Starting /dee2/code/volunteer_pipeline.sh SRR6031370 current disk space = 3086926880768 free memory = 1017780412 SRR6031370 SRAfilesize 265a5c7a67a0a6469ba824c9986c3dad SRR6031370.sra SRR6031370.sra file validated SRR6031370 is paired end SRR6031370 is conventional basespace SRR6031370 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031370_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.19875 34.0 34.0 34.0 33.0 34.0 2 33.5305 34.0 34.0 34.0 33.0 34.0 3 33.5415 34.0 34.0 34.0 33.0 34.0 4 33.5445 34.0 34.0 34.0 33.0 34.0 5 33.445 34.0 34.0 34.0 33.0 34.0 6 37.19925 38.0 38.0 38.0 36.0 38.0 7 37.501 38.0 38.0 38.0 37.0 38.0 8 37.58275 38.0 38.0 38.0 38.0 38.0 9 37.59025 38.0 38.0 38.0 38.0 38.0 10-14 37.55525 38.0 38.0 38.0 38.0 38.0 15-19 37.55195 38.0 38.0 38.0 38.0 38.0 20-24 37.54935 38.0 38.0 38.0 38.0 38.0 25-29 37.48555 38.0 38.0 38.0 38.0 38.0 30-34 37.46894999999999 38.0 38.0 38.0 38.0 38.0 35-39 37.43025 38.0 38.0 38.0 37.6 38.0 40-44 37.2632 38.0 38.0 38.0 37.0 38.0 45-49 37.2432 38.0 38.0 38.0 37.0 38.0 50-54 37.212650000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.151700000000005 38.0 38.0 38.0 36.6 38.0 60-64 37.11165 38.0 38.0 38.0 36.2 38.0 65-69 37.05535 38.0 38.0 38.0 36.0 38.0 70-74 37.02725 38.0 38.0 38.0 36.0 38.0 75-79 36.957100000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.87945 38.0 38.0 38.0 36.0 38.0 85-89 36.81609999999999 38.0 38.0 38.0 36.0 38.0 90-94 36.70015 38.0 38.0 38.0 35.0 38.0 95-99 36.6432 38.0 38.0 38.0 34.8 38.0 100-104 36.56285 38.0 38.0 38.0 34.6 38.0 105-109 36.523199999999996 38.0 38.0 38.0 34.2 38.0 110-114 36.3744 38.0 38.0 38.0 34.0 38.0 115-119 36.20205 38.0 38.0 38.0 33.8 38.0 120-124 36.136 38.0 38.0 38.0 33.6 38.0 125-129 35.966449999999995 38.0 37.6 38.0 33.0 38.0 130-134 35.7347 38.0 37.0 38.0 32.2 38.0 135-139 35.6528 38.0 36.4 38.0 32.6 38.0 140-144 35.30015 38.0 36.0 38.0 31.0 38.0 145-149 34.6053 38.0 36.0 38.0 28.8 38.0 150 28.77 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 4.0 14 2.0 15 2.0 16 4.0 17 2.0 18 4.0 19 7.0 20 1.0 21 0.0 22 4.0 23 2.0 24 6.0 25 8.0 26 16.0 27 16.0 28 30.0 29 32.0 30 30.0 31 41.0 32 58.0 33 88.0 34 104.0 35 193.0 36 491.0 37 2851.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.350164099974755 17.647058823529413 5.55415299166877 43.44862408482707 2 16.85 16.225 47.375 19.55 3 13.775 22.325 32.800000000000004 31.1 4 20.45 29.925 27.400000000000002 22.225 5 21.217434869739478 34.2685370741483 25.951903807615228 18.562124248496996 6 16.825000000000003 36.125 27.575 19.475 7 12.775 24.85 45.425 16.950000000000003 8 13.475000000000001 23.5 36.575 26.450000000000003 9 14.924999999999999 21.05 38.074999999999996 25.95 10-14 18.96 28.775000000000002 28.37 23.895 15-19 19.03 28.46 28.455000000000002 24.055 20-24 19.66 28.475 28.449999999999996 23.415 25-29 19.040000000000003 28.860000000000003 28.595 23.505000000000003 30-34 19.255 29.365000000000002 27.96 23.419999999999998 35-39 19.225 29.299999999999997 28.16 23.315 40-44 19.195 29.26 28.01 23.535 45-49 19.855 27.93 28.065 24.15 50-54 19.605 28.58 27.93 23.885 55-59 19.615 29.09 27.655 23.64 60-64 19.72 28.965000000000003 27.845 23.47 65-69 19.96 28.694999999999997 28.33 23.015 70-74 19.655 29.45 27.229999999999997 23.665 75-79 19.845 28.515 28.335 23.305 80-84 19.705000000000002 28.849999999999998 27.92 23.525 85-89 20.07 28.799999999999997 27.495000000000005 23.635 90-94 20.419999999999998 28.74 27.650000000000002 23.189999999999998 95-99 20.205000000000002 28.615000000000002 28.04 23.14 100-104 19.89 28.735 27.955000000000002 23.419999999999998 105-109 20.34 28.935 27.315 23.41 110-114 20.215 29.37 27.189999999999998 23.225 115-119 20.39 29.160000000000004 26.645000000000003 23.805 120-124 20.65 28.470000000000002 27.51 23.369999999999997 125-129 20.7 28.405 27.029999999999998 23.865 130-134 20.16 28.93 27.534999999999997 23.375 135-139 20.055 28.63 27.51 23.805 140-144 20.255000000000003 28.42 27.625 23.7 145-149 20.13 28.994999999999997 27.18 23.695 150 20.135236664162285 28.850488354620584 26.67167543200601 24.34259954921112 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 1.0 13 1.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.0 20 1.5 21 1.5 22 5.5 23 5.5 24 2.5 25 4.5 26 10.0 27 11.5 28 12.0 29 17.5 30 23.5 31 33.0 32 42.5 33 56.0 34 69.5 35 84.5 36 109.0 37 130.0 38 150.5 39 178.5 40 197.5 41 227.0 42 241.5 43 237.0 44 265.0 45 268.0 46 265.5 47 265.0 48 220.5 49 183.5 50 154.0 51 129.5 52 104.0 53 78.0 54 64.0 55 47.5 56 27.5 57 15.0 58 13.5 59 10.5 60 9.5 61 6.0 62 3.5 63 2.5 64 0.5 65 0.5 66 0.5 67 1.0 68 1.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.975 2 0.0 3 0.0 4 0.0 5 0.2 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5794910556815319 1.15 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCAACTAATCTCGTATGC 5 0.125 TruSeq Adapter, Index 23 (97% over 38bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7749999999999999 0.0 0.0 0.0 0.0 102-103 1.0375 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.55 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.1 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.7249999999999996 0.0 0.0 0.0 0.0 126-127 4.15 0.0 0.0 0.0 0.0 128-129 4.65 0.0 0.0 0.0 0.0 130-131 5.0 0.0 0.0 0.0 0.0 132-133 5.425 0.0 0.0 0.0 0.0 134-135 5.675 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138 6.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGTGGT 10 0.006973645 144.0 1 TTTTTTT 25 5.183459E-4 28.8 140-144 >>END_MODULE SRR6031370 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031370_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6895 33.0 33.0 34.0 32.0 34.0 2 32.8895 34.0 33.0 34.0 32.0 34.0 3 32.8755 34.0 33.0 34.0 32.0 34.0 4 32.80025 34.0 33.0 34.0 32.0 34.0 5 32.701 34.0 33.0 34.0 32.0 34.0 6 37.05675 38.0 38.0 38.0 37.0 38.0 7 37.1285 38.0 38.0 38.0 37.0 38.0 8 37.12075 38.0 38.0 38.0 37.0 38.0 9 37.12525 38.0 38.0 38.0 37.0 38.0 10-14 37.097899999999996 38.0 38.0 38.0 37.0 38.0 15-19 37.1018 38.0 38.0 38.0 37.0 38.0 20-24 37.0459 38.0 38.0 38.0 37.0 38.0 25-29 37.09345 38.0 38.0 38.0 37.0 38.0 30-34 37.0738 38.0 38.0 38.0 37.0 38.0 35-39 36.919 38.0 38.0 38.0 36.8 38.0 40-44 36.787099999999995 38.0 38.0 38.0 36.4 38.0 45-49 36.89640000000001 38.0 38.0 38.0 36.0 38.0 50-54 36.96585 38.0 38.0 38.0 36.6 38.0 55-59 36.934450000000005 38.0 38.0 38.0 36.6 38.0 60-64 36.920550000000006 38.0 38.0 38.0 36.2 38.0 65-69 36.774 38.0 38.0 38.0 36.0 38.0 70-74 36.719849999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.67389999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.3852 38.0 38.0 38.0 35.4 38.0 85-89 35.7262 38.0 38.0 38.0 34.0 38.0 90-94 35.8212 38.0 38.0 38.0 34.0 38.0 95-99 35.785349999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.118550000000006 38.0 38.0 38.0 34.2 38.0 105-109 36.299850000000006 38.0 38.0 38.0 34.4 38.0 110-114 36.13065 38.0 38.0 38.0 34.0 38.0 115-119 35.9975 38.0 38.0 38.0 34.0 38.0 120-124 35.88674999999999 38.0 38.0 38.0 33.6 38.0 125-129 35.455349999999996 38.0 38.0 38.0 31.6 38.0 130-134 34.36345 38.0 36.8 38.0 23.6 38.0 135-139 33.6917 38.0 36.0 38.0 15.8 38.0 140-144 33.43750000000001 38.0 36.0 38.0 14.0 38.0 145-149 32.9628 38.0 35.6 38.0 8.8 38.0 150 26.45725 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 1.0 6 2.0 7 4.0 8 1.0 9 1.0 10 2.0 11 3.0 12 3.0 13 6.0 14 8.0 15 8.0 16 4.0 17 4.0 18 5.0 19 6.0 20 5.0 21 4.0 22 13.0 23 14.0 24 22.0 25 26.0 26 21.0 27 26.0 28 44.0 29 45.0 30 54.0 31 64.0 32 80.0 33 88.0 34 97.0 35 168.0 36 357.0 37 2804.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.73463757210936 24.153498871331827 8.35214446952596 33.759719087032856 2 22.45922208281054 23.513174404015054 41.1543287327478 12.8732747804266 3 15.838353413654618 27.81124497991968 35.6425702811245 20.707831325301203 4 20.66281697213156 36.45493346723575 25.207130303791114 17.675119256841576 5 23.322442824830357 40.16084443327469 21.060567981905002 15.456144759989948 6 19.2 39.900000000000006 23.549999999999997 17.349999999999998 7 20.125 19.400000000000002 41.775 18.7 8 18.4 24.55 31.0 26.05 9 19.375 22.5 33.4 24.725 10-14 22.97114855742787 28.356417820891046 27.151357567878392 21.52107605380269 15-19 22.665 28.49 28.375 20.47 20-24 22.405 28.355000000000004 28.535 20.705000000000002 25-29 23.211160558027903 29.006450322516127 27.45137256862843 20.331016550827542 30-34 22.936146807340364 28.48642432121606 28.66143307165358 19.91599579978999 35-39 22.934444332898305 28.722015861861262 27.89378576448148 20.44975404075896 40-44 23.168217249182803 27.985919034448077 28.242393764143824 20.603469952225296 45-49 22.869439023169694 27.788620327278185 28.78446679677726 20.55747385277486 50-54 22.33 27.965 28.910000000000004 20.794999999999998 55-59 23.33116655832792 28.046402320116005 27.961398069903492 20.661033051652584 60-64 22.81 27.555000000000003 28.93 20.705000000000002 65-69 22.86114305715286 28.081404070203508 28.30641532076604 20.751037551877594 70-74 23.155 27.744999999999997 28.610000000000003 20.49 75-79 23.585 27.93 28.225 20.26 80-84 23.331822531097345 28.413154051468 28.327541924762052 19.92748149267261 85-89 23.546288231979098 27.64998206875352 28.623392591833596 20.180337107433783 90-94 23.35167634770203 27.850810149801287 28.360338326709467 20.43717517578722 95-99 23.40966921119593 28.437659033078884 27.557251908396946 20.595419847328245 100-104 23.73441490160733 28.356116368734664 27.92048470281909 19.988984026838917 105-109 23.544999999999998 28.08 27.665 20.71 110-114 23.400000000000002 28.665000000000003 27.935 20.0 115-119 23.443516527479122 28.774316147422113 27.804170625593837 19.977996699504928 120-124 23.877387738773876 28.42784278427843 27.872787278727873 19.82198219821982 125-129 23.905943827563682 28.36758277646586 27.196904989197606 20.52956840677285 130-134 24.897013388259527 28.57363542739444 27.183316168898042 19.346035015447992 135-139 24.485197799318836 28.137280586848313 27.44563793555148 19.931883678281373 140-144 24.174626245847175 28.498754152823917 27.09717607973422 20.229443521594686 145-149 24.870726442090465 28.525528389979414 27.41603494151313 19.18771022641699 150 24.291091593475535 28.180677540777914 28.25595984943538 19.27227101631117 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 3.0 23 6.5 24 5.5 25 4.0 26 5.0 27 8.0 28 14.5 29 18.0 30 21.5 31 33.0 32 39.0 33 39.5 34 51.0 35 73.0 36 95.5 37 112.0 38 141.0 39 188.5 40 231.0 41 247.0 42 264.5 43 293.0 44 283.0 45 280.0 46 271.0 47 240.5 48 214.5 49 173.5 50 149.5 51 119.0 52 85.5 53 74.5 54 55.5 55 43.0 56 37.5 57 23.0 58 13.5 59 10.0 60 8.5 61 7.0 62 5.0 63 2.5 64 0.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.375 3 0.4 4 0.42500000000000004 5 0.525 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.38999999999999996 40-44 0.575 45-49 0.08499999999999999 50-54 0.0 55-59 0.005 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.715 85-89 2.405 90-94 1.87 95-99 1.7500000000000002 100-104 0.145 105-109 0.0 110-114 0.0 115-119 0.015 120-124 0.01 125-129 0.485 130-134 2.9000000000000004 135-139 4.575 140-144 3.6799999999999997 145-149 0.40499999999999997 150 0.375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34459289135367 98.52499999999999 2 0.5293672800604992 1.05 3 0.07562389715149988 0.22499999999999998 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.05 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.9625 0.0 0.0 0.0 0.0 104-105 1.2374999999999998 0.0 0.0 0.0 0.0 106-107 1.35 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.0 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.0 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.387499999999999 0.0 0.0 0.0 0.0 130-131 4.7375 0.0 0.0 0.0 0.0 132-133 5.15 0.0 0.0 0.0 0.0 134-135 5.4 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014542 spots for SRR6031370.sra Written 1014542 spots for SRR6031370.sra Read 1014549 spots for SRR6031370.sra Written 1014549 spots for SRR6031370.sra SRR ids: ['SRR6031370.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ptaqcn21 SRR6031370.sra spots: 20290847 blocks: [[1, 1014542], [1014543, 2029084], [2029085, 3043626], [3043627, 4058168], [4058169, 5072710], [5072711, 6087252], [6087253, 7101794], [7101795, 8116336], [8116337, 9130878], [9130879, 10145420], [10145421, 11159962], [11159963, 12174504], [12174505, 13189046], [13189047, 14203588], [14203589, 15218130], [15218131, 16232672], [16232673, 17247214], [17247215, 18261756], [18261757, 19276298], [19276299, 20290847]] SRR6031370 file size 6814571 SRR6031370 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031370 SRR6031370_1.fastq SRR6031370_2.fastq Input file: SRR6031370_1.fastq Paired file: SRR6031370_2.fastq trimmed: SRR6031370-trimmed-pair1.fastq, SRR6031370-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:55:42 2025 >> started Fri Feb 14 04:56:17 2025 >> done (34.914s) 20290847 read pairs processed; of these: 27278 ( 0.13%) short read pairs filtered out after trimming by size control 99084 ( 0.49%) empty read pairs filtered out after trimming by size control 20164485 (99.38%) read pairs available; of these: 8334210 (41.33%) trimmed read pairs available after processing 11830275 (58.67%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 18 0.00% 19 19 0.00% 20 16 0.00% 21 24 0.00% 22 30 0.00% 23 35 0.00% 24 21 0.00% 25 42 0.00% 26 30 0.00% 27 27 0.00% 28 27 0.00% 29 28 0.00% 30 32 0.00% 31 47 0.00% 32 31 0.00% 33 39 0.00% 34 41 0.00% 35 54 0.00% 36 49 0.00% 37 52 0.00% 38 45 0.00% 39 53 0.00% 40 52 0.00% 41 77 0.00% 42 64 0.00% 43 72 0.00% 44 107 0.00% 45 109 0.00% 46 143 0.00% 47 126 0.00% 48 134 0.00% 49 159 0.00% 50 153 0.00% 51 186 0.00% 52 199 0.00% 53 183 0.00% 54 216 0.00% 55 206 0.00% 56 259 0.00% 57 289 0.00% 58 312 0.00% 59 272 0.00% 60 355 0.00% 61 397 0.00% 62 430 0.00% 63 493 0.00% 64 587 0.00% 65 801 0.00% 66 883 0.00% 67 949 0.00% 68 1269 0.01% 69 2521 0.01% 70 2632 0.01% 71 1850 0.01% 72 1610 0.01% 73 1587 0.01% 74 1694 0.01% 75 1742 0.01% 76 1966 0.01% 77 2027 0.01% 78 2457 0.01% 79 2547 0.01% 80 2962 0.01% 81 3398 0.02% 82 3843 0.02% 83 4625 0.02% 84 6370 0.03% 85 6808 0.03% 86 7172 0.04% 87 7784 0.04% 88 8076 0.04% 89 8624 0.04% 90 9682 0.05% 91 10098 0.05% 92 10840 0.05% 93 11875 0.06% 94 12708 0.06% 95 13474 0.07% 96 14399 0.07% 97 15486 0.08% 98 17971 0.09% 99 17101 0.08% 100 17727 0.09% 101 19018 0.09% 102 20522 0.10% 103 22070 0.11% 104 23164 0.11% 105 24642 0.12% 106 25940 0.13% 107 26735 0.13% 108 28035 0.14% 109 29261 0.15% 110 30144 0.15% 111 31393 0.16% 112 32782 0.16% 113 34138 0.17% 114 36007 0.18% 115 37254 0.18% 116 38638 0.19% 117 39573 0.20% 118 40396 0.20% 119 41892 0.21% 120 42693 0.21% 121 44507 0.22% 122 45862 0.23% 123 48243 0.24% 124 50539 0.25% 125 52947 0.26% 126 54681 0.27% 127 55679 0.28% 128 57212 0.28% 129 58366 0.29% 130 61003 0.30% 131 62397 0.31% 132 65922 0.33% 133 69320 0.34% 134 72008 0.36% 135 76751 0.38% 136 80900 0.40% 137 86857 0.43% 138 92416 0.46% 139 97330 0.48% 140 103908 0.52% 141 111367 0.55% 142 118940 0.59% 143 130966 0.65% 144 151240 0.75% 145 176360 0.87% 146 227476 1.13% 147 329495 1.63% 148 628285 3.12% 149 4255038 21.10% 150 11830275 58.67% 20164485 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=36 prefix-density=0.18 prefix-fanout=2.0 sequence=TATGCTACCCCCAA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=109.30 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=17.7 sequence=CAGCATCAACAT criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.63 fanout-score-rank=22 prefix-density=0.19 prefix-fanout=3.9 sequence=TTTTTGGCAACCTTCTTATTATTACTTCTGCCCAACACCTATGCTCACCACCTTCTACTTCCACATTGCATGAATCAATTTTCTTTAGCAAGCTATGCCTGTGCTATGCTTCCATACACACCATTTCCAC criterion=fanout-score sequence-density=0.01 sequence-density-rank=45 fanout-score=481.85 fanout-score-rank=1 prefix-density=0.30 prefix-fanout=9.4 sequence=AAGAAAATTCACAGAGATGGAGTTAATTACAGGGTTCAACAAGGTGATCGTTCTGATGTTGATGCTGATGCTCTTGAGGAAAACAACAGCATACTCGGAAGAGTACGATAAGAAGTGCTATGATAAATGTTTTAGAAGCTGTGTTGATCAAGGTAATATACCGTGGCAGTGTTCGTCTCACTGCATGGACGCGTGCAGCAACAATTTAGATGTAATTCGCTACTGCAATGTTGGTTGTTCGCTTCAAAATTGCAACAAAATCATGGACGATGAGGTGAAAAGGCATATTTGCTTGAAGGAGTGCTCGAACACTCACTGCAACCCCAAACACTTCAAGAAGTCTCCGTAGCATCTGCTCTTTCATATTTGGAGCAATATATCTACAAGTAATGTCATGATAAATAATCAAATGATTAAGGGATGAATCATCCTTAATTATCGAGTAATTAAACCCATGGCTGTAACATCAAGCTG SRR6031370 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:57:04 Started mapping on | Feb 14 04:57:04 Finished on | Feb 14 04:59:42 Mapping speed, Million of reads per hour | 459.44 Number of input reads | 20164485 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 19187789 Uniquely mapped reads % | 95.16% Average mapped length | 291.99 Number of splices: Total | 18205324 Number of splices: Annotated (sjdb) | 17824883 Number of splices: GT/AG | 17895432 Number of splices: GC/AG | 239304 Number of splices: AT/AC | 12156 Number of splices: Non-canonical | 58432 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.04% Deletion average length | 3.11 Insertion rate per base | 0.03% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 472729 % of reads mapped to multiple loci | 2.34% Number of reads mapped to too many loci | 23258 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.35% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 529725 529725 529725 N_multimapping 472729 472729 472729 N_noFeature 592214 18916219 752514 N_ambiguous 255098 1360 142921 UnstrandedReadsAssigned:18340477 PositiveStrandReadsAssigned:270210 NegativeStrandReadsAssigned:18292354 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031370 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031370-trimmed-pair1.fastq SRR6031370-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,164,485 reads, 18,332,951 reads pseudoaligned [quant] estimated average fragment length: 253.618 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR6031370.ke.tsv 34699 SRR6031370.se.tsv 87100 total ==> SRR6031370.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.38 676 19.6373 Potri.005G024800.1.v4.1 1035 782.382 163 10.6842 Potri.004G059700.1.v4.1 961 708.482 33 2.38868 Potri.007G009000.2.v4.1 1416 1163.38 0 0 Potri.003G141000.2.v4.1 2943 2690.38 332.193 6.33212 Potri.016G087400.1.v4.1 270 83.1726 1583 976.054 Potri.015G069301.1.v4.1 564 321.749 0 0 Potri.010G195200.1.v4.1 1773 1520.38 35 1.18056 Potri.012G127500.1.v4.1 977 724.443 3128 221.429 ==> SRR6031370.se.tsv <== Potri.001G166300.v4.1 7 Potri.001G448400.v4.1 3282 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 379 Potri.001G212900.v4.1 176 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 10 SRR6031370 completed mapping pipeline successfully