Starting /dee2/code/volunteer_pipeline.sh SRR6031368 current disk space = 3087647674368 free memory = 1532569772 SRR6031368 SRAfilesize 6583d6b04a9d724b0990cccf555dd52f SRR6031368.sra SRR6031368.sra file validated SRR6031368 is paired end SRR6031368 is conventional basespace SRR6031368 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.39275 34.0 34.0 34.0 33.0 34.0 2 33.516 34.0 34.0 34.0 33.0 34.0 3 33.53575 34.0 34.0 34.0 33.0 34.0 4 33.5885 34.0 34.0 34.0 33.0 34.0 5 33.545 34.0 34.0 34.0 33.0 34.0 6 37.38175 38.0 38.0 38.0 37.0 38.0 7 37.58025 38.0 38.0 38.0 38.0 38.0 8 37.61825 38.0 38.0 38.0 38.0 38.0 9 37.631 38.0 38.0 38.0 38.0 38.0 10-14 37.58285 38.0 38.0 38.0 38.0 38.0 15-19 37.53900000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.589 38.0 38.0 38.0 38.0 38.0 25-29 37.53054999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.459649999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.423649999999995 38.0 38.0 38.0 37.8 38.0 40-44 37.1986 38.0 38.0 38.0 37.0 38.0 45-49 37.26645 38.0 38.0 38.0 37.0 38.0 50-54 37.240899999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.2312 38.0 38.0 38.0 37.0 38.0 60-64 37.17975 38.0 38.0 38.0 36.8 38.0 65-69 37.13185000000001 38.0 38.0 38.0 37.0 38.0 70-74 36.9764 38.0 38.0 38.0 36.4 38.0 75-79 36.599900000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.50305 38.0 38.0 38.0 36.0 38.0 85-89 36.45975 38.0 38.0 38.0 35.8 38.0 90-94 36.418549999999996 38.0 38.0 38.0 35.4 38.0 95-99 36.332800000000006 38.0 38.0 38.0 35.0 38.0 100-104 36.21965 38.0 38.0 38.0 34.8 38.0 105-109 36.11535 38.0 38.0 38.0 34.4 38.0 110-114 35.99 38.0 38.0 38.0 34.2 38.0 115-119 35.8911 38.0 38.0 38.0 34.0 38.0 120-124 35.7781 38.0 38.0 38.0 33.6 38.0 125-129 35.566050000000004 38.0 38.0 38.0 33.0 38.0 130-134 35.405100000000004 38.0 37.8 38.0 32.2 38.0 135-139 35.376000000000005 38.0 37.8 38.0 32.8 38.0 140-144 35.016 38.0 36.8 38.0 31.0 38.0 145-149 34.528650000000006 38.0 36.0 38.0 29.2 38.0 150 28.80475 33.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 1.0 8 2.0 9 1.0 10 1.0 11 0.0 12 4.0 13 2.0 14 3.0 15 2.0 16 5.0 17 9.0 18 20.0 19 33.0 20 6.0 21 4.0 22 10.0 23 7.0 24 6.0 25 4.0 26 10.0 27 23.0 28 19.0 29 15.0 30 28.0 31 37.0 32 48.0 33 62.0 34 98.0 35 136.0 36 373.0 37 3029.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.743911624403715 11.82525734371077 11.975897564649761 36.45493346723575 2 23.9 15.2 34.050000000000004 26.85 3 18.95 21.175 28.4 31.474999999999998 4 21.575 27.750000000000004 24.099999999999998 26.575 5 23.305826456614152 32.883220805201304 23.905976494123532 19.904976244061015 6 20.825 34.300000000000004 25.724999999999998 19.15 7 13.025 27.325 42.3 17.349999999999998 8 16.975 27.1 30.325000000000003 25.6 9 17.299999999999997 24.625 33.625 24.45 10-14 19.765 31.075000000000003 26.245 22.915 15-19 19.564999999999998 29.565 27.6 23.27 20-24 19.625 29.470000000000002 27.474999999999998 23.43 25-29 18.935 29.29 27.939999999999998 23.835 30-34 19.25 29.32 27.68 23.75 35-39 19.715 29.945 26.465 23.875 40-44 19.5 29.375 27.91 23.215 45-49 20.395 29.294999999999998 28.000000000000004 22.31 50-54 20.14 28.610000000000003 27.36 23.89 55-59 19.78 28.53 28.64 23.05 60-64 20.225 28.555000000000003 27.595 23.625 65-69 19.355 29.975 26.995 23.674999999999997 70-74 19.7 29.64 27.800000000000004 22.86 75-79 19.61 29.965000000000003 26.945000000000004 23.48 80-84 20.05 29.265 27.555000000000003 23.13 85-89 20.305 28.615000000000002 27.725 23.355 90-94 20.34 28.544999999999998 27.71 23.405 95-99 20.349999999999998 28.360000000000003 27.439999999999998 23.849999999999998 100-104 19.42 30.375000000000004 27.345000000000002 22.86 105-109 20.565 29.735 27.245 22.455 110-114 20.445 29.04 26.97 23.544999999999998 115-119 20.72 28.625 27.450000000000003 23.205000000000002 120-124 20.580000000000002 28.634999999999998 27.034999999999997 23.75 125-129 20.84 28.884999999999998 26.955000000000002 23.32 130-134 20.57 29.020000000000003 27.255000000000003 23.155 135-139 20.885 29.115000000000002 26.765 23.235 140-144 20.95 28.9 26.665 23.485 145-149 21.365000000000002 29.020000000000003 26.19 23.425 150 20.560280140070038 28.76438219109555 26.76338169084542 23.911955977988995 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 6.0 1 5.0 2 3.5 3 3.0 4 1.5 5 1.0 6 1.5 7 1.0 8 0.5 9 0.0 10 0.5 11 1.5 12 1.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 1.5 19 2.0 20 2.0 21 1.5 22 1.0 23 3.5 24 5.5 25 5.0 26 5.5 27 9.5 28 14.5 29 21.0 30 26.5 31 33.0 32 39.5 33 51.5 34 66.0 35 92.0 36 112.5 37 118.0 38 136.5 39 155.5 40 174.5 41 206.5 42 238.0 43 255.5 44 238.5 45 231.0 46 245.0 47 232.5 48 219.0 49 192.0 50 156.0 51 140.0 52 127.0 53 102.5 54 79.5 55 64.0 56 45.0 57 29.0 58 21.0 59 21.5 60 15.5 61 9.0 62 9.0 63 7.0 64 6.0 65 2.5 66 0.5 67 0.5 68 1.5 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.42500000000000004 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.12820512820512 96.65 2 0.717948717948718 1.4000000000000001 3 0.07692307692307693 0.22499999999999998 4 0.05128205128205128 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.02564102564102564 1.525 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACAACAAAATCTCGTATGC 61 1.525 TruSeq Adapter, Index 1 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.44999999999999996 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.6 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.4874999999999998 0.0 0.0 0.0 0.0 124-125 1.775 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.2625 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.9375 0.0 0.0 0.0 0.0 134-135 3.175 0.0 0.0 0.0 0.0 136-137 3.4749999999999996 0.0 0.0 0.0 0.0 138 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATCCA 10 0.006973645 144.0 4 CTCAACA 10 0.006973645 144.0 3 CTCTTTC 30 0.0018473949 72.0 1 >>END_MODULE SRR6031368 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7765 33.0 33.0 34.0 32.0 34.0 2 32.87325 34.0 33.0 34.0 32.0 34.0 3 32.90475 34.0 33.0 34.0 32.0 34.0 4 32.83925 34.0 33.0 34.0 32.0 34.0 5 32.85375 34.0 33.0 34.0 32.0 34.0 6 37.00975 38.0 38.0 38.0 37.0 38.0 7 37.03075 38.0 38.0 38.0 37.0 38.0 8 37.02925 38.0 38.0 38.0 37.0 38.0 9 36.983 38.0 38.0 38.0 37.0 38.0 10-14 37.03125 38.0 38.0 38.0 37.0 38.0 15-19 36.99895 38.0 38.0 38.0 37.0 38.0 20-24 37.0519 38.0 38.0 38.0 37.0 38.0 25-29 37.043850000000006 38.0 38.0 38.0 37.0 38.0 30-34 36.94085 38.0 38.0 38.0 37.0 38.0 35-39 36.662549999999996 38.0 38.0 38.0 36.6 38.0 40-44 36.5031 38.0 38.0 38.0 36.2 38.0 45-49 36.81015 38.0 38.0 38.0 36.2 38.0 50-54 36.81565 38.0 38.0 38.0 36.8 38.0 55-59 36.82105 38.0 38.0 38.0 36.8 38.0 60-64 36.8754 38.0 38.0 38.0 37.0 38.0 65-69 36.66515 38.0 38.0 38.0 36.4 38.0 70-74 36.39115 38.0 38.0 38.0 36.0 38.0 75-79 36.3009 38.0 38.0 38.0 36.0 38.0 80-84 35.855850000000004 38.0 38.0 38.0 35.0 38.0 85-89 35.5029 38.0 38.0 38.0 34.2 38.0 90-94 35.43635 38.0 38.0 38.0 33.8 38.0 95-99 35.371300000000005 38.0 38.0 38.0 34.0 38.0 100-104 35.812749999999994 38.0 38.0 38.0 34.0 38.0 105-109 35.986050000000006 38.0 38.0 38.0 34.6 38.0 110-114 35.869899999999994 38.0 38.0 38.0 34.2 38.0 115-119 35.758300000000006 38.0 38.0 38.0 34.0 38.0 120-124 35.69595 38.0 38.0 38.0 34.0 38.0 125-129 35.24125 38.0 38.0 38.0 32.0 38.0 130-134 34.4868 38.0 38.0 38.0 27.8 38.0 135-139 33.7097 38.0 36.6 38.0 15.8 38.0 140-144 33.4655 38.0 36.0 38.0 13.4 38.0 145-149 33.135549999999995 38.0 36.0 38.0 8.2 38.0 150 26.3635 33.0 20.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 17.0 3 4.0 4 4.0 5 0.0 6 2.0 7 2.0 8 1.0 9 3.0 10 3.0 11 3.0 12 5.0 13 10.0 14 5.0 15 14.0 16 24.0 17 25.0 18 3.0 19 5.0 20 9.0 21 4.0 22 11.0 23 20.0 24 21.0 25 21.0 26 22.0 27 23.0 28 33.0 29 37.0 30 31.0 31 28.0 32 47.0 33 91.0 34 74.0 35 137.0 36 338.0 37 2923.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.764337590783875 21.462559479088405 14.350112697220135 27.42299023290759 2 27.75827482447342 25.325977933801404 31.444332998996995 15.471414242728185 3 19.633901705115345 27.35707121364092 33.92678034102307 19.08224674022066 4 23.464527450488845 32.66482827776385 24.79318124843319 19.077463023314113 5 26.60481444332999 34.2778335005015 22.04112337011033 17.076228686058176 6 21.357035553329993 36.73009514271407 22.934401602403607 18.97846770155233 7 19.32899349023535 22.8843264897346 39.20881321982975 18.5778668002003 8 20.711244678186826 27.247683446030553 26.34610568494866 25.694966190833963 9 21.96343601302279 24.843476083145504 30.503380916604055 22.68970698722765 10-14 22.94055786469027 29.19024487956332 25.885121939005458 21.98407531674095 15-19 24.065912050485828 27.576880697185214 27.65200841430432 20.705198838024643 20-24 24.382669671925868 28.254445279238666 27.21262208865515 20.150262960180314 25-29 23.711495116453793 29.10092662158778 27.27272727272727 19.91485098923115 30-34 24.168669871794872 27.529046474358974 28.155048076923077 20.147235576923077 35-39 23.46089850249584 27.807190036807338 27.57525336560278 21.156658095094034 40-44 24.009100101112235 27.62891809908999 27.548028311425682 20.813953488372093 45-49 23.109664496745115 27.481221832749124 27.76164246369554 21.647471206810216 50-54 23.481091910843976 27.2526922113699 28.454795892812424 20.811419984973703 55-59 23.31580265464563 28.244427748559982 28.03906836964688 20.400701227147508 60-64 22.774855997996493 29.135987978963186 27.08740295517155 21.00175306786877 65-69 22.699724517906336 27.95391935887804 28.079138492361633 21.26721763085399 70-74 22.49436513899324 28.419734535437012 27.738542449286253 21.347357876283496 75-79 23.339848644314138 28.050919661203828 28.086002104946623 20.523229589535408 80-84 23.257583443238307 28.675053261641477 26.884447600689864 21.182915694430353 85-89 23.44612553670006 28.51155182989164 27.519934573706806 20.522388059701495 90-94 24.015546691214073 27.580034775493505 27.631175207118748 20.773243326173674 95-99 23.533026113671273 28.054275473630312 27.798259088581666 20.61443932411674 100-104 22.99075748442837 27.918424753867793 28.114325899136027 20.976491862567812 105-109 23.410969196093163 28.49486601552717 27.548209366391184 20.54595542198848 110-114 23.020285499624343 28.68519909842224 27.227648384673174 21.06686701728024 115-119 23.215627347858753 28.580015026296017 27.688454795892813 20.515902829952417 120-124 23.220636113198097 28.114199849737037 28.329576759328823 20.33558727773604 125-129 23.313627406396847 28.553382850790765 27.744934566216966 20.388055176595422 130-134 23.895582329317268 28.354443414684376 27.623313767892082 20.12666048810627 135-139 23.06449932270501 28.654787954569137 27.847243930394917 20.433468792330935 140-144 23.97657788371852 27.831899678723182 27.577987356202716 20.61353508135558 145-149 24.385938366873454 27.689514298683616 27.432289302466334 20.492258031976597 150 23.865630483830532 29.305590373527203 27.400350965154175 19.42842817748809 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 5.0 1 2.5 2 0.5 3 1.5 4 1.5 5 0.5 6 1.5 7 2.0 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 2.5 21 2.0 22 0.5 23 1.0 24 3.0 25 5.5 26 9.0 27 9.5 28 8.5 29 12.0 30 15.0 31 18.0 32 28.5 33 45.0 34 59.5 35 78.5 36 92.5 37 109.0 38 137.5 39 153.0 40 189.5 41 225.0 42 226.0 43 236.5 44 241.5 45 261.5 46 271.0 47 244.5 48 228.0 49 199.0 50 177.0 51 148.0 52 124.0 53 107.0 54 81.5 55 68.5 56 45.5 57 31.0 58 19.5 59 15.0 60 15.0 61 12.5 62 10.5 63 4.5 64 3.0 65 3.0 66 2.5 67 1.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.3 3 0.3 4 0.27499999999999997 5 0.3 6 0.15 7 0.15 8 0.17500000000000002 9 0.17500000000000002 10-14 0.155 15-19 0.16999999999999998 20-24 0.17500000000000002 25-29 0.17500000000000002 30-34 0.16 35-39 0.835 40-44 1.0999999999999999 45-49 0.15 50-54 0.17500000000000002 55-59 0.17500000000000002 60-64 0.17500000000000002 65-69 0.17500000000000002 70-74 0.17500000000000002 75-79 0.23500000000000001 80-84 1.43 85-89 2.18 90-94 2.23 95-99 2.35 100-104 0.45999999999999996 105-109 0.17500000000000002 110-114 0.17500000000000002 115-119 0.17500000000000002 120-124 0.17500000000000002 125-129 1.045 130-134 2.8899999999999997 135-139 4.03 140-144 3.51 145-149 0.865 150 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.5 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8974358974359 96.42500000000001 2 0.8717948717948718 1.7000000000000002 3 0.1794871794871795 0.525 4 0.02564102564102564 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02564102564102564 1.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 50 1.25 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.42500000000000004 0.0 0.0 0.0 0.0 102-103 0.475 0.0 0.0 0.0 0.0 104-105 0.5874999999999999 0.0 0.0 0.0 0.0 106-107 0.625 0.0 0.0 0.0 0.0 108-109 0.675 0.0 0.0 0.0 0.0 110-111 0.825 0.0 0.0 0.0 0.0 112-113 0.9375 0.0 0.0 0.0 0.0 114-115 0.975 0.0 0.0 0.0 0.0 116-117 1.125 0.0 0.0 0.0 0.0 118-119 1.25 0.0 0.0 0.0 0.0 120-121 1.35 0.0 0.0 0.0 0.0 122-123 1.475 0.0 0.0 0.0 0.0 124-125 1.75 0.0 0.0 0.0 0.0 126-127 1.9 0.0 0.0 0.0 0.0 128-129 2.2 0.0 0.0 0.0 0.0 130-131 2.4000000000000004 0.0 0.0 0.0 0.0 132-133 2.7875 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.3 0.0 0.0 0.0 0.0 138 3.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706470 spots for SRR6031368.sra Written 706470 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra Read 706458 spots for SRR6031368.sra Written 706458 spots for SRR6031368.sra SRR ids: ['SRR6031368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l7vxq9bg SRR6031368.sra spots: 14129172 blocks: [[1, 706458], [706459, 1412916], [1412917, 2119374], [2119375, 2825832], [2825833, 3532290], [3532291, 4238748], [4238749, 4945206], [4945207, 5651664], [5651665, 6358122], [6358123, 7064580], [7064581, 7771038], [7771039, 8477496], [8477497, 9183954], [9183955, 9890412], [9890413, 10596870], [10596871, 11303328], [11303329, 12009786], [12009787, 12716244], [12716245, 13422702], [13422703, 14129172]] SRR6031368 file size 4738616 SRR6031368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031368 SRR6031368_1.fastq SRR6031368_2.fastq Input file: SRR6031368_1.fastq Paired file: SRR6031368_2.fastq trimmed: SRR6031368-trimmed-pair1.fastq, SRR6031368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:09:52 2025 >> started Fri Feb 14 04:10:07 2025 >> done (14.388s) 14129172 read pairs processed; of these: 21720 ( 0.15%) short read pairs filtered out after trimming by size control 246537 ( 1.74%) empty read pairs filtered out after trimming by size control 13860915 (98.10%) read pairs available; of these: 5190425 (37.45%) trimmed read pairs available after processing 8670490 (62.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 8 0.00% 20 14 0.00% 21 24 0.00% 22 28 0.00% 23 30 0.00% 24 34 0.00% 25 20 0.00% 26 45 0.00% 27 42 0.00% 28 129 0.00% 29 40 0.00% 30 51 0.00% 31 88 0.00% 32 49 0.00% 33 37 0.00% 34 54 0.00% 35 122 0.00% 36 77 0.00% 37 75 0.00% 38 66 0.00% 39 67 0.00% 40 96 0.00% 41 89 0.00% 42 106 0.00% 43 109 0.00% 44 152 0.00% 45 156 0.00% 46 193 0.00% 47 211 0.00% 48 234 0.00% 49 243 0.00% 50 235 0.00% 51 241 0.00% 52 295 0.00% 53 333 0.00% 54 315 0.00% 55 322 0.00% 56 282 0.00% 57 362 0.00% 58 369 0.00% 59 332 0.00% 60 426 0.00% 61 453 0.00% 62 521 0.00% 63 456 0.00% 64 538 0.00% 65 698 0.01% 66 1140 0.01% 67 1911 0.01% 68 3355 0.02% 69 10000 0.07% 70 20643 0.15% 71 21021 0.15% 72 13844 0.10% 73 5317 0.04% 74 2977 0.02% 75 2328 0.02% 76 1994 0.01% 77 1757 0.01% 78 1605 0.01% 79 1608 0.01% 80 1600 0.01% 81 1642 0.01% 82 1861 0.01% 83 2261 0.02% 84 3367 0.02% 85 3832 0.03% 86 4049 0.03% 87 4589 0.03% 88 4489 0.03% 89 4843 0.03% 90 5427 0.04% 91 5399 0.04% 92 5671 0.04% 93 5928 0.04% 94 6250 0.05% 95 6493 0.05% 96 7037 0.05% 97 8010 0.06% 98 9427 0.07% 99 7621 0.05% 100 8232 0.06% 101 8547 0.06% 102 9024 0.07% 103 10062 0.07% 104 10721 0.08% 105 11234 0.08% 106 11954 0.09% 107 12451 0.09% 108 12754 0.09% 109 12959 0.09% 110 13300 0.10% 111 13575 0.10% 112 14255 0.10% 113 15533 0.11% 114 15631 0.11% 115 16448 0.12% 116 16928 0.12% 117 17051 0.12% 118 17548 0.13% 119 17455 0.13% 120 17500 0.13% 121 18574 0.13% 122 19150 0.14% 123 20652 0.15% 124 21634 0.16% 125 22998 0.17% 126 23522 0.17% 127 24564 0.18% 128 24845 0.18% 129 25846 0.19% 130 26551 0.19% 131 28174 0.20% 132 29715 0.21% 133 32177 0.23% 134 33769 0.24% 135 35680 0.26% 136 38622 0.28% 137 42041 0.30% 138 45066 0.33% 139 49221 0.36% 140 51057 0.37% 141 55558 0.40% 142 60992 0.44% 143 68377 0.49% 144 79772 0.58% 145 97372 0.70% 146 127737 0.92% 147 189589 1.37% 148 392380 2.83% 149 3023459 21.81% 150 8670490 62.55% 13860915 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=2.2 sequence=AACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACT criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=92.97 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=13.6 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTAGCAAACTTTGACCCAGTCTTCTATGAAATCAGTTGATGTTGTTCCATCATAAGGGAAGGACATGAGGCCCTTAATTCCACCACAGGCGCTGTGTCCAATGACCACAATGTATT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.00 fanout-score-rank=40 prefix-density=0.01 prefix-fanout=1.0 sequence=ATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=58.43 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.3 sequence=CAAAGAGAGCAGCATACATCCATAGAGAGAAAGAGAAGACATGGCAACCAGAACTCCAAAGCTTGTGAAGCACACATTGTTGACTCGGTTCAAGGATGAGATCACACGAGAACAAATCGACAACTACATTAATGACTATACCAATCTGCTCGATCTCATTCCAACCATGAAGAGTTTCAATTGGGGCACGGATTTGGGCATGGAGTCTGCGGAGCTAAACCGAGGATACACTCATGCCTTTGAATCTACATTTGAGAGCAAGTCAGGTTTGCAAGAGTACCTCGATTCTGCTGCTCTTGCTGCATTTGCAGAAGGATTTTTGCCTACTTTGTCACAGCGTCTTGTGATAGACTACTTTCTCTACTAAATGCTCAGGAGTAACGACTTCGGCCGGGCTATTTCATGGGAATAAAGTAATGTAATGTGCAATAAATGCTGGTTTTGAACCACTGAATGTTCGTGTCTTGATTTCTTGTTTGTGCTGTGCTATGTGAAGGGAGT SRR6031368 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:10:51 Started mapping on | Feb 14 04:10:51 Finished on | Feb 14 04:13:07 Mapping speed, Million of reads per hour | 366.91 Number of input reads | 13860915 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12686422 Uniquely mapped reads % | 91.53% Average mapped length | 294.87 Number of splices: Total | 11588794 Number of splices: Annotated (sjdb) | 11391013 Number of splices: GT/AG | 11365733 Number of splices: GC/AG | 192859 Number of splices: AT/AC | 8286 Number of splices: Non-canonical | 21916 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.02% Deletion average length | 2.25 Insertion rate per base | 0.02% Insertion average length | 1.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 301861 % of reads mapped to multiple loci | 2.18% Number of reads mapped to too many loci | 69985 % of reads mapped to too many loci | 0.50% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.64% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 891589 891589 891589 N_multimapping 301861 301861 301861 N_noFeature 341216 12507631 410161 N_ambiguous 187584 785 77344 UnstrandedReadsAssigned:12157622 PositiveStrandReadsAssigned:178006 NegativeStrandReadsAssigned:12198917 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031368-trimmed-pair1.fastq SRR6031368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,860,915 reads, 12,392,603 reads pseudoaligned [quant] estimated average fragment length: 244.435 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,063 rounds 52401 SRR6031368.ke.tsv 34699 SRR6031368.se.tsv 87100 total ==> SRR6031368.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1774.57 154 6.09818 Potri.005G024800.1.v4.1 1035 791.565 74 6.56926 Potri.004G059700.1.v4.1 961 717.593 3 0.293775 Potri.007G009000.2.v4.1 1416 1172.57 2 0.119857 Potri.003G141000.2.v4.1 2943 2699.57 194 5.04986 Potri.016G087400.1.v4.1 270 72.2515 675 656.491 Potri.015G069301.1.v4.1 564 323.787 0 0 Potri.010G195200.1.v4.1 1773 1529.57 6 0.275648 Potri.012G127500.1.v4.1 977 733.579 992 95.0246 ==> SRR6031368.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 188 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 145 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR6031368 completed mapping pipeline successfully