Starting /dee2/code/volunteer_pipeline.sh SRR6031367 current disk space = 3087644536832 free memory = 1412731752 SRR6031367 SRAfilesize d362006b8d2a8eebbd2baa47a7860d16 SRR6031367.sra SRR6031367.sra file validated SRR6031367 is paired end SRR6031367 is conventional basespace SRR6031367 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.41525 34.0 33.0 34.0 33.0 34.0 2 33.503 34.0 34.0 34.0 33.0 34.0 3 33.53275 34.0 34.0 34.0 33.0 34.0 4 33.53525 34.0 34.0 34.0 33.0 34.0 5 33.56375 34.0 34.0 34.0 33.0 34.0 6 37.32725 38.0 38.0 38.0 37.0 38.0 7 37.53675 38.0 38.0 38.0 37.0 38.0 8 37.5535 38.0 38.0 38.0 38.0 38.0 9 37.5805 38.0 38.0 38.0 38.0 38.0 10-14 37.5857 38.0 38.0 38.0 37.8 38.0 15-19 37.6048 38.0 38.0 38.0 38.0 38.0 20-24 37.59824999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.611000000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.5952 38.0 38.0 38.0 38.0 38.0 35-39 37.53965 38.0 38.0 38.0 37.8 38.0 40-44 37.42765000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.3811 38.0 38.0 38.0 37.0 38.0 50-54 37.37155 38.0 38.0 38.0 37.0 38.0 55-59 37.344950000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.35235 38.0 38.0 38.0 37.0 38.0 65-69 37.33645 38.0 38.0 38.0 37.0 38.0 70-74 37.3276 38.0 38.0 38.0 37.0 38.0 75-79 37.24275 38.0 38.0 38.0 37.0 38.0 80-84 37.20885 38.0 38.0 38.0 37.0 38.0 85-89 37.17305 38.0 38.0 38.0 36.6 38.0 90-94 37.11775 38.0 38.0 38.0 36.2 38.0 95-99 37.0318 38.0 38.0 38.0 36.0 38.0 100-104 36.94295 38.0 38.0 38.0 35.8 38.0 105-109 36.89685000000001 38.0 38.0 38.0 35.6 38.0 110-114 36.738200000000006 38.0 38.0 38.0 35.0 38.0 115-119 36.7094 38.0 38.0 38.0 35.0 38.0 120-124 36.609500000000004 38.0 38.0 38.0 34.6 38.0 125-129 36.47580000000001 38.0 38.0 38.0 34.0 38.0 130-134 36.22775 38.0 38.0 38.0 33.6 38.0 135-139 36.2431 38.0 38.0 38.0 33.8 38.0 140-144 35.9047 38.0 38.0 38.0 32.8 38.0 145-149 35.29809999999999 38.0 36.8 38.0 31.0 38.0 150 29.2555 34.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 1.0 18 1.0 19 4.0 20 4.0 21 4.0 22 2.0 23 0.0 24 6.0 25 6.0 26 8.0 27 14.0 28 17.0 29 22.0 30 27.0 31 32.0 32 41.0 33 67.0 34 80.0 35 163.0 36 404.0 37 3092.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.67418546365914 11.854636591478696 10.075187969924812 38.39598997493734 2 21.8 15.925 35.199999999999996 27.075 3 19.925 21.825 27.025 31.225 4 21.95 29.45 23.549999999999997 25.05 5 23.45 33.7 23.25 19.6 6 18.875 34.8 25.85 20.474999999999998 7 13.900000000000002 23.65 44.525 17.925 8 17.65 23.875 32.7 25.775 9 17.0 24.525 33.4 25.074999999999996 10-14 20.105 30.085 26.834999999999997 22.975 15-19 19.965 28.365000000000002 27.884999999999998 23.785 20-24 19.1 28.99 27.865000000000002 24.044999999999998 25-29 19.305 29.544999999999998 27.834999999999997 23.315 30-34 19.74 29.659999999999997 27.229999999999997 23.369999999999997 35-39 19.785 28.660000000000004 27.944999999999997 23.61 40-44 19.695 28.96 27.685 23.66 45-49 19.24 28.79 28.17 23.799999999999997 50-54 19.79 28.49 28.37 23.35 55-59 19.945 28.685 28.28 23.09 60-64 20.055 28.715000000000003 27.435 23.794999999999998 65-69 19.695 28.810000000000002 27.700000000000003 23.794999999999998 70-74 20.335 28.925 27.694999999999997 23.044999999999998 75-79 20.200000000000003 28.904999999999998 27.08 23.815 80-84 20.169999999999998 27.99 28.050000000000004 23.79 85-89 20.035 28.655 27.925 23.385 90-94 20.735 28.505000000000003 27.169999999999998 23.59 95-99 20.119999999999997 28.43 27.700000000000003 23.75 100-104 20.244999999999997 28.925 27.805000000000003 23.025000000000002 105-109 20.125 28.93 27.41 23.535 110-114 20.5 28.87 27.595 23.035 115-119 20.815 28.08 27.450000000000003 23.655 120-124 20.02 28.435 27.41 24.135 125-129 20.41 28.17 28.03 23.39 130-134 20.14 28.405 27.625 23.830000000000002 135-139 20.24 28.425 27.595 23.74 140-144 20.935000000000002 27.665 27.855 23.544999999999998 145-149 20.555 29.235 26.919999999999998 23.29 150 21.275 27.500000000000004 28.375 22.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.5 25 3.5 26 7.5 27 9.0 28 10.0 29 14.0 30 25.5 31 37.5 32 40.0 33 47.0 34 53.5 35 70.0 36 97.5 37 114.5 38 125.5 39 153.0 40 198.0 41 222.0 42 228.5 43 251.5 44 271.5 45 270.5 46 280.0 47 258.5 48 222.5 49 199.5 50 170.0 51 150.0 52 123.5 53 95.5 54 70.5 55 46.0 56 31.0 57 23.5 58 19.5 59 15.0 60 11.0 61 9.0 62 4.5 63 3.5 64 2.5 65 0.0 66 0.0 67 0.5 68 2.0 69 2.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.025 0.0 0.0 0.0 0.0 96-97 0.037500000000000006 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.5 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.825 0.0 0.0 0.0 0.0 118-119 1.0375 0.0 0.0 0.0 0.0 120-121 1.0750000000000002 0.0 0.0 0.0 0.0 122-123 1.175 0.0 0.0 0.0 0.0 124-125 1.3375 0.0 0.0 0.0 0.0 126-127 1.4125 0.0 0.0 0.0 0.0 128-129 1.6125 0.0 0.0 0.0 0.0 130-131 1.7374999999999998 0.0 0.0 0.0 0.0 132-133 1.9 0.0 0.0 0.0 0.0 134-135 2.1375 0.0 0.0 0.0 0.0 136-137 2.325 0.0 0.0 0.0 0.0 138 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031367 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031367_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84875 33.0 33.0 34.0 32.0 34.0 2 33.0195 34.0 33.0 34.0 32.0 34.0 3 32.986 34.0 33.0 34.0 32.0 34.0 4 32.94875 34.0 33.0 34.0 32.0 34.0 5 32.95125 34.0 33.0 34.0 32.0 34.0 6 37.19825 38.0 38.0 38.0 37.0 38.0 7 37.17475 38.0 38.0 38.0 37.0 38.0 8 37.193 38.0 38.0 38.0 37.0 38.0 9 37.2125 38.0 38.0 38.0 37.0 38.0 10-14 37.1545 38.0 38.0 38.0 37.0 38.0 15-19 37.17915000000001 38.0 38.0 38.0 37.0 38.0 20-24 37.19815 38.0 38.0 38.0 37.0 38.0 25-29 37.1767 38.0 38.0 38.0 37.0 38.0 30-34 37.143350000000005 38.0 38.0 38.0 37.0 38.0 35-39 36.951100000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.74315 38.0 38.0 38.0 36.8 38.0 45-49 37.08945 38.0 38.0 38.0 36.8 38.0 50-54 37.068799999999996 38.0 38.0 38.0 36.8 38.0 55-59 37.05835 38.0 38.0 38.0 37.0 38.0 60-64 37.100049999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.0567 38.0 38.0 38.0 36.6 38.0 70-74 37.0406 38.0 38.0 38.0 36.8 38.0 75-79 37.0115 38.0 38.0 38.0 36.4 38.0 80-84 36.4695 38.0 38.0 38.0 36.0 38.0 85-89 35.974599999999995 38.0 38.0 38.0 34.8 38.0 90-94 35.8447 38.0 38.0 38.0 34.0 38.0 95-99 35.763600000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.295950000000005 38.0 38.0 38.0 34.2 38.0 105-109 36.59115 38.0 38.0 38.0 35.2 38.0 110-114 36.527 38.0 38.0 38.0 35.0 38.0 115-119 36.3679 38.0 38.0 38.0 34.6 38.0 120-124 36.2548 38.0 38.0 38.0 34.0 38.0 125-129 35.79645000000001 38.0 38.0 38.0 33.0 38.0 130-134 34.60295 38.0 37.6 38.0 28.0 38.0 135-139 33.7319 38.0 36.2 38.0 19.0 38.0 140-144 33.43865 38.0 35.8 38.0 15.4 38.0 145-149 32.916000000000004 38.0 35.8 38.0 8.2 38.0 150 25.63625 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 1.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 2.0 12 4.0 13 3.0 14 5.0 15 2.0 16 6.0 17 4.0 18 2.0 19 6.0 20 6.0 21 8.0 22 9.0 23 21.0 24 27.0 25 26.0 26 22.0 27 32.0 28 39.0 29 42.0 30 41.0 31 49.0 32 54.0 33 96.0 34 100.0 35 171.0 36 386.0 37 2826.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.585585585585584 21.396396396396398 14.23923923923924 28.77877877877878 2 24.76214321482223 24.787180771156734 34.12618928392589 16.324486730095142 3 20.681021532298445 28.04206309464196 32.22333500250375 19.053580370555835 4 22.684026039058587 34.97746619929895 23.034551827741613 19.303955933900852 5 23.22144288577154 37.399799599198396 22.945891783567134 16.432865731462925 6 18.884442221110557 40.09504752376188 24.412206103051524 16.60830415207604 7 20.210105052526263 18.48424212106053 41.97098549274637 19.334667333666832 8 20.485242621310658 23.861930965482742 28.76438219109555 26.88844422211106 9 22.611305652826413 25.287643821910955 29.239619809904955 22.861430715357677 10-14 23.103862317390433 29.207524514708826 26.550930558335 21.13768260956574 15-19 23.288973384030417 28.85731438863318 27.68160896537923 20.172103261957176 20-24 22.84985240406264 28.54855656176515 27.793065492570168 20.80852554160204 25-29 22.730911638146704 28.294806364455116 27.969578705093568 21.00470329230461 30-34 22.244458898283884 28.523540301195776 28.668634612498124 20.563366188022215 35-39 22.888351958119397 28.561361119500656 27.92207792207792 20.62820900030202 40-44 23.231251263391954 27.941176470588236 28.390944006468565 20.43662825955124 45-49 23.349009405643386 27.601560936561935 28.592155293175907 20.457274364618772 50-54 22.737052789592195 27.52564423317488 28.801601200900674 20.935701776332248 55-59 22.972229171878908 27.62071553665249 28.62646985238929 20.78058543907931 60-64 23.46760070052539 27.910933199899922 28.371278458844134 20.250187640730548 65-69 22.907180385288967 28.276207155366524 28.326244683512634 20.490367775831874 70-74 23.39754816112084 27.640730547910934 28.3112334250688 20.650487865899425 75-79 22.960664598138326 27.3946551896707 28.901010909818837 20.743669302372133 80-84 23.36225706601715 28.30973765667022 28.477190845892324 19.850814431420307 85-89 23.210891343436938 28.183919856152066 28.12740816850758 20.477780631903418 90-94 23.953727506426738 27.676092544987146 28.14910025706941 20.22107969151671 95-99 22.486213472143483 28.3667474101943 28.464670411791992 20.68236870587023 100-104 22.96578709742149 28.19805357680345 28.14788803050065 20.688271295274404 105-109 23.417563172379285 28.29121841381036 28.19114335751814 20.10007505629222 110-114 23.55266449837378 27.9459594696022 27.730798098573928 20.770577933450088 115-119 24.19435548438751 28.102481985588472 27.737189751801438 19.96597277822258 120-124 23.723979183346678 28.23258606885509 27.872297838270615 20.171136909527622 125-129 23.47330170586454 28.03068537397799 28.288079135964473 20.207933784192996 130-134 24.079275905118603 27.50208073241781 28.162713275072825 20.255930087390762 135-139 23.961914837344615 27.971436128008463 28.198889182755888 19.867759851891034 140-144 24.21279503758608 28.68107028334122 27.577143457919362 19.52899122115334 145-149 24.41297994558097 27.562229164567164 27.919983875844 20.10480701400786 150 23.38507761642464 27.591387080620933 28.668002003004506 20.355533299949926 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 1.5 19 1.0 20 0.0 21 0.0 22 3.0 23 5.5 24 5.0 25 5.5 26 7.0 27 8.0 28 12.0 29 17.5 30 21.0 31 27.5 32 37.0 33 45.0 34 56.5 35 76.5 36 86.5 37 113.0 38 156.5 39 189.0 40 213.0 41 235.5 42 261.5 43 262.5 44 270.0 45 289.5 46 267.5 47 236.5 48 212.0 49 191.5 50 164.5 51 123.0 52 94.5 53 78.0 54 59.5 55 42.0 56 34.0 57 25.5 58 17.0 59 13.5 60 10.0 61 4.5 62 3.5 63 4.0 64 3.0 65 2.0 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.15 3 0.15 4 0.15 5 0.2 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.06 15-19 0.06 20-24 0.065 25-29 0.06999999999999999 30-34 0.065 35-39 0.67 40-44 1.06 45-49 0.06 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.075 75-79 0.09 80-84 1.465 85-89 2.675 90-94 2.75 95-99 2.9850000000000003 100-104 0.33 105-109 0.075 110-114 0.075 115-119 0.08 120-124 0.08 125-129 0.9299999999999999 130-134 3.88 135-139 5.475 140-144 4.885 145-149 0.77 150 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7743795437453 99.5 2 0.17548257708698922 0.35000000000000003 3 0.0501378791677112 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.44999999999999996 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.7375 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.875 0.0 0.0 0.0 0.0 118-119 1.0875 0.0 0.0 0.0 0.0 120-121 1.125 0.0 0.0 0.0 0.0 122-123 1.2125 0.0 0.0 0.0 0.0 124-125 1.3625 0.0 0.0 0.0 0.0 126-127 1.4375 0.0 0.0 0.0 0.0 128-129 1.6375 0.0 0.0 0.0 0.0 130-131 1.7625000000000002 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.1125 0.0 0.0 0.0 0.0 136-137 2.3 0.0 0.0 0.0 0.0 138 2.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGCTA 10 0.007438549 140.925 7 >>END_MODULE Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra Read 973045 spots for SRR6031367.sra Written 973045 spots for SRR6031367.sra SRR ids: ['SRR6031367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_azv1g9hh SRR6031367.sra spots: 19460900 blocks: [[1, 973045], [973046, 1946090], [1946091, 2919135], [2919136, 3892180], [3892181, 4865225], [4865226, 5838270], [5838271, 6811315], [6811316, 7784360], [7784361, 8757405], [8757406, 9730450], [9730451, 10703495], [10703496, 11676540], [11676541, 12649585], [12649586, 13622630], [13622631, 14595675], [14595676, 15568720], [15568721, 16541765], [16541766, 17514810], [17514811, 18487855], [18487856, 19460900]] SRR6031367 file size 6534950 SRR6031367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031367 SRR6031367_1.fastq SRR6031367_2.fastq Input file: SRR6031367_1.fastq Paired file: SRR6031367_2.fastq trimmed: SRR6031367-trimmed-pair1.fastq, SRR6031367-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:10:32 2025 >> started Fri Feb 14 04:11:06 2025 >> done (34.186s) 19460900 read pairs processed; of these: 19152 ( 0.10%) short read pairs filtered out after trimming by size control 35114 ( 0.18%) empty read pairs filtered out after trimming by size control 19406634 (99.72%) read pairs available; of these: 6912496 (35.62%) trimmed read pairs available after processing 12494138 (64.38%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 6 0.00% 21 4 0.00% 22 2 0.00% 23 8 0.00% 24 6 0.00% 25 8 0.00% 26 6 0.00% 27 6 0.00% 28 10 0.00% 29 5 0.00% 30 11 0.00% 31 10 0.00% 32 7 0.00% 33 11 0.00% 34 10 0.00% 35 13 0.00% 36 12 0.00% 37 16 0.00% 38 17 0.00% 39 17 0.00% 40 23 0.00% 41 16 0.00% 42 17 0.00% 43 18 0.00% 44 36 0.00% 45 25 0.00% 46 39 0.00% 47 30 0.00% 48 31 0.00% 49 39 0.00% 50 47 0.00% 51 59 0.00% 52 68 0.00% 53 45 0.00% 54 59 0.00% 55 61 0.00% 56 82 0.00% 57 81 0.00% 58 81 0.00% 59 97 0.00% 60 113 0.00% 61 108 0.00% 62 148 0.00% 63 146 0.00% 64 148 0.00% 65 187 0.00% 66 234 0.00% 67 241 0.00% 68 334 0.00% 69 598 0.00% 70 852 0.00% 71 475 0.00% 72 447 0.00% 73 447 0.00% 74 512 0.00% 75 490 0.00% 76 584 0.00% 77 679 0.00% 78 696 0.00% 79 756 0.00% 80 862 0.00% 81 984 0.01% 82 1118 0.01% 83 1410 0.01% 84 2113 0.01% 85 2491 0.01% 86 2676 0.01% 87 2952 0.02% 88 3128 0.02% 89 3221 0.02% 90 3452 0.02% 91 3665 0.02% 92 3949 0.02% 93 4389 0.02% 94 4687 0.02% 95 5012 0.03% 96 5532 0.03% 97 6912 0.04% 98 9259 0.05% 99 6279 0.03% 100 6467 0.03% 101 6863 0.04% 102 7511 0.04% 103 7918 0.04% 104 8473 0.04% 105 9172 0.05% 106 9795 0.05% 107 10230 0.05% 108 10771 0.06% 109 11334 0.06% 110 11700 0.06% 111 12427 0.06% 112 13069 0.07% 113 13779 0.07% 114 14639 0.08% 115 15450 0.08% 116 16235 0.08% 117 16883 0.09% 118 17557 0.09% 119 18468 0.10% 120 18800 0.10% 121 20101 0.10% 122 20874 0.11% 123 22467 0.12% 124 23613 0.12% 125 25988 0.13% 126 26405 0.14% 127 27641 0.14% 128 28432 0.15% 129 30046 0.15% 130 31371 0.16% 131 33217 0.17% 132 35022 0.18% 133 37436 0.19% 134 39922 0.21% 135 43049 0.22% 136 46782 0.24% 137 52657 0.27% 138 57157 0.29% 139 63802 0.33% 140 67489 0.35% 141 74535 0.38% 142 81672 0.42% 143 91799 0.47% 144 108642 0.56% 145 135431 0.70% 146 181474 0.94% 147 273557 1.41% 148 571983 2.95% 149 4318960 22.26% 150 12494138 64.38% 19406634 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=37 prefix-density=0.18 prefix-fanout=2.0 sequence=TATGCTACCCCCAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=403.25 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=37.6 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.42 fanout-score-rank=35 prefix-density=0.15 prefix-fanout=2.8 sequence=TTTAGCCAGTACGGTGAAATCATCGATTCGAAGATTATAAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=43 fanout-score=458.23 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=12.5 sequence=CAAGCTCAAATGCCCAAGATGGAAAGATTAATCAAGACAACGACACTAAC SRR6031367 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:12:35 Started mapping on | Feb 14 04:12:36 Finished on | Feb 14 04:15:06 Mapping speed, Million of reads per hour | 465.76 Number of input reads | 19406634 Average input read length | 288 UNIQUE READS: Uniquely mapped reads number | 17899172 Uniquely mapped reads % | 92.23% Average mapped length | 287.70 Number of splices: Total | 17575346 Number of splices: Annotated (sjdb) | 17219174 Number of splices: GT/AG | 17272685 Number of splices: GC/AG | 237425 Number of splices: AT/AC | 11515 Number of splices: Non-canonical | 53721 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 3.06 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 456566 % of reads mapped to multiple loci | 2.35% Number of reads mapped to too many loci | 27295 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1069022 1069022 1069022 N_multimapping 456566 456566 456566 N_noFeature 494202 17688268 599366 N_ambiguous 257419 1747 150599 UnstrandedReadsAssigned:17147551 PositiveStrandReadsAssigned:209157 NegativeStrandReadsAssigned:17149207 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031367 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031367-trimmed-pair1.fastq SRR6031367-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,406,634 reads, 17,779,241 reads pseudoaligned [quant] estimated average fragment length: 263.266 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,075 rounds 52401 SRR6031367.ke.tsv 34699 SRR6031367.se.tsv 87100 total ==> SRR6031367.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.73 605 17.9186 Potri.005G024800.1.v4.1 1035 772.734 145 9.75763 Potri.004G059700.1.v4.1 961 698.805 8 0.595306 Potri.007G009000.2.v4.1 1416 1153.73 0 0 Potri.003G141000.2.v4.1 2943 2680.73 316 6.12971 Potri.016G087400.1.v4.1 270 72.2996 1779 1279.52 Potri.015G069301.1.v4.1 564 309.392 0 0 Potri.010G195200.1.v4.1 1773 1510.73 14 0.481888 Potri.012G127500.1.v4.1 977 714.773 3369 245.098 ==> SRR6031367.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1668 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 320 Potri.001G212900.v4.1 91 Potri.001G182400.v4.1 71 Potri.001G256600.v4.1 27 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR6031367 completed mapping pipeline successfully