Starting /dee2/code/volunteer_pipeline.sh SRR6031371 current disk space = 3087084965888 free memory = 1468698192 SRR6031371 SRAfilesize 5a5943d8f629b7e8fe555183a75353d8 SRR6031371.sra SRR6031371.sra file validated SRR6031371 is paired end SRR6031371 is conventional basespace SRR6031371 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.82 34.0 33.0 34.0 33.0 34.0 2 33.37125 34.0 34.0 34.0 33.0 34.0 3 33.4285 34.0 34.0 34.0 33.0 34.0 4 33.47225 34.0 34.0 34.0 33.0 34.0 5 33.336 34.0 34.0 34.0 33.0 34.0 6 37.10675 38.0 38.0 38.0 36.0 38.0 7 37.37875 38.0 38.0 38.0 37.0 38.0 8 37.447 38.0 38.0 38.0 37.0 38.0 9 37.4365 38.0 38.0 38.0 37.0 38.0 10-14 37.4665 38.0 38.0 38.0 37.4 38.0 15-19 37.48595 38.0 38.0 38.0 37.8 38.0 20-24 37.480650000000004 38.0 38.0 38.0 37.8 38.0 25-29 37.4527 38.0 38.0 38.0 37.4 38.0 30-34 37.4022 38.0 38.0 38.0 37.2 38.0 35-39 37.36409999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.162850000000006 38.0 38.0 38.0 36.4 38.0 45-49 37.11775 38.0 38.0 38.0 36.0 38.0 50-54 37.12845 38.0 38.0 38.0 36.0 38.0 55-59 37.062 38.0 38.0 38.0 36.0 38.0 60-64 37.011399999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.973699999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.84875 38.0 38.0 38.0 35.6 38.0 75-79 36.83055 38.0 38.0 38.0 35.2 38.0 80-84 36.7192 38.0 38.0 38.0 35.0 38.0 85-89 36.6928 38.0 38.0 38.0 34.8 38.0 90-94 36.60795 38.0 38.0 38.0 34.0 38.0 95-99 36.5208 38.0 38.0 38.0 34.2 38.0 100-104 36.38125 38.0 38.0 38.0 34.0 38.0 105-109 36.24829999999999 38.0 38.0 38.0 33.6 38.0 110-114 35.951049999999995 38.0 37.2 38.0 32.4 38.0 115-119 35.81705 38.0 37.0 38.0 31.0 38.0 120-124 35.7529 38.0 37.0 38.0 31.6 38.0 125-129 35.3108 38.0 36.2 38.0 30.4 38.0 130-134 34.92235 38.0 36.0 38.0 28.8 38.0 135-139 34.6533 38.0 36.0 38.0 27.6 38.0 140-144 33.91345 38.0 34.2 38.0 23.2 38.0 145-149 32.747150000000005 38.0 33.0 38.0 11.0 38.0 150 23.868 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 3.0 17 0.0 18 0.0 19 3.0 20 4.0 21 5.0 22 11.0 23 13.0 24 16.0 25 19.0 26 22.0 27 34.0 28 21.0 29 37.0 30 48.0 31 61.0 32 76.0 33 110.0 34 136.0 35 255.0 36 594.0 37 2527.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.80959673302706 15.26288922919857 8.422664624808576 29.5048494129658 2 22.425 18.175 33.125 26.275 3 18.975 25.0 27.275 28.749999999999996 4 24.349999999999998 31.175000000000004 22.825 21.65 5 22.702159718734304 35.76092415871421 23.204419889502763 18.33249623304872 6 16.825000000000003 35.175 25.874999999999996 22.125 7 14.499999999999998 23.275000000000002 43.7 18.525 8 17.549999999999997 22.900000000000002 32.125 27.425 9 17.675 24.15 32.225 25.95 10-14 20.655 29.294999999999998 26.795 23.255 15-19 19.72 28.965000000000003 27.465 23.849999999999998 20-24 19.985 28.244999999999997 27.805000000000003 23.965 25-29 19.43 28.89 27.54 24.14 30-34 20.01 28.915000000000003 27.065 24.01 35-39 20.195 28.544999999999998 27.33 23.93 40-44 20.105 28.689999999999998 27.075 24.13 45-49 20.485 28.244999999999997 26.845000000000002 24.425 50-54 19.905 28.925 27.650000000000002 23.52 55-59 20.19 28.46 27.905 23.445 60-64 20.424999999999997 28.749999999999996 27.145000000000003 23.68 65-69 20.13 27.534999999999997 28.025 24.310000000000002 70-74 20.330000000000002 28.485 27.675 23.51 75-79 20.294999999999998 28.189999999999998 27.565 23.95 80-84 20.3 28.449999999999996 27.775 23.474999999999998 85-89 20.95 28.28 27.229999999999997 23.54 90-94 20.52 28.735 27.105 23.64 95-99 20.31 28.23 27.595 23.865 100-104 20.335 28.34 27.150000000000002 24.175 105-109 20.48 28.645 27.125 23.75 110-114 20.44 28.275 27.605 23.68 115-119 20.345 28.435 27.365000000000002 23.855 120-124 20.580000000000002 28.23 27.525 23.665 125-129 20.979999999999997 27.834999999999997 27.91 23.275000000000002 130-134 21.14 28.16 27.3 23.400000000000002 135-139 20.805 27.97 27.68 23.544999999999998 140-144 20.65 27.51 28.035 23.805 145-149 21.6 28.139999999999997 26.72 23.54 150 20.91913611250628 26.745354093420392 27.423405323957812 24.91210447011552 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 1.0 22 1.5 23 0.5 24 2.0 25 3.5 26 4.0 27 5.0 28 9.5 29 12.0 30 13.5 31 26.5 32 32.0 33 35.5 34 49.0 35 63.5 36 77.5 37 100.0 38 124.5 39 144.0 40 184.0 41 231.0 42 249.0 43 261.5 44 274.0 45 271.0 46 266.5 47 249.0 48 245.0 49 243.5 50 196.0 51 139.0 52 114.5 53 99.5 54 74.0 55 48.5 56 35.0 57 29.0 58 19.5 59 16.0 60 12.0 61 7.5 62 8.0 63 4.5 64 1.5 65 3.0 66 3.0 67 1.5 68 0.5 69 0.5 70 1.0 71 0.5 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.0500000000000003 2 0.0 3 0.0 4 0.0 5 0.44999999999999996 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69887076537015 99.325 2 0.2258469259723965 0.44999999999999996 3 0.0752823086574655 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.1 0.0 0.0 0.0 0.0 102-103 0.125 0.0 0.0 0.0 0.0 104-105 0.15 0.0 0.0 0.0 0.0 106-107 0.175 0.0 0.0 0.0 0.0 108-109 0.2 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.55 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.1375 0.0 0.0 0.0 0.0 136-137 1.25 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031371 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59325 33.0 33.0 34.0 32.0 34.0 2 32.796 34.0 33.0 34.0 32.0 34.0 3 32.7865 34.0 33.0 34.0 32.0 34.0 4 32.73625 34.0 33.0 34.0 32.0 34.0 5 32.8225 34.0 33.0 34.0 32.0 34.0 6 36.98925 38.0 38.0 38.0 36.0 38.0 7 37.00925 38.0 38.0 38.0 37.0 38.0 8 37.0015 38.0 38.0 38.0 37.0 38.0 9 36.94475 38.0 38.0 38.0 36.0 38.0 10-14 36.981550000000006 38.0 38.0 38.0 36.6 38.0 15-19 36.90990000000001 38.0 38.0 38.0 36.2 38.0 20-24 36.955600000000004 38.0 38.0 38.0 36.8 38.0 25-29 36.90615 38.0 38.0 38.0 36.6 38.0 30-34 36.8779 38.0 38.0 38.0 36.4 38.0 35-39 36.49085 38.0 38.0 38.0 35.8 38.0 40-44 36.3535 38.0 38.0 38.0 35.6 38.0 45-49 36.7136 38.0 38.0 38.0 36.2 38.0 50-54 36.7635 38.0 38.0 38.0 36.0 38.0 55-59 36.7515 38.0 38.0 38.0 36.0 38.0 60-64 36.68344999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.66265 38.0 38.0 38.0 36.0 38.0 70-74 36.553650000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.4695 38.0 38.0 38.0 35.2 38.0 80-84 35.760949999999994 38.0 38.0 38.0 33.6 38.0 85-89 35.0103 38.0 38.0 38.0 30.2 38.0 90-94 35.12935 38.0 38.0 38.0 29.4 38.0 95-99 35.11875 38.0 38.0 38.0 29.4 38.0 100-104 35.73885 38.0 38.0 38.0 32.0 38.0 105-109 35.8344 38.0 38.0 38.0 32.8 38.0 110-114 35.7897 38.0 38.0 38.0 32.6 38.0 115-119 35.49075 38.0 37.6 38.0 31.4 38.0 120-124 35.290800000000004 38.0 37.4 38.0 30.6 38.0 125-129 34.61755000000001 38.0 36.8 38.0 27.2 38.0 130-134 33.1471 38.0 35.4 38.0 14.4 38.0 135-139 31.95695 38.0 33.0 38.0 2.0 38.0 140-144 31.584250000000004 38.0 33.0 38.0 2.0 38.0 145-149 31.21675 38.0 33.0 38.0 2.0 38.0 150 22.7855 30.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 3.0 5 5.0 6 2.0 7 3.0 8 4.0 9 5.0 10 8.0 11 2.0 12 5.0 13 9.0 14 4.0 15 4.0 16 8.0 17 4.0 18 6.0 19 9.0 20 8.0 21 17.0 22 14.0 23 36.0 24 29.0 25 33.0 26 20.0 27 53.0 28 43.0 29 51.0 30 55.0 31 73.0 32 65.0 33 135.0 34 101.0 35 207.0 36 425.0 37 2544.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.09001760120694 19.386472215237617 11.164194116167966 23.35931606738748 2 26.529588766298893 23.37011033099298 31.444332998996995 18.655967903711137 3 20.803011292346298 26.97616060225847 32.0702634880803 20.15056461731493 4 24.2728184553661 34.42828485456369 22.166499498495487 19.132397191574725 5 23.570712136409227 36.83550651955868 21.890672016048143 17.703109327983952 6 19.275000000000002 37.175000000000004 23.075000000000003 20.474999999999998 7 19.5 19.35 40.75 20.4 8 19.825 24.775 28.575 26.825 9 20.849999999999998 25.0 29.525000000000002 24.625 10-14 22.869999999999997 28.53 26.38 22.220000000000002 15-19 22.96 28.015 27.41 21.615000000000002 20-24 21.959999999999997 28.435 28.494999999999997 21.11 25-29 22.655 28.87 27.450000000000003 21.025 30-34 22.637923273145603 28.09983494222978 27.96478767568649 21.297454108938126 35-39 22.702238391187915 28.558435652569347 27.861149007124453 20.878176949118284 40-44 22.945587192218056 27.935961090282703 27.85996554868781 21.25848616881143 45-49 22.510518934081347 27.654778601482672 28.30094169505109 21.533760769384894 50-54 22.495 28.21 28.000000000000004 21.295 55-59 23.064999999999998 27.92 27.474999999999998 21.54 60-64 22.54 28.075 28.194999999999997 21.19 65-69 22.869999999999997 27.744999999999997 27.985 21.4 70-74 23.175 27.22 28.205000000000002 21.4 75-79 22.626495170411893 28.10169661178119 27.88148741304239 21.390320804764524 80-84 23.19600753679279 27.69771350002546 27.621327086622195 21.484951876559556 85-89 23.27357755261107 27.28500909327098 27.986489997401918 21.45492335671603 90-94 22.82373544864531 27.778922427114455 28.103430514062016 21.29391161017822 95-99 22.983124099608972 27.397612677505663 28.071619674830213 21.547643548055156 100-104 22.43638006324349 27.71169000652512 28.17848717562616 21.67344275460523 105-109 23.265 27.905 28.005000000000003 20.825 110-114 22.805 28.185 27.805000000000003 21.205 115-119 23.235 27.845 28.12 20.8 120-124 23.565 27.439999999999998 27.779999999999998 21.215 125-129 23.244724025974026 27.876420454545453 27.97280844155844 20.90604707792208 130-134 23.830278842619336 27.81599537887938 27.65320590243134 20.700519876069947 135-139 23.620356452651922 27.22782907451149 28.467897788275714 20.683916684560877 140-144 23.146971622193984 27.56776789495976 28.150148242270223 21.135112240576028 145-149 23.810244764067626 27.075447893010345 28.155437799646734 20.958869543275295 150 22.95288485764676 28.143109095490047 28.92416225749559 19.9798437893676 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.0 22 1.0 23 2.0 24 2.5 25 4.5 26 7.5 27 9.0 28 12.5 29 17.0 30 19.0 31 24.0 32 30.5 33 40.0 34 49.0 35 63.5 36 83.5 37 98.5 38 134.5 39 170.0 40 194.0 41 225.5 42 247.0 43 256.5 44 277.0 45 277.0 46 267.0 47 256.0 48 229.0 49 204.5 50 165.5 51 138.5 52 123.5 53 99.0 54 78.5 55 53.5 56 33.0 57 29.0 58 20.0 59 12.0 60 10.0 61 7.0 62 5.0 63 5.5 64 5.5 65 2.5 66 1.0 67 1.5 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.575 2 0.3 3 0.375 4 0.3 5 0.3 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 1.045 40-44 1.31 45-49 0.18 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.095 80-84 1.815 85-89 3.775 90-94 2.93 95-99 2.82 100-104 0.385 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.44 130-134 4.784999999999999 135-139 6.859999999999999 140-144 5.56 145-149 0.9249999999999999 150 0.775 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0125 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.075 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.225 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.3375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.5375 0.0 0.0 0.0 0.0 124-125 0.6625 0.0 0.0 0.0 0.0 126-127 0.7625 0.0 0.0 0.0 0.0 128-129 0.775 0.0 0.0 0.0 0.0 130-131 0.8625 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0375 0.0 0.0 0.0 0.0 136-137 1.1375000000000002 0.0 0.0 0.0 0.0 138 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193771 spots for SRR6031371.sra Written 1193771 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra Read 1193761 spots for SRR6031371.sra Written 1193761 spots for SRR6031371.sra SRR ids: ['SRR6031371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5y2m0knp SRR6031371.sra spots: 23875230 blocks: [[1, 1193761], [1193762, 2387522], [2387523, 3581283], [3581284, 4775044], [4775045, 5968805], [5968806, 7162566], [7162567, 8356327], [8356328, 9550088], [9550089, 10743849], [10743850, 11937610], [11937611, 13131371], [13131372, 14325132], [14325133, 15518893], [15518894, 16712654], [16712655, 17906415], [17906416, 19100176], [19100177, 20293937], [20293938, 21487698], [21487699, 22681459], [22681460, 23875230]] SRR6031371 file size 8022200 SRR6031371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031371 SRR6031371_1.fastq SRR6031371_2.fastq Input file: SRR6031371_1.fastq Paired file: SRR6031371_2.fastq trimmed: SRR6031371-trimmed-pair1.fastq, SRR6031371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 04:53:34 2025 >> started Fri Feb 14 04:54:02 2025 >> done (27.935s) 23875230 read pairs processed; of these: 39334 ( 0.16%) short read pairs filtered out after trimming by size control 36443 ( 0.15%) empty read pairs filtered out after trimming by size control 23799453 (99.68%) read pairs available; of these: 10464908 (43.97%) trimmed read pairs available after processing 13334545 (56.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 13 0.00% 20 15 0.00% 21 10 0.00% 22 19 0.00% 23 18 0.00% 24 17 0.00% 25 19 0.00% 26 12 0.00% 27 23 0.00% 28 20 0.00% 29 18 0.00% 30 30 0.00% 31 20 0.00% 32 18 0.00% 33 39 0.00% 34 26 0.00% 35 25 0.00% 36 30 0.00% 37 36 0.00% 38 35 0.00% 39 34 0.00% 40 43 0.00% 41 51 0.00% 42 58 0.00% 43 52 0.00% 44 61 0.00% 45 72 0.00% 46 79 0.00% 47 77 0.00% 48 77 0.00% 49 84 0.00% 50 102 0.00% 51 94 0.00% 52 104 0.00% 53 118 0.00% 54 104 0.00% 55 126 0.00% 56 137 0.00% 57 124 0.00% 58 144 0.00% 59 160 0.00% 60 173 0.00% 61 185 0.00% 62 180 0.00% 63 201 0.00% 64 204 0.00% 65 253 0.00% 66 310 0.00% 67 325 0.00% 68 509 0.00% 69 1160 0.00% 70 908 0.00% 71 542 0.00% 72 538 0.00% 73 587 0.00% 74 644 0.00% 75 664 0.00% 76 703 0.00% 77 790 0.00% 78 905 0.00% 79 971 0.00% 80 1115 0.00% 81 1335 0.01% 82 1461 0.01% 83 2121 0.01% 84 4727 0.02% 85 4712 0.02% 86 5045 0.02% 87 5163 0.02% 88 5271 0.02% 89 5202 0.02% 90 5388 0.02% 91 5531 0.02% 92 5586 0.02% 93 5826 0.02% 94 6361 0.03% 95 6498 0.03% 96 7095 0.03% 97 7697 0.03% 98 8873 0.04% 99 8046 0.03% 100 8391 0.04% 101 8995 0.04% 102 9642 0.04% 103 10123 0.04% 104 10683 0.04% 105 11239 0.05% 106 11817 0.05% 107 12344 0.05% 108 12907 0.05% 109 13326 0.06% 110 13660 0.06% 111 14378 0.06% 112 14957 0.06% 113 15652 0.07% 114 15771 0.07% 115 16952 0.07% 116 17594 0.07% 117 18392 0.08% 118 19109 0.08% 119 19958 0.08% 120 20953 0.09% 121 21980 0.09% 122 23074 0.10% 123 25124 0.11% 124 26574 0.11% 125 29314 0.12% 126 30581 0.13% 127 31488 0.13% 128 33648 0.14% 129 36237 0.15% 130 39102 0.16% 131 42229 0.18% 132 45621 0.19% 133 49266 0.21% 134 54219 0.23% 135 60001 0.25% 136 67501 0.28% 137 77405 0.33% 138 86092 0.36% 139 95490 0.40% 140 107280 0.45% 141 118241 0.50% 142 132822 0.56% 143 154985 0.65% 144 188206 0.79% 145 241674 1.02% 146 331600 1.39% 147 505933 2.13% 148 1057742 4.44% 149 6338483 26.63% 150 13334545 56.03% 23799453 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.19 fanout-score-rank=27 prefix-density=0.16 prefix-fanout=3.8 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGACCGCAAAGTCATTCGAAGCGGCTCCGATGATATAACGATCACCAGTTCTAACCTCATCACCGAAGACATCGATCACTGCTTCAGCATGAACGGCACGAGGAAATATTGAAGTTGCCGTGAAGGCAAAGAGAAGAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=445.52 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=39.9 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=4.86 fanout-score-rank=26 prefix-density=0.35 prefix-fanout=3.6 sequence=TCTCCTTTCTTCTCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=19 fanout-score=322.25 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=30.7 sequence=GAAGAAGAAGAAA SRR6031371 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 04:54:48 Started mapping on | Feb 14 04:54:49 Finished on | Feb 14 04:57:39 Mapping speed, Million of reads per hour | 503.99 Number of input reads | 23799453 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 22433370 Uniquely mapped reads % | 94.26% Average mapped length | 295.17 Number of splices: Total | 22516629 Number of splices: Annotated (sjdb) | 22159154 Number of splices: GT/AG | 22152643 Number of splices: GC/AG | 292649 Number of splices: AT/AC | 12636 Number of splices: Non-canonical | 58701 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.75 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 699771 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 22129 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.68% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 718988 718988 718988 N_multimapping 699771 699771 699771 N_noFeature 514482 22209519 623401 N_ambiguous 266582 951 151077 UnstrandedReadsAssigned:21652306 PositiveStrandReadsAssigned:222900 NegativeStrandReadsAssigned:21658892 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031371-trimmed-pair1.fastq SRR6031371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,799,453 reads, 21,554,756 reads pseudoaligned [quant] estimated average fragment length: 297.675 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,032 rounds 52401 SRR6031371.ke.tsv 34699 SRR6031371.se.tsv 87100 total ==> SRR6031371.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.33 368 9.6457 Potri.005G024800.1.v4.1 1035 738.325 146 8.92183 Potri.004G059700.1.v4.1 961 664.53 14 0.950522 Potri.007G009000.2.v4.1 1416 1119.33 1 0.0403081 Potri.003G141000.2.v4.1 2943 2646.33 565 9.63284 Potri.016G087400.1.v4.1 270 60.1228 1785 1339.52 Potri.015G069301.1.v4.1 564 282.291 0 0 Potri.010G195200.1.v4.1 1773 1476.33 56 1.71141 Potri.012G127500.1.v4.1 977 680.423 2834 187.919 ==> SRR6031371.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 374 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 551 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 28 SRR6031371 completed mapping pipeline successfully