Starting /dee2/code/volunteer_pipeline.sh SRR6031366 current disk space = 3086332329984 free memory = 1582117624 SRR6031366 SRAfilesize 144b00e5cf0eb3c48c44d9f0202f14d1 SRR6031366.sra SRR6031366.sra file validated SRR6031366 is paired end SRR6031366 is conventional basespace SRR6031366 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031366_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.3505 34.0 34.0 34.0 33.0 34.0 2 33.51175 34.0 34.0 34.0 33.0 34.0 3 33.5335 34.0 34.0 34.0 33.0 34.0 4 33.525 34.0 34.0 34.0 33.0 34.0 5 33.496 34.0 34.0 34.0 33.0 34.0 6 37.22425 38.0 38.0 38.0 36.0 38.0 7 37.508 38.0 38.0 38.0 37.0 38.0 8 37.5295 38.0 38.0 38.0 37.0 38.0 9 37.5485 38.0 38.0 38.0 38.0 38.0 10-14 37.5043 38.0 38.0 38.0 37.8 38.0 15-19 37.548500000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.530899999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.488 38.0 38.0 38.0 37.8 38.0 30-34 37.462 38.0 38.0 38.0 37.8 38.0 35-39 37.41075 38.0 38.0 38.0 37.4 38.0 40-44 37.287600000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.269999999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.238 38.0 38.0 38.0 37.0 38.0 55-59 37.2022 38.0 38.0 38.0 37.0 38.0 60-64 37.20345 38.0 38.0 38.0 37.0 38.0 65-69 37.151700000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.131 38.0 38.0 38.0 36.4 38.0 75-79 37.10680000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.9846 38.0 38.0 38.0 36.0 38.0 85-89 36.93575 38.0 38.0 38.0 36.0 38.0 90-94 36.924249999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.84065 38.0 38.0 38.0 35.8 38.0 100-104 36.74645 38.0 38.0 38.0 35.0 38.0 105-109 36.6559 38.0 38.0 38.0 34.8 38.0 110-114 36.443400000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.3616 38.0 38.0 38.0 34.0 38.0 120-124 36.22515 38.0 38.0 38.0 33.8 38.0 125-129 36.072449999999996 38.0 38.0 38.0 33.0 38.0 130-134 35.86325000000001 38.0 37.4 38.0 32.6 38.0 135-139 35.792699999999996 38.0 37.4 38.0 33.0 38.0 140-144 35.38735 38.0 36.6 38.0 31.0 38.0 145-149 34.7359 38.0 36.0 38.0 29.6 38.0 150 28.066 33.0 25.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 3.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 1.0 19 1.0 20 3.0 21 5.0 22 5.0 23 4.0 24 6.0 25 10.0 26 18.0 27 18.0 28 25.0 29 28.0 30 41.0 31 43.0 32 57.0 33 80.0 34 100.0 35 166.0 36 407.0 37 2971.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.88947500627983 14.192413966340114 9.16855061542326 36.74956041195679 2 20.325 19.775000000000002 36.4 23.5 3 18.9 23.775 26.25 31.075000000000003 4 21.85 31.075000000000003 22.900000000000002 24.175 5 21.025 37.05 22.625 19.3 6 16.7 35.325 26.25 21.725 7 13.65 23.375 43.775 19.2 8 18.125 23.7 31.574999999999996 26.6 9 17.2 23.025000000000002 34.25 25.525 10-14 19.66 29.310000000000002 27.18 23.849999999999998 15-19 19.09 28.794999999999998 28.1 24.015 20-24 19.555 28.849999999999998 27.834999999999997 23.76 25-29 19.215 28.95 28.04 23.794999999999998 30-34 19.07 29.21 28.189999999999998 23.53 35-39 19.175 28.645 28.535 23.645 40-44 19.98 28.305000000000003 28.165000000000003 23.549999999999997 45-49 19.695 28.26 28.04 24.005000000000003 50-54 19.7 28.299999999999997 28.410000000000004 23.59 55-59 19.580000000000002 28.725 27.775 23.919999999999998 60-64 19.785 28.49 28.115000000000002 23.61 65-69 19.98 28.53 27.700000000000003 23.79 70-74 19.905 28.744999999999997 27.935 23.415 75-79 19.38 27.965 28.754999999999995 23.9 80-84 20.23 28.07 28.485 23.215 85-89 19.86 28.095 28.065 23.98 90-94 20.119999999999997 28.139999999999997 28.294999999999998 23.445 95-99 19.39 28.285 28.315 24.01 100-104 19.5 28.884999999999998 27.855 23.76 105-109 19.919999999999998 28.345 28.249999999999996 23.485 110-114 19.48 28.48 27.57 24.47 115-119 19.945 28.59 27.834999999999997 23.630000000000003 120-124 19.82 28.585 27.245 24.349999999999998 125-129 20.41 28.465 27.54 23.585 130-134 20.785 28.689999999999998 27.355 23.169999999999998 135-139 20.71 28.549999999999997 27.345000000000002 23.395 140-144 19.794999999999998 27.855 28.7 23.65 145-149 20.29 28.325 28.09 23.294999999999998 150 19.900000000000002 27.525 29.5 23.075000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 1.5 22 0.5 23 2.5 24 3.5 25 2.5 26 5.0 27 7.5 28 9.0 29 13.5 30 20.0 31 30.5 32 42.5 33 51.5 34 55.5 35 66.5 36 93.0 37 114.5 38 131.0 39 165.5 40 212.0 41 252.5 42 259.5 43 256.0 44 274.0 45 282.0 46 260.5 47 236.0 48 220.5 49 187.5 50 152.5 51 133.5 52 113.5 53 95.5 54 73.5 55 55.0 56 41.5 57 20.0 58 11.0 59 9.5 60 8.0 61 5.5 62 3.5 63 3.0 64 2.5 65 3.5 66 1.5 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.325 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.4375 0.0 0.0 0.0 0.0 120-121 0.45 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.55 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.7875000000000001 0.0 0.0 0.0 0.0 132-133 0.8125 0.0 0.0 0.0 0.0 134-135 0.9375 0.0 0.0 0.0 0.0 136-137 1.0625 0.0 0.0 0.0 0.0 138 1.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031366 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031366_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.74325 33.0 33.0 34.0 32.0 34.0 2 32.87025 34.0 33.0 34.0 32.0 34.0 3 32.84675 34.0 33.0 34.0 32.0 34.0 4 32.76825 34.0 33.0 34.0 32.0 34.0 5 32.7625 34.0 33.0 34.0 32.0 34.0 6 37.0305 38.0 38.0 38.0 36.0 38.0 7 37.06725 38.0 38.0 38.0 37.0 38.0 8 37.0435 38.0 38.0 38.0 37.0 38.0 9 36.93725 38.0 38.0 38.0 37.0 38.0 10-14 36.9464 38.0 38.0 38.0 36.4 38.0 15-19 36.9497 38.0 38.0 38.0 37.0 38.0 20-24 36.98025 38.0 38.0 38.0 37.0 38.0 25-29 36.955799999999996 38.0 38.0 38.0 37.0 38.0 30-34 36.9534 38.0 38.0 38.0 37.0 38.0 35-39 36.704449999999994 38.0 38.0 38.0 36.2 38.0 40-44 36.48465 38.0 38.0 38.0 36.0 38.0 45-49 36.8582 38.0 38.0 38.0 36.4 38.0 50-54 36.8414 38.0 38.0 38.0 36.2 38.0 55-59 36.802150000000005 38.0 38.0 38.0 36.0 38.0 60-64 36.86 38.0 38.0 38.0 36.4 38.0 65-69 36.7711 38.0 38.0 38.0 36.0 38.0 70-74 36.79594999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.68285 38.0 38.0 38.0 35.8 38.0 80-84 36.1063 38.0 38.0 38.0 35.0 38.0 85-89 35.566199999999995 38.0 38.0 38.0 33.8 38.0 90-94 35.396 38.0 38.0 38.0 32.6 38.0 95-99 35.33185 38.0 38.0 38.0 32.4 38.0 100-104 36.04085 38.0 38.0 38.0 33.6 38.0 105-109 36.3611 38.0 38.0 38.0 34.6 38.0 110-114 36.24499999999999 38.0 38.0 38.0 34.0 38.0 115-119 36.119150000000005 38.0 38.0 38.0 34.0 38.0 120-124 36.05030000000001 38.0 38.0 38.0 34.0 38.0 125-129 35.4072 38.0 38.0 38.0 31.4 38.0 130-134 34.164699999999996 38.0 36.8 38.0 22.2 38.0 135-139 33.2889 38.0 36.0 38.0 13.4 38.0 140-144 33.031699999999994 38.0 34.8 38.0 13.0 38.0 145-149 32.65515 38.0 35.0 38.0 6.4 38.0 150 25.74575 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 5.0 4 2.0 5 1.0 6 3.0 7 6.0 8 1.0 9 2.0 10 1.0 11 1.0 12 2.0 13 6.0 14 2.0 15 5.0 16 4.0 17 4.0 18 4.0 19 6.0 20 5.0 21 9.0 22 15.0 23 21.0 24 23.0 25 36.0 26 28.0 27 31.0 28 47.0 29 48.0 30 43.0 31 49.0 32 67.0 33 96.0 34 101.0 35 191.0 36 375.0 37 2748.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.65624218163623 19.814861145859393 12.284213159869903 26.244683512634477 2 25.707133917396746 25.90738423028786 33.34167709637047 15.043804755944931 3 21.126408010012515 27.609511889862326 31.48936170212766 19.774718397997496 4 24.1991991991992 36.33633633633634 21.12112112112112 18.343343343343342 5 22.984476715072606 39.75963945918878 21.231847771657485 16.024036054081122 6 18.689016762571928 38.528896672504374 24.86865148861646 17.91343507630723 7 18.613960470352765 18.363772829622217 43.3324993745309 19.68976732549412 8 20.190142606955217 24.093069802351764 29.597197898423815 26.1195896922692 9 22.066549912434326 23.817863397548162 29.92244183137353 24.193144858643983 10-14 23.290138590083554 28.708660629409117 26.517236203532295 21.483964576975033 15-19 22.742056542406804 28.491368526394794 27.91593695271454 20.850637978483864 20-24 22.902176632474355 28.081060795596695 28.381285964473356 20.63547660745559 25-29 22.626970227670753 28.416312234175635 28.14110582937203 20.815611708781585 30-34 22.869865412518138 28.17831590533847 28.438485015259918 20.513333666883472 35-39 22.990418557740796 28.361069087241553 28.19969742813918 20.448814926878466 40-44 22.94409560461819 28.129430828438323 28.42819526027952 20.498278306663966 45-49 23.198919351610968 28.191915149089454 28.306984190514306 20.302181308785272 50-54 23.567675756817614 28.71653740305229 27.62071553665249 20.095071303477607 55-59 23.057292969727293 28.591443582687013 28.19614711033275 20.15511633725294 60-64 23.07730798098574 27.825869402051538 28.256192144108084 20.84063047285464 65-69 22.86715036277208 28.71153365023768 27.91593695271454 20.505379034275705 70-74 23.54265699274456 28.101075806855143 27.59069301976482 20.765574180635475 75-79 23.461673258899516 28.253141741350824 27.89766184348871 20.387523156260954 80-84 23.26634444161791 28.639023149325872 27.763927753752228 20.330704655303993 85-89 23.11938912392942 28.887627695800226 27.67516252192756 20.317820658342793 90-94 23.06261624302542 28.347799132052074 28.15664393469725 20.432940690225255 95-99 23.45972789819461 28.115462210956494 27.81542599968962 20.60938389115928 100-104 22.937484308310317 28.099422545819735 28.481044438865176 20.482048707004772 105-109 23.29246935201401 27.990993244933698 28.20115086314736 20.515386539904927 110-114 23.042281711283465 28.00100075056292 28.091068301225917 20.8656492369277 115-119 23.472604453340004 27.990993244933698 28.111083312484364 20.42531898924193 120-124 23.742807105328996 27.36052039029272 28.591443582687013 20.305228921691267 125-129 23.3559287737758 28.009915014164307 27.853095912585996 20.781060299473896 130-134 23.405365904582943 28.3223718550997 28.296273097400565 19.9759891429168 135-139 23.655913978494624 28.361545832002555 28.12732886191845 19.85521132758437 140-144 23.20675105485232 28.175105485232066 28.5337552742616 20.08438818565401 145-149 23.904483037156705 28.150242326332798 27.534329563812598 20.4109450726979 150 23.5985985985986 27.32732732732733 28.87887887887888 20.195195195195197 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 0.0 19 0.5 20 0.5 21 2.0 22 3.5 23 1.5 24 3.5 25 5.0 26 6.0 27 13.0 28 15.0 29 14.5 30 17.5 31 24.5 32 40.0 33 58.5 34 65.0 35 72.5 36 90.5 37 113.5 38 150.5 39 182.0 40 208.5 41 245.0 42 273.0 43 283.5 44 274.0 45 264.5 46 257.0 47 229.0 48 210.0 49 188.5 50 136.0 51 114.5 52 106.0 53 83.0 54 60.0 55 42.5 56 30.5 57 22.5 58 25.0 59 19.0 60 12.0 61 7.5 62 7.0 63 5.5 64 3.5 65 3.5 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 0.125 3 0.125 4 0.1 5 0.15 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.065 15-19 0.075 20-24 0.075 25-29 0.075 30-34 0.065 35-39 0.8500000000000001 40-44 1.26 45-49 0.06 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.075 75-79 0.135 80-84 1.725 85-89 3.09 90-94 3.2199999999999998 95-99 3.345 100-104 0.42500000000000004 105-109 0.075 110-114 0.075 115-119 0.075 120-124 0.075 125-129 1.16 130-134 4.21 135-139 6.069999999999999 140-144 5.2 145-149 0.96 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.75 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74937343358395 99.5 2 0.2506265664160401 0.5 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.07500000000000001 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.3 0.0 0.0 0.0 0.0 114-115 0.3125 0.0 0.0 0.0 0.0 116-117 0.35 0.0 0.0 0.0 0.0 118-119 0.4125 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.45 0.0 0.0 0.0 0.0 124-125 0.525 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.7625 0.0 0.0 0.0 0.0 132-133 0.7875000000000001 0.0 0.0 0.0 0.0 134-135 0.9 0.0 0.0 0.0 0.0 136-137 1.0 0.0 0.0 0.0 0.0 138 1.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCAGTTA 10 0.0069886516 143.87341 2 >>END_MODULE Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084613 spots for SRR6031366.sra Written 1084613 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra Read 1084610 spots for SRR6031366.sra Written 1084610 spots for SRR6031366.sra SRR ids: ['SRR6031366.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_316_mfnu SRR6031366.sra spots: 21692203 blocks: [[1, 1084610], [1084611, 2169220], [2169221, 3253830], [3253831, 4338440], [4338441, 5423050], [5423051, 6507660], [6507661, 7592270], [7592271, 8676880], [8676881, 9761490], [9761491, 10846100], [10846101, 11930710], [11930711, 13015320], [13015321, 14099930], [14099931, 15184540], [15184541, 16269150], [16269151, 17353760], [17353761, 18438370], [18438371, 19522980], [19522981, 20607590], [20607591, 21692203]] SRR6031366 file size 7286707 SRR6031366 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031366 SRR6031366_1.fastq SRR6031366_2.fastq Input file: SRR6031366_1.fastq Paired file: SRR6031366_2.fastq trimmed: SRR6031366-trimmed-pair1.fastq, SRR6031366-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:14:48 2025 >> started Fri Feb 14 05:15:10 2025 >> done (22.494s) 21692203 read pairs processed; of these: 26916 ( 0.12%) short read pairs filtered out after trimming by size control 34608 ( 0.16%) empty read pairs filtered out after trimming by size control 21630679 (99.72%) read pairs available; of these: 7732892 (35.75%) trimmed read pairs available after processing 13897787 (64.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 9 0.00% 21 7 0.00% 22 8 0.00% 23 12 0.00% 24 9 0.00% 25 7 0.00% 26 10 0.00% 27 10 0.00% 28 8 0.00% 29 8 0.00% 30 17 0.00% 31 13 0.00% 32 9 0.00% 33 10 0.00% 34 17 0.00% 35 14 0.00% 36 19 0.00% 37 20 0.00% 38 24 0.00% 39 25 0.00% 40 17 0.00% 41 27 0.00% 42 39 0.00% 43 35 0.00% 44 40 0.00% 45 41 0.00% 46 34 0.00% 47 40 0.00% 48 50 0.00% 49 64 0.00% 50 66 0.00% 51 68 0.00% 52 67 0.00% 53 65 0.00% 54 75 0.00% 55 83 0.00% 56 90 0.00% 57 80 0.00% 58 121 0.00% 59 116 0.00% 60 116 0.00% 61 146 0.00% 62 176 0.00% 63 164 0.00% 64 173 0.00% 65 179 0.00% 66 194 0.00% 67 237 0.00% 68 301 0.00% 69 556 0.00% 70 744 0.00% 71 506 0.00% 72 473 0.00% 73 451 0.00% 74 464 0.00% 75 490 0.00% 76 560 0.00% 77 576 0.00% 78 675 0.00% 79 730 0.00% 80 819 0.00% 81 929 0.00% 82 1060 0.00% 83 1308 0.01% 84 2758 0.01% 85 2866 0.01% 86 3099 0.01% 87 3193 0.01% 88 3379 0.02% 89 3483 0.02% 90 3633 0.02% 91 3879 0.02% 92 4126 0.02% 93 4335 0.02% 94 4526 0.02% 95 4917 0.02% 96 5405 0.02% 97 6769 0.03% 98 9082 0.04% 99 5807 0.03% 100 5941 0.03% 101 6256 0.03% 102 6738 0.03% 103 7066 0.03% 104 7514 0.03% 105 8127 0.04% 106 8434 0.04% 107 8971 0.04% 108 9419 0.04% 109 9869 0.05% 110 10336 0.05% 111 10710 0.05% 112 11326 0.05% 113 11778 0.05% 114 12577 0.06% 115 13079 0.06% 116 13551 0.06% 117 14041 0.06% 118 14463 0.07% 119 15320 0.07% 120 16211 0.07% 121 17078 0.08% 122 17401 0.08% 123 18837 0.09% 124 20205 0.09% 125 22236 0.10% 126 22702 0.10% 127 23071 0.11% 128 24299 0.11% 129 26037 0.12% 130 27189 0.13% 131 29047 0.13% 132 30810 0.14% 133 33497 0.15% 134 36372 0.17% 135 39577 0.18% 136 43786 0.20% 137 50047 0.23% 138 55691 0.26% 139 62371 0.29% 140 67018 0.31% 141 75090 0.35% 142 83927 0.39% 143 97493 0.45% 144 118393 0.55% 145 150626 0.70% 146 208248 0.96% 147 320843 1.48% 148 684933 3.17% 149 5019578 23.21% 150 13897787 64.25% 21630679 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=7.10 fanout-score-rank=22 prefix-density=0.17 prefix-fanout=3.9 sequence=TCCTTGTCCTGGATCTT criterion=fanout-score sequence-density=0.05 sequence-density-rank=15 fanout-score=613.21 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=38.4 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.08 sequence-density-rank=1 fanout-score=395.43 fanout-score-rank=4 prefix-density=0.94 prefix-fanout=34.5 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=17 fanout-score=558.61 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=34.5 sequence=AAGAAGAAGAAG SRR6031366 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:15:52 Started mapping on | Feb 14 05:15:52 Finished on | Feb 14 05:17:42 Mapping speed, Million of reads per hour | 707.91 Number of input reads | 21630679 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 20701722 Uniquely mapped reads % | 95.71% Average mapped length | 296.29 Number of splices: Total | 19668535 Number of splices: Annotated (sjdb) | 19235200 Number of splices: GT/AG | 19334475 Number of splices: GC/AG | 280035 Number of splices: AT/AC | 16661 Number of splices: Non-canonical | 37364 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 481201 % of reads mapped to multiple loci | 2.22% Number of reads mapped to too many loci | 32497 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 473549 473549 473549 N_multimapping 481201 481201 481201 N_noFeature 819569 20471356 942374 N_ambiguous 212921 1189 104640 UnstrandedReadsAssigned:19669232 PositiveStrandReadsAssigned:229177 NegativeStrandReadsAssigned:19654708 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR6031366 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031366-trimmed-pair1.fastq SRR6031366-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,630,679 reads, 19,767,123 reads pseudoaligned [quant] estimated average fragment length: 291.498 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,056 rounds 52401 SRR6031366.ke.tsv 34699 SRR6031366.se.tsv 87100 total ==> SRR6031366.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1727.5 1049 31.1614 Potri.005G024800.1.v4.1 1035 744.502 287 19.7822 Potri.004G059700.1.v4.1 961 670.662 157 12.0131 Potri.007G009000.2.v4.1 1416 1125.5 4 0.182378 Potri.003G141000.2.v4.1 2943 2652.5 999.376 19.3345 Potri.016G087400.1.v4.1 270 58.1038 1756 1550.89 Potri.015G069301.1.v4.1 564 285.139 0 0 Potri.010G195200.1.v4.1 1773 1482.5 116 4.01534 Potri.012G127500.1.v4.1 977 686.561 1576 117.798 ==> SRR6031366.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 310 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 17 SRR6031366 completed mapping pipeline successfully