Starting /dee2/code/volunteer_pipeline.sh SRR6031369 current disk space = 3086907977728 free memory = 1017786936 SRR6031369 SRAfilesize 785de811ec481a7b260768e02f3d0980 SRR6031369.sra SRR6031369.sra file validated SRR6031369 is paired end SRR6031369 is conventional basespace SRR6031369 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031369_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10625 34.0 34.0 34.0 33.0 34.0 2 33.541 34.0 34.0 34.0 33.0 34.0 3 33.5405 34.0 34.0 34.0 33.0 34.0 4 33.54225 34.0 34.0 34.0 33.0 34.0 5 33.4975 34.0 34.0 34.0 33.0 34.0 6 37.30675 38.0 38.0 38.0 36.0 38.0 7 37.45525 38.0 38.0 38.0 37.0 38.0 8 37.565 38.0 38.0 38.0 38.0 38.0 9 37.6505 38.0 38.0 38.0 38.0 38.0 10-14 37.57555 38.0 38.0 38.0 38.0 38.0 15-19 37.56245 38.0 38.0 38.0 38.0 38.0 20-24 37.60504999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.5398 38.0 38.0 38.0 38.0 38.0 30-34 37.54615 38.0 38.0 38.0 38.0 38.0 35-39 37.50715 38.0 38.0 38.0 37.8 38.0 40-44 37.34785000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.271249999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.24305 38.0 38.0 38.0 36.8 38.0 55-59 37.2202 38.0 38.0 38.0 36.8 38.0 60-64 37.14175 38.0 38.0 38.0 36.2 38.0 65-69 37.103049999999996 38.0 38.0 38.0 36.2 38.0 70-74 37.08095 38.0 38.0 38.0 36.0 38.0 75-79 37.036950000000004 38.0 38.0 38.0 36.0 38.0 80-84 37.04855 38.0 38.0 38.0 36.0 38.0 85-89 36.9764 38.0 38.0 38.0 36.0 38.0 90-94 36.8106 38.0 38.0 38.0 35.2 38.0 95-99 36.78195 38.0 38.0 38.0 35.4 38.0 100-104 36.6726 38.0 38.0 38.0 35.0 38.0 105-109 36.612 38.0 38.0 38.0 34.4 38.0 110-114 36.4221 38.0 38.0 38.0 34.0 38.0 115-119 36.31935 38.0 38.0 38.0 34.0 38.0 120-124 36.19585 38.0 38.0 38.0 33.6 38.0 125-129 36.080549999999995 38.0 37.2 38.0 33.0 38.0 130-134 35.91385 38.0 37.2 38.0 33.0 38.0 135-139 35.69805 38.0 36.6 38.0 32.0 38.0 140-144 35.2778 38.0 36.0 38.0 31.0 38.0 145-149 34.6673 38.0 35.8 38.0 29.2 38.0 150 28.983 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 2.0 17 1.0 18 3.0 19 5.0 20 0.0 21 4.0 22 2.0 23 7.0 24 9.0 25 7.0 26 16.0 27 15.0 28 14.0 29 30.0 30 48.0 31 45.0 32 53.0 33 66.0 34 121.0 35 174.0 36 501.0 37 2872.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.341772151898734 16.582278481012658 4.8354430379746836 53.24050632911393 2 14.35 17.05 50.2 18.4 3 13.5 21.224999999999998 31.324999999999996 33.95 4 20.4 29.575000000000003 25.874999999999996 24.15 5 21.09746930593836 33.82610874467552 26.860435980957153 18.215985968428967 6 15.325 34.4 28.449999999999996 21.825 7 12.15 24.4 45.9 17.549999999999997 8 15.775 21.775 36.199999999999996 26.25 9 15.625 20.525 37.724999999999994 26.125 10-14 19.06 28.68 27.62 24.64 15-19 19.265 28.449999999999996 28.799999999999997 23.485 20-24 19.485 28.345 28.09 24.08 25-29 19.765 28.99 27.884999999999998 23.36 30-34 19.175 28.465 28.17 24.19 35-39 19.57 28.845 27.67 23.915 40-44 19.919999999999998 28.634999999999998 28.255000000000003 23.189999999999998 45-49 20.064999999999998 28.565 27.034999999999997 24.335 50-54 19.7 28.505000000000003 28.595 23.200000000000003 55-59 19.895 29.17 27.825 23.11 60-64 19.689999999999998 28.185 28.065 24.060000000000002 65-69 19.625 28.494999999999997 27.939999999999998 23.94 70-74 20.41 28.71 27.35 23.53 75-79 19.435 28.749999999999996 28.275 23.54 80-84 20.29 28.515 27.215 23.98 85-89 20.565 28.675 27.01 23.75 90-94 19.975 28.33 27.48 24.215 95-99 20.165 28.28 27.705000000000002 23.849999999999998 100-104 20.43 28.67 27.575 23.325000000000003 105-109 20.34 28.33 27.589999999999996 23.74 110-114 21.26 28.37 27.125 23.244999999999997 115-119 20.435 29.349999999999998 26.865 23.35 120-124 20.605 28.575 27.089999999999996 23.73 125-129 20.549999999999997 28.249999999999996 27.295 23.905 130-134 20.32 28.15 27.58 23.95 135-139 20.51 28.15 27.125 24.215 140-144 20.995 28.585 27.105 23.315 145-149 20.59 28.825 26.55 24.035 150 19.919819594086697 28.990228013029316 26.509646705086443 24.580305687797544 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 1.5 20 2.0 21 1.5 22 1.5 23 2.5 24 2.5 25 3.0 26 5.5 27 8.5 28 12.5 29 14.5 30 18.5 31 32.5 32 36.5 33 45.5 34 61.5 35 73.0 36 95.5 37 111.5 38 135.0 39 161.5 40 204.5 41 253.0 42 257.0 43 261.0 44 281.5 45 281.5 46 272.0 47 245.5 48 209.5 49 184.0 50 167.5 51 136.5 52 95.5 53 79.5 54 68.0 55 47.0 56 34.0 57 28.0 58 18.5 59 14.5 60 12.0 61 9.0 62 5.0 63 2.5 64 1.0 65 0.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.25 2 0.0 3 0.0 4 0.0 5 0.22499999999999998 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.22499999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.3625 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.7374999999999998 0.0 0.0 0.0 0.0 108-109 1.95 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.25 0.0 0.0 0.0 0.0 120-121 3.7375 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.475 0.0 0.0 0.0 0.0 126-127 4.6375 0.025 0.0 0.0 0.0 128-129 4.875 0.025 0.0 0.0 0.0 130-131 5.1625 0.025 0.0 0.0 0.0 132-133 5.6125 0.025 0.0 0.0 0.0 134-135 6.0 0.025 0.0 0.0 0.0 136-137 6.3625 0.025 0.0 0.0 0.0 138 6.825 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTTCA 10 0.0069754543 143.9875 4 AGACGTG 10 0.0069754543 143.9875 5 >>END_MODULE SRR6031369 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031369_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77525 33.0 33.0 34.0 32.0 34.0 2 32.96325 33.0 33.0 34.0 32.0 34.0 3 33.0005 34.0 33.0 34.0 32.0 34.0 4 32.968 34.0 33.0 34.0 32.0 34.0 5 32.8745 34.0 33.0 34.0 32.0 34.0 6 37.2185 38.0 38.0 38.0 37.0 38.0 7 37.225 38.0 38.0 38.0 37.0 38.0 8 37.24625 38.0 38.0 38.0 37.0 38.0 9 37.19475 38.0 38.0 38.0 37.0 38.0 10-14 37.247400000000006 38.0 38.0 38.0 37.0 38.0 15-19 37.226600000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.221999999999994 38.0 38.0 38.0 37.0 38.0 25-29 37.2091 38.0 38.0 38.0 37.0 38.0 30-34 37.206 38.0 38.0 38.0 37.0 38.0 35-39 37.025800000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.8914 38.0 38.0 38.0 36.8 38.0 45-49 37.05485 38.0 38.0 38.0 37.0 38.0 50-54 37.10455 38.0 38.0 38.0 37.0 38.0 55-59 37.05435 38.0 38.0 38.0 37.0 38.0 60-64 37.0383 38.0 38.0 38.0 36.8 38.0 65-69 37.02205 38.0 38.0 38.0 36.6 38.0 70-74 36.9483 38.0 38.0 38.0 36.0 38.0 75-79 36.92555 38.0 38.0 38.0 36.0 38.0 80-84 36.61745 38.0 38.0 38.0 35.8 38.0 85-89 35.9449 38.0 38.0 38.0 34.6 38.0 90-94 35.977850000000004 38.0 38.0 38.0 34.0 38.0 95-99 35.98295 38.0 38.0 38.0 34.2 38.0 100-104 36.378049999999995 38.0 38.0 38.0 34.4 38.0 105-109 36.505 38.0 38.0 38.0 34.6 38.0 110-114 36.3495 38.0 38.0 38.0 34.2 38.0 115-119 36.262800000000006 38.0 38.0 38.0 34.0 38.0 120-124 36.05145 38.0 38.0 38.0 33.6 38.0 125-129 35.574799999999996 38.0 38.0 38.0 32.2 38.0 130-134 34.59965 38.0 36.6 38.0 27.0 38.0 135-139 33.8412 38.0 36.0 38.0 20.2 38.0 140-144 33.5561 38.0 35.4 38.0 17.0 38.0 145-149 33.0932 38.0 35.4 38.0 11.0 38.0 150 26.855 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 2.0 5 3.0 6 2.0 7 1.0 8 3.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 3.0 15 1.0 16 1.0 17 9.0 18 5.0 19 4.0 20 5.0 21 11.0 22 5.0 23 4.0 24 31.0 25 22.0 26 28.0 27 40.0 28 39.0 29 31.0 30 47.0 31 50.0 32 63.0 33 104.0 34 107.0 35 197.0 36 399.0 37 2775.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.284854563691077 22.893681043129387 8.24974924774323 40.57171514543631 2 21.99097291875627 23.570712136409227 41.27382146439318 13.164493480441324 3 14.343029087261785 28.46038114343029 36.2086258776329 20.987963891675022 4 20.43630892678034 35.481444332999 25.376128385155468 18.706118355065197 5 23.432012042147516 38.81083793276468 22.37832413447065 15.37882589061716 6 16.675 40.5 24.625 18.2 7 18.85 18.75 42.575 19.825 8 17.825 23.0 31.974999999999998 27.200000000000003 9 19.6 22.75 32.525 25.124999999999996 10-14 22.536126806340317 27.74638731936597 27.431371568578427 22.286114305715284 15-19 22.255 28.294999999999998 28.410000000000004 21.04 20-24 22.384999999999998 28.67 27.944999999999997 21.0 25-29 23.07730773077308 28.30783078307831 27.93779377937794 20.67706770677068 30-34 22.33111655582779 28.10140507025351 28.921446072303613 20.64603230161508 35-39 22.532027128862094 28.349660889223816 28.530519969856822 20.58779201205727 40-44 22.734138972809667 27.880161127895263 28.282980866062434 21.102719033232628 45-49 22.835118630493543 27.755531084192615 28.506356992691963 20.902993292621886 50-54 22.82 27.815 28.775000000000002 20.59 55-59 23.151157557877895 26.96634831741587 28.871443572178606 21.011050552527628 60-64 22.81 27.400000000000002 29.235 20.555 65-69 22.55112755637782 28.026401320066004 28.7964398219911 20.626031301565078 70-74 23.165 27.62 28.32 20.895 75-79 22.96 28.194999999999997 27.985 20.86 80-84 23.619028401351965 27.185592493568077 28.663673510568533 20.531705594511426 85-89 23.72872667623539 28.234570432643018 27.798851753126925 20.23785113799467 90-94 23.394589076059212 28.437978560490045 27.651863195507914 20.51556916794283 95-99 23.259372609028308 28.150981892374393 27.814333078296354 20.775312420300942 100-104 24.098377078741734 28.230815467842113 27.434381887397315 20.236425566018834 105-109 23.51117555877794 27.881394069703486 28.041402070103505 20.56602830141507 110-114 23.851192559627982 28.356417820891046 27.711385569278463 20.081004050202512 115-119 23.920980245061266 28.172043010752688 27.28182045511378 20.62515628907227 120-124 24.13982796559312 28.210642128425683 28.135627125425085 19.513902780556112 125-129 24.919517102615693 28.018108651911465 27.867203219315893 19.19517102615694 130-134 24.911068721967315 28.46831984327473 27.07635201319792 19.544259421560035 135-139 24.473504542828632 27.692873273462524 28.239063074418358 19.59455910929048 140-144 24.783128149187057 28.497220923588383 27.46350838917459 19.25614253804997 145-149 24.451032611426562 28.254861564745493 27.465956484598763 19.828149339229185 150 25.22567703109328 27.106318956870613 28.91173520561685 18.756268806419257 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 2.0 20 2.5 21 2.5 22 2.0 23 1.5 24 2.0 25 2.5 26 3.5 27 7.5 28 19.5 29 19.5 30 20.5 31 30.5 32 37.5 33 38.5 34 49.5 35 72.0 36 92.0 37 118.0 38 143.5 39 180.0 40 217.0 41 254.0 42 277.0 43 267.0 44 271.5 45 288.5 46 269.5 47 236.5 48 220.5 49 190.5 50 148.0 51 123.0 52 103.0 53 79.5 54 56.0 55 40.5 56 30.5 57 22.5 58 13.5 59 9.5 60 10.5 61 5.0 62 4.0 63 5.0 64 3.0 65 2.0 66 2.0 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.3 3 0.3 4 0.3 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.01 30-34 0.005 35-39 0.475 40-44 0.7000000000000001 45-49 0.11 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.885 85-89 2.46 90-94 2.0500000000000003 95-99 1.975 100-104 0.18 105-109 0.005 110-114 0.005 115-119 0.025 120-124 0.02 125-129 0.6 130-134 3.015 135-139 4.795 140-144 3.7449999999999997 145-149 0.49500000000000005 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54716981132076 98.925 2 0.4025157232704402 0.8 3 0.0 0.0 4 0.0 0.0 5 0.025157232704402514 0.125 6 0.025157232704402514 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTCACTTCTTCCTTCTTTCTATCTTGTTTTCGACTGCAAAGCTCTTCCCT 6 0.15 No Hit CTCAAAAACATCAAATAACAATGAAGTCTACATTGTTGGTGTGGTTCTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.7625 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.2000000000000002 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.2625 0.0 0.0 0.0 0.0 120-121 3.7625 0.0 0.0 0.0 0.0 122-123 4.125 0.0 0.0 0.0 0.0 124-125 4.487500000000001 0.0 0.0 0.0 0.0 126-127 4.6 0.0 0.0 0.0 0.0 128-129 4.824999999999999 0.0 0.0 0.0 0.0 130-131 5.1 0.0 0.0 0.0 0.0 132-133 5.475 0.0 0.0 0.0 0.0 134-135 5.825 0.0 0.0 0.0 0.0 136-137 6.1875 0.0 0.0 0.0 0.0 138 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTTGA 10 0.0071372455 142.88751 6 >>END_MODULE Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966440 spots for SRR6031369.sra Written 966440 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra Read 966424 spots for SRR6031369.sra Written 966424 spots for SRR6031369.sra SRR ids: ['SRR6031369.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_iniam0sj SRR6031369.sra spots: 19328496 blocks: [[1, 966424], [966425, 1932848], [1932849, 2899272], [2899273, 3865696], [3865697, 4832120], [4832121, 5798544], [5798545, 6764968], [6764969, 7731392], [7731393, 8697816], [8697817, 9664240], [9664241, 10630664], [10630665, 11597088], [11597089, 12563512], [12563513, 13529936], [13529937, 14496360], [14496361, 15462784], [15462785, 16429208], [16429209, 17395632], [17395633, 18362056], [18362057, 19328496]] SRR6031369 file size 6490341 SRR6031369 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031369 SRR6031369_1.fastq SRR6031369_2.fastq Input file: SRR6031369_1.fastq Paired file: SRR6031369_2.fastq trimmed: SRR6031369-trimmed-pair1.fastq, SRR6031369-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:56:31 2025 >> started Fri Feb 14 04:56:55 2025 >> done (24.055s) 19328496 read pairs processed; of these: 18299 ( 0.09%) short read pairs filtered out after trimming by size control 52531 ( 0.27%) empty read pairs filtered out after trimming by size control 19257666 (99.63%) read pairs available; of these: 7813826 (40.58%) trimmed read pairs available after processing 11443840 (59.42%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 7 0.00% 20 11 0.00% 21 10 0.00% 22 16 0.00% 23 15 0.00% 24 17 0.00% 25 15 0.00% 26 19 0.00% 27 17 0.00% 28 19 0.00% 29 14 0.00% 30 25 0.00% 31 44 0.00% 32 26 0.00% 33 40 0.00% 34 23 0.00% 35 40 0.00% 36 31 0.00% 37 38 0.00% 38 42 0.00% 39 38 0.00% 40 51 0.00% 41 60 0.00% 42 59 0.00% 43 67 0.00% 44 69 0.00% 45 68 0.00% 46 85 0.00% 47 89 0.00% 48 119 0.00% 49 130 0.00% 50 147 0.00% 51 183 0.00% 52 183 0.00% 53 207 0.00% 54 211 0.00% 55 214 0.00% 56 253 0.00% 57 267 0.00% 58 301 0.00% 59 338 0.00% 60 380 0.00% 61 459 0.00% 62 493 0.00% 63 583 0.00% 64 577 0.00% 65 728 0.00% 66 814 0.00% 67 1010 0.01% 68 1095 0.01% 69 1533 0.01% 70 1759 0.01% 71 1544 0.01% 72 1696 0.01% 73 1835 0.01% 74 2045 0.01% 75 2178 0.01% 76 2497 0.01% 77 2702 0.01% 78 2951 0.02% 79 3232 0.02% 80 3488 0.02% 81 4118 0.02% 82 4736 0.02% 83 5135 0.03% 84 6543 0.03% 85 7067 0.04% 86 7642 0.04% 87 8256 0.04% 88 8540 0.04% 89 9337 0.05% 90 9994 0.05% 91 10836 0.06% 92 11739 0.06% 93 12496 0.06% 94 13680 0.07% 95 14515 0.08% 96 15279 0.08% 97 16581 0.09% 98 18484 0.10% 99 17379 0.09% 100 18342 0.10% 101 19352 0.10% 102 20532 0.11% 103 21556 0.11% 104 22646 0.12% 105 24163 0.13% 106 24833 0.13% 107 25933 0.13% 108 26642 0.14% 109 27807 0.14% 110 28423 0.15% 111 29319 0.15% 112 30266 0.16% 113 31942 0.17% 114 32908 0.17% 115 34393 0.18% 116 35180 0.18% 117 36474 0.19% 118 37085 0.19% 119 38214 0.20% 120 39108 0.20% 121 40316 0.21% 122 41149 0.21% 123 43068 0.22% 124 44566 0.23% 125 46738 0.24% 126 48079 0.25% 127 49687 0.26% 128 50141 0.26% 129 52067 0.27% 130 53724 0.28% 131 55531 0.29% 132 57225 0.30% 133 60060 0.31% 134 62392 0.32% 135 65788 0.34% 136 70062 0.36% 137 75270 0.39% 138 80882 0.42% 139 84752 0.44% 140 91189 0.47% 141 97337 0.51% 142 104316 0.54% 143 114391 0.59% 144 132007 0.69% 145 157530 0.82% 146 203878 1.06% 147 300878 1.56% 148 587147 3.05% 149 4098962 21.28% 150 11443840 59.42% 19257666 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=2.62 fanout-score-rank=31 prefix-density=0.17 prefix-fanout=2.4 sequence=GCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACT criterion=fanout-score sequence-density=0.08 sequence-density-rank=10 fanout-score=412.52 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=38.3 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=31 prefix-density=0.25 prefix-fanout=3.0 sequence=ACTAACTTTCTAGTGCTCTCCTTTCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=371.44 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=31.5 sequence=AAGAAGAAGAAA SRR6031369 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:57:43 Started mapping on | Feb 14 04:57:43 Finished on | Feb 14 05:00:15 Mapping speed, Million of reads per hour | 456.10 Number of input reads | 19257666 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 18281566 Uniquely mapped reads % | 94.93% Average mapped length | 292.13 Number of splices: Total | 17728671 Number of splices: Annotated (sjdb) | 17412781 Number of splices: GT/AG | 17437192 Number of splices: GC/AG | 228052 Number of splices: AT/AC | 11666 Number of splices: Non-canonical | 51761 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 627721 % of reads mapped to multiple loci | 3.26% Number of reads mapped to too many loci | 23455 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.66% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 361949 361949 361949 N_multimapping 627721 627721 627721 N_noFeature 504602 18045650 633093 N_ambiguous 222320 967 114355 UnstrandedReadsAssigned:17554644 PositiveStrandReadsAssigned:234949 NegativeStrandReadsAssigned:17534118 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031369 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031369-trimmed-pair1.fastq SRR6031369-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,257,666 reads, 17,575,062 reads pseudoaligned [quant] estimated average fragment length: 250.216 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,125 rounds 52401 SRR6031369.ke.tsv 34699 SRR6031369.se.tsv 87100 total ==> SRR6031369.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.78 387 12.5908 Potri.005G024800.1.v4.1 1035 785.784 138 10.1063 Potri.004G059700.1.v4.1 961 711.848 14 1.13177 Potri.007G009000.2.v4.1 1416 1166.78 0 0 Potri.003G141000.2.v4.1 2943 2693.78 547.137 11.6883 Potri.016G087400.1.v4.1 270 82.3215 1579.57 1104.18 Potri.015G069301.1.v4.1 564 322.675 0 0 Potri.010G195200.1.v4.1 1773 1523.78 54 2.03933 Potri.012G127500.1.v4.1 977 727.819 3596 284.323 ==> SRR6031369.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 377 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 295 Potri.001G212900.v4.1 22 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 43 SRR6031369 completed mapping pipeline successfully