0.025 0.0 58-59 0.0625 0.0 0.0 0.025 0.0 60-61 0.075 0.0 0.0 0.025 0.0 62-63 0.075 0.0 0.0 0.025 0.0 64-65 0.075 0.0 0.0 0.025 0.0 66-67 0.075 0.0 0.0 0.025 0.0 68-69 0.075 0.0 0.0 0.025 0.0 70-71 0.075 0.0 0.0 0.025 0.0 72-73 0.075 0.0 0.0 0.025 0.0 74-75 0.075 0.0 0.0 0.025 0.0 76-77 0.1125 0.0 0.0 0.025 0.0 78-79 0.125 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.1375 0.0 0.0 0.025 0.0 84-85 0.21250000000000002 0.0 0.0 0.025 0.0 86-87 0.25 0.0 0.0 0.025 0.0 88-89 0.2875 0.0 0.0 0.025 0.0 90-91 0.3125 0.0 0.0 0.025 0.0 92-93 0.4125 0.0 0.0 0.025 0.0 94-95 0.44999999999999996 0.0 0.0 0.025 0.0 96-97 0.6375 0.0 0.0 0.025 0.0 98-99 0.75 0.0 0.0 0.025 0.0 100-101 0.9125 0.0 0.0 0.025 0.0 102-103 1.1125 0.0 0.0 0.025 0.0 104-105 1.2625000000000002 0.0 0.0 0.025 0.0 106-107 1.4 0.0 0.0 0.025 0.0 108-109 1.675 0.0 0.0 0.025 0.0 110-111 1.925 0.0 0.0 0.025 0.0 112-113 2.3 0.0 0.0 0.025 0.0 114-115 2.575 0.0 0.0 0.025 0.0 116-117 2.7249999999999996 0.0 0.0 0.025 0.0 118-119 3.0374999999999996 0.0 0.0 0.025 0.0 120-121 3.25 0.0 0.0 0.025 0.0 122-123 3.5 0.0 0.0 0.025 0.0 124-125 3.75 0.0 0.0 0.025 0.0 126-127 4.275 0.0 0.0 0.025 0.0 128-129 4.6625 0.0 0.0 0.025 0.0 130-131 5.074999999999999 0.0 0.0 0.025 0.0 132-133 5.5375 0.0 0.0 0.025 0.0 134-135 5.8625 0.0 0.0 0.025 0.0 136-137 6.2875 0.0 0.0 0.025 0.0 138 6.725 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAGCGA 10 0.0071935453 142.5125 4 GAAGATT 10 0.0071935453 142.5125 2 TCATGGC 10 0.0071935453 142.5125 7 GCATGTA 10 0.0071935453 142.5125 1 AAGCGAG 10 0.0071935453 142.5125 5 GATTAAG 10 0.0071935453 142.5125 5 TCTCATT 10 0.0071935453 142.5125 2 AGCGAGG 10 0.0071935453 142.5125 6 >>END_MODULE Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra Read 1109636 spots for SRR6031365.sra Written 1109636 spots for SRR6031365.sra SRR ids: ['SRR6031365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6_s5e6nk SRR6031365.sra spots: 22192720 blocks: [[1, 1109636], [1109637, 2219272], [2219273, 3328908], [3328909, 4438544], [4438545, 5548180], [5548181, 6657816], [6657817, 7767452], [7767453, 8877088], [8877089, 9986724], [9986725, 11096360], [11096361, 12205996], [12205997, 13315632], [13315633, 14425268], [14425269, 15534904], [15534905, 16644540], [16644541, 17754176], [17754177, 18863812], [18863813, 19973448], [19973449, 21083084], [21083085, 22192720]] SRR6031365 file size 7455339 SRR6031365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031365 SRR6031365_1.fastq SRR6031365_2.fastq Input file: SRR6031365_1.fastq Paired file: SRR6031365_2.fastq trimmed: SRR6031365-trimmed-pair1.fastq, SRR6031365-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:07:53 2025 >> started Fri Feb 14 04:08:15 2025 >> done (22.643s) 22192720 read pairs processed; of these: 24738 ( 0.11%) short read pairs filtered out after trimming by size control 37093 ( 0.17%) empty read pairs filtered out after trimming by size control 22130889 (99.72%) read pairs available; of these: 12492396 (56.45%) trimmed read pairs available after processing 9638493 (43.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 15 0.00% 20 25 0.00% 21 21 0.00% 22 19 0.00% 23 32 0.00% 24 41 0.00% 25 22 0.00% 26 30 0.00% 27 42 0.00% 28 33 0.00% 29 34 0.00% 30 49 0.00% 31 52 0.00% 32 47 0.00% 33 42 0.00% 34 36 0.00% 35 61 0.00% 36 41 0.00% 37 52 0.00% 38 42 0.00% 39 54 0.00% 40 58 0.00% 41 65 0.00% 42 75 0.00% 43 80 0.00% 44 77 0.00% 45 86 0.00% 46 104 0.00% 47 121 0.00% 48 135 0.00% 49 118 0.00% 50 152 0.00% 51 155 0.00% 52 182 0.00% 53 194 0.00% 54 213 0.00% 55 215 0.00% 56 244 0.00% 57 259 0.00% 58 270 0.00% 59 332 0.00% 60 337 0.00% 61 443 0.00% 62 490 0.00% 63 521 0.00% 64 609 0.00% 65 661 0.00% 66 831 0.00% 67 958 0.00% 68 1097 0.00% 69 2246 0.01% 70 2175 0.01% 71 1699 0.01% 72 1610 0.01% 73 1792 0.01% 74 1891 0.01% 75 2136 0.01% 76 2416 0.01% 77 2532 0.01% 78 2840 0.01% 79 3312 0.01% 80 3692 0.02% 81 4283 0.02% 82 4905 0.02% 83 5726 0.03% 84 7270 0.03% 85 8034 0.04% 86 8524 0.04% 87 9253 0.04% 88 9798 0.04% 89 10653 0.05% 90 11435 0.05% 91 12423 0.06% 92 13446 0.06% 93 14857 0.07% 94 15708 0.07% 95 17185 0.08% 96 18417 0.08% 97 19600 0.09% 98 21290 0.10% 99 21415 0.10% 100 22884 0.10% 101 24055 0.11% 102 25874 0.12% 103 27793 0.13% 104 29078 0.13% 105 31187 0.14% 106 32368 0.15% 107 34079 0.15% 108 34816 0.16% 109 36871 0.17% 110 37879 0.17% 111 38987 0.18% 112 41281 0.19% 113 43994 0.20% 114 45011 0.20% 115 47266 0.21% 116 49301 0.22% 117 50570 0.23% 118 52002 0.23% 119 53947 0.24% 120 55477 0.25% 121 57836 0.26% 122 60218 0.27% 123 62711 0.28% 124 66372 0.30% 125 69868 0.32% 126 72516 0.33% 127 74639 0.34% 128 75433 0.34% 129 79292 0.36% 130 80988 0.37% 131 83760 0.38% 132 87141 0.39% 133 92668 0.42% 134 96290 0.44% 135 102789 0.46% 136 109625 0.50% 137 117759 0.53% 138 126685 0.57% 139 133740 0.60% 140 143549 0.65% 141 155425 0.70% 142 170774 0.77% 143 194026 0.88% 144 231974 1.05% 145 289402 1.31% 146 386122 1.74% 147 583374 2.64% 148 1202904 5.44% 149 6397347 28.91% 150 9638493 43.55% 22130889 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=34 prefix-density=0.20 prefix-fanout=2.1 sequence=AACGAGCATTAAGTGTCCCAATGTGGAACCTTCTCCCCGCAATGTCAACATAAGGCGTTTCAGCATCAGGTGTGAAGAGACCAGAGTCTTGAAGGGCCTTTTCGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=26 fanout-score=61.81 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=9.4 sequence=CTTTTTCTTAATGAACTCAAAAGCATATTCCATTAGCCCTCCATTACATCCTTGATTTTCTGTAGTGTCACAATCCACCAACTC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=2.68 fanout-score-rank=24 prefix-density=0.42 prefix-fanout=2.4 sequence=TGGTAGTGATGGTGGTTGGGCTGCTGGTTTTGGCTCAGCAGTCCTTCCAAATGAGTTTGAGAAACCCTGTTGCTGAGACAAACAATTGCAAAATTGATTTCACTCGTTTAGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=83.86 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=13.7 sequence=TCTTCCTCTCTATAATTTTCTAGGGTTTAGCAATGTCTGCCGAGGTTGAGTACAGGTGCTTTGTTGGCGGCCTCGCTTGGGCCACCACTGACCAAGTCCTCCAAGAGGCTTTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA SRR6031365 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:09:05 Started mapping on | Feb 14 04:09:05 Finished on | Feb 14 04:11:59 Mapping speed, Million of reads per hour | 457.88 Number of input reads | 22130889 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20760152 Uniquely mapped reads % | 93.81% Average mapped length | 290.62 Number of splices: Total | 18970234 Number of splices: Annotated (sjdb) | 18568905 Number of splices: GT/AG | 18643163 Number of splices: GC/AG | 254146 Number of splices: AT/AC | 12707 Number of splices: Non-canonical | 60218 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.74 Insertion rate per base | 0.03% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 934631 % of reads mapped to multiple loci | 4.22% Number of reads mapped to too many loci | 38140 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.75% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 460155 460155 460155 N_multimapping 934631 934631 934631 N_noFeature 642156 20420035 811100 N_ambiguous 312518 1961 140115 UnstrandedReadsAssigned:19805478 PositiveStrandReadsAssigned:338156 NegativeStrandReadsAssigned:19808937 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031365 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031365-trimmed-pair1.fastq SRR6031365-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,130,889 reads, 20,119,781 reads pseudoaligned [quant] estimated average fragment length: 253.763 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR6031365.ke.tsv 34699 SRR6031365.se.tsv 87100 total ==> SRR6031365.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.24 565 15.0277 Potri.005G024800.1.v4.1 1035 782.237 547 32.8318 Potri.004G059700.1.v4.1 961 708.304 28 1.85603 Potri.007G009000.2.v4.1 1416 1163.24 0 0 Potri.003G141000.2.v4.1 2943 2690.24 332.133 5.79651 Potri.016G087400.1.v4.1 270 84.9045 1367 755.933 Potri.015G069301.1.v4.1 564 320.7 0 0 Potri.010G195200.1.v4.1 1773 1520.24 148 4.57084 Potri.012G127500.1.v4.1 977 724.256 3575 231.755 ==> SRR6031365.se.tsv <== Potri.001G166300.v4.1 286 Potri.001G448400.v4.1 614 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 501 Potri.001G212900.v4.1 120 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 15 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 2 SRR6031365 completed mapping pipeline successfully