Starting /dee2/code/volunteer_pipeline.sh SRR6031372 current disk space = 3086205145088 free memory = 1486915436 SRR6031372 SRAfilesize af56e62120454a811e3ec4495df2692e SRR6031372.sra SRR6031372.sra file validated SRR6031372 is paired end SRR6031372 is conventional basespace SRR6031372 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.65825 34.0 33.0 34.0 32.0 34.0 2 33.2885 34.0 33.0 34.0 32.0 34.0 3 33.387 34.0 33.0 34.0 33.0 34.0 4 33.33 34.0 33.0 34.0 33.0 34.0 5 33.2895 34.0 33.0 34.0 33.0 34.0 6 37.025 38.0 38.0 38.0 36.0 38.0 7 37.31625 38.0 38.0 38.0 37.0 38.0 8 37.44975 38.0 38.0 38.0 37.0 38.0 9 37.4605 38.0 38.0 38.0 37.0 38.0 10-14 37.41295 38.0 38.0 38.0 37.0 38.0 15-19 37.39815 38.0 38.0 38.0 37.0 38.0 20-24 37.4026 38.0 38.0 38.0 37.0 38.0 25-29 37.36065 38.0 38.0 38.0 37.0 38.0 30-34 37.3152 38.0 38.0 38.0 37.0 38.0 35-39 37.240899999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.06715 38.0 38.0 38.0 36.0 38.0 45-49 36.998549999999994 38.0 38.0 38.0 36.0 38.0 50-54 36.970150000000004 38.0 38.0 38.0 36.0 38.0 55-59 36.89785 38.0 38.0 38.0 35.6 38.0 60-64 36.919999999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.824999999999996 38.0 38.0 38.0 35.2 38.0 70-74 36.785199999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.7016 38.0 38.0 38.0 34.6 38.0 80-84 36.5954 38.0 38.0 38.0 34.2 38.0 85-89 36.565549999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.474450000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.34935 38.0 37.8 38.0 34.0 38.0 100-104 36.25625 38.0 38.0 38.0 34.0 38.0 105-109 36.034349999999996 38.0 37.0 38.0 33.2 38.0 110-114 35.969800000000006 38.0 37.0 38.0 32.8 38.0 115-119 35.77755 38.0 37.0 38.0 32.2 38.0 120-124 35.54344999999999 38.0 36.2 38.0 30.6 38.0 125-129 35.3718 38.0 36.0 38.0 30.6 38.0 130-134 35.08395 38.0 36.0 38.0 28.8 38.0 135-139 34.76455 38.0 35.4 38.0 28.0 38.0 140-144 34.31545 38.0 34.2 38.0 26.4 38.0 145-149 33.373400000000004 38.0 33.0 38.0 19.6 38.0 150 26.1535 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 2.0 12 0.0 13 1.0 14 1.0 15 0.0 16 1.0 17 5.0 18 3.0 19 4.0 20 4.0 21 7.0 22 7.0 23 11.0 24 9.0 25 14.0 26 19.0 27 27.0 28 33.0 29 41.0 30 52.0 31 67.0 32 70.0 33 101.0 34 152.0 35 235.0 36 635.0 37 2495.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.93142272262027 13.843398157625384 9.570112589559878 30.655066530194475 2 22.275 17.675 34.150000000000006 25.900000000000002 3 19.5 23.65 27.825 29.025000000000002 4 21.55 32.05 23.45 22.95 5 22.428499749121926 34.99749121926744 24.03411941796287 18.539889613647766 6 16.85 35.25 25.4 22.5 7 13.950000000000001 24.275 43.225 18.55 8 17.2 23.125 32.975 26.700000000000003 9 17.9 24.224999999999998 32.675 25.2 10-14 20.52 29.115000000000002 26.650000000000002 23.715 15-19 19.52 28.544999999999998 27.894999999999996 24.04 20-24 19.935 28.720000000000002 27.93 23.415 25-29 20.135 28.189999999999998 27.71 23.965 30-34 20.244999999999997 28.854999999999997 27.63 23.27 35-39 19.919999999999998 29.115000000000002 27.250000000000004 23.715 40-44 19.685 28.749999999999996 27.6 23.965 45-49 20.455000000000002 28.34 27.63 23.575 50-54 19.905 28.470000000000002 27.644999999999996 23.98 55-59 19.73 29.115000000000002 27.865000000000002 23.29 60-64 19.605 29.025000000000002 27.355 24.015 65-69 20.11 28.26 27.925 23.705000000000002 70-74 20.23 28.62 27.450000000000003 23.7 75-79 20.495 27.96 28.185 23.36 80-84 20.405 28.345 27.725 23.525 85-89 20.294999999999998 28.63 27.72 23.355 90-94 20.200000000000003 28.535 27.515 23.75 95-99 20.115 27.76 27.97 24.154999999999998 100-104 20.21 27.794999999999998 28.29 23.705000000000002 105-109 19.919999999999998 28.694999999999997 27.994999999999997 23.39 110-114 20.5 28.175 27.49 23.835 115-119 20.169999999999998 28.615000000000002 27.689999999999998 23.525 120-124 20.630000000000003 28.605000000000004 26.955000000000002 23.810000000000002 125-129 20.185 28.43 27.875 23.51 130-134 20.380000000000003 28.59 27.67 23.36 135-139 20.925 28.384999999999998 27.505000000000003 23.185 140-144 20.44 28.935 27.025 23.599999999999998 145-149 20.435 28.945 27.205000000000002 23.415 150 20.42147516307075 28.123432012042148 27.797290516808832 23.657802308078274 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 0.5 22 1.5 23 5.0 24 5.0 25 4.0 26 5.5 27 8.5 28 8.5 29 8.5 30 15.5 31 26.5 32 35.0 33 44.0 34 52.5 35 57.5 36 79.5 37 112.5 38 137.5 39 157.5 40 191.5 41 224.5 42 257.5 43 276.5 44 275.0 45 270.5 46 247.0 47 237.5 48 227.5 49 212.0 50 183.5 51 143.5 52 117.0 53 85.5 54 64.5 55 56.0 56 45.5 57 30.0 58 20.0 59 20.0 60 17.0 61 8.0 62 4.0 63 4.0 64 2.5 65 1.5 66 2.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.3 2 0.0 3 0.0 4 0.0 5 0.35000000000000003 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.35000000000000003 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37027707808565 98.625 2 0.5541561712846348 1.0999999999999999 3 0.05037783375314861 0.15 4 0.0 0.0 5 0.025188916876574305 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCAAAGTTCAGCGTCCCTTCATCTGACCCGAATTTCTTCCAATTCCAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.037500000000000006 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.30000000000000004 0.0 0.0 0.0 0.0 114-115 0.325 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.525 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.7124999999999999 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 1.0125 0.0 0.0 0.0 0.0 130-131 1.1625 0.0 0.0 0.0 0.0 132-133 1.3 0.0 0.0 0.0 0.0 134-135 1.5375 0.0 0.0 0.0 0.0 136-137 1.6625 0.0 0.0 0.0 0.0 138 1.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031372 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55325 33.0 33.0 34.0 32.0 34.0 2 32.769 33.0 33.0 34.0 32.0 34.0 3 32.7635 33.0 33.0 34.0 32.0 34.0 4 32.706 34.0 33.0 34.0 32.0 34.0 5 32.7555 34.0 33.0 34.0 32.0 34.0 6 36.88075 38.0 38.0 38.0 36.0 38.0 7 36.98875 38.0 38.0 38.0 37.0 38.0 8 36.956 38.0 38.0 38.0 36.0 38.0 9 36.89825 38.0 38.0 38.0 36.0 38.0 10-14 36.83905 38.0 38.0 38.0 36.0 38.0 15-19 36.80915 38.0 38.0 38.0 36.0 38.0 20-24 36.77055 38.0 38.0 38.0 36.0 38.0 25-29 36.78865 38.0 38.0 38.0 36.0 38.0 30-34 36.8466 38.0 38.0 38.0 36.0 38.0 35-39 36.449149999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.190999999999995 38.0 38.0 38.0 34.4 38.0 45-49 36.541250000000005 38.0 38.0 38.0 35.4 38.0 50-54 36.695949999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.574949999999994 38.0 38.0 38.0 35.4 38.0 60-64 36.5578 38.0 38.0 38.0 35.0 38.0 65-69 36.55105 38.0 38.0 38.0 35.2 38.0 70-74 36.45890000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.3463 38.0 38.0 38.0 34.6 38.0 80-84 35.660250000000005 38.0 38.0 38.0 33.4 38.0 85-89 34.95025 38.0 38.0 38.0 29.4 38.0 90-94 35.0595 38.0 38.0 38.0 29.2 38.0 95-99 34.95989999999999 38.0 38.0 38.0 29.0 38.0 100-104 35.5398 38.0 38.0 38.0 30.2 38.0 105-109 35.8463 38.0 38.0 38.0 33.4 38.0 110-114 35.6376 38.0 38.0 38.0 32.2 38.0 115-119 35.438300000000005 38.0 37.2 38.0 31.0 38.0 120-124 35.2213 38.0 37.0 38.0 30.2 38.0 125-129 34.42075 38.0 36.4 38.0 25.0 38.0 130-134 33.247 38.0 35.4 38.0 15.4 38.0 135-139 32.166999999999994 38.0 33.0 38.0 6.4 38.0 140-144 32.134949999999996 38.0 33.0 38.0 6.4 38.0 145-149 31.41455 38.0 33.0 38.0 2.0 38.0 150 23.96575 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 7.0 4 4.0 5 3.0 6 4.0 7 3.0 8 1.0 9 2.0 10 3.0 11 3.0 12 5.0 13 3.0 14 7.0 15 9.0 16 9.0 17 14.0 18 10.0 19 6.0 20 7.0 21 10.0 22 26.0 23 16.0 24 23.0 25 44.0 26 28.0 27 48.0 28 50.0 29 51.0 30 52.0 31 68.0 32 89.0 33 114.0 34 136.0 35 237.0 36 414.0 37 2487.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.0565424068051 21.015761821366024 11.883912934701026 25.04378283712785 2 26.200000000000003 25.650000000000002 30.275000000000002 17.875 3 21.099999999999998 27.750000000000004 31.3 19.85 4 24.224999999999998 34.4 22.5 18.875 5 22.900000000000002 37.724999999999994 21.975 17.4 6 19.825 37.775 24.375 18.025 7 19.400000000000002 19.125 40.8 20.674999999999997 8 21.325 24.65 27.85 26.174999999999997 9 20.65 24.425 28.925 26.0 10-14 22.615 27.99 26.97 22.425 15-19 22.945 28.125 28.015 20.915 20-24 22.955000000000002 27.6 28.64 20.805 25-29 22.675 28.095 28.46 20.77 30-34 22.84842726408961 28.45926889033355 27.699154873230984 20.99314897234585 35-39 22.854397410610428 27.86628230415213 28.60466292418955 20.674657361047892 40-44 22.7494164213945 28.285801278798335 28.427889982746375 20.536892317060794 45-49 23.248008816310172 27.92165506186445 28.43760957771878 20.392726544106598 50-54 22.895 28.52 27.935 20.65 55-59 23.41 27.125 28.225 21.240000000000002 60-64 22.93 27.889999999999997 28.449999999999996 20.73 65-69 22.96 27.83 28.01 21.2 70-74 23.44 27.76 28.07 20.73 75-79 23.21061858251941 27.39794640621087 28.2694715752567 21.121963436013022 80-84 23.305970529750674 27.915158313363587 28.312853719471782 20.46601743741396 85-89 23.197589860793684 28.459380843548722 27.56077290671099 20.782256388946603 90-94 22.72281570934613 28.49770346286835 27.883573308561697 20.895907519223822 95-99 23.159636062861868 28.298180314309345 27.734698097601324 20.807485525227463 100-104 23.458714673639747 27.61239062657146 28.336518153474806 20.59237654631399 105-109 23.865 27.310000000000002 28.08 20.745 110-114 23.485 27.91 28.244999999999997 20.36 115-119 23.865 27.915 27.32 20.9 120-124 24.07 27.79 27.584999999999997 20.555 125-129 23.586873569066398 28.140422284406004 27.479012973798017 20.793691172729588 130-134 23.590683067259878 27.99790630724941 27.762365872808164 20.649044752682542 135-139 24.25459022536267 27.4610566886141 27.862534125582144 20.42181896044109 140-144 23.410206343342658 28.217847907541294 28.45532745791335 19.9166182912027 145-149 23.743737665097917 27.97935327159557 28.156469814280655 20.12043924902586 150 24.230186774356387 28.01615345784957 28.142352347299344 19.6113074204947 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 2.0 21 3.0 22 3.0 23 2.0 24 1.5 25 8.0 26 10.0 27 9.0 28 12.5 29 16.5 30 19.5 31 23.5 32 31.5 33 40.0 34 52.0 35 68.0 36 88.5 37 119.5 38 142.5 39 174.5 40 207.5 41 231.5 42 253.0 43 254.0 44 260.5 45 266.5 46 262.0 47 252.5 48 239.0 49 207.0 50 158.5 51 129.5 52 109.5 53 84.5 54 66.0 55 49.0 56 36.5 57 27.0 58 21.0 59 14.0 60 11.5 61 11.0 62 5.0 63 5.0 64 3.0 65 1.0 66 1.0 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 1.135 40-44 1.47 45-49 0.185 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.17500000000000002 80-84 1.9349999999999998 85-89 3.74 90-94 3.115 95-99 3.2800000000000002 100-104 0.5700000000000001 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.725 130-134 4.475 135-139 6.595 140-144 5.255 145-149 1.195 150 0.95 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7077856420626896 1.4000000000000001 3 0.15166835187057634 0.44999999999999996 4 0.0 0.0 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGAAATGTTACCGACAAAGCTAGCCGTCCCTCTTCTAATTCTTCTCTTCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0125 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.0625 0.0 0.0 0.0 0.0 96-97 0.1125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.32499999999999996 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.375 0.0 0.0 0.0 0.0 118-119 0.44999999999999996 0.0 0.0 0.0 0.0 120-121 0.5 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.7875 0.0 0.0 0.0 0.0 128-129 0.925 0.0 0.0 0.0 0.0 130-131 1.0625 0.0 0.0 0.0 0.0 132-133 1.1875 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.5375 0.0 0.0 0.0 0.0 138 1.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTTCCA 10 0.0072657103 142.0375 1 >>END_MODULE Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195593 spots for SRR6031372.sra Written 1195593 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra Read 1195581 spots for SRR6031372.sra Written 1195581 spots for SRR6031372.sra SRR ids: ['SRR6031372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9oo4d3qk SRR6031372.sra spots: 23911632 blocks: [[1, 1195581], [1195582, 2391162], [2391163, 3586743], [3586744, 4782324], [4782325, 5977905], [5977906, 7173486], [7173487, 8369067], [8369068, 9564648], [9564649, 10760229], [10760230, 11955810], [11955811, 13151391], [13151392, 14346972], [14346973, 15542553], [15542554, 16738134], [16738135, 17933715], [17933716, 19129296], [19129297, 20324877], [20324878, 21520458], [21520459, 22716039], [22716040, 23911632]] SRR6031372 file size 8034464 SRR6031372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031372 SRR6031372_1.fastq SRR6031372_2.fastq Input file: SRR6031372_1.fastq Paired file: SRR6031372_2.fastq trimmed: SRR6031372-trimmed-pair1.fastq, SRR6031372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:20:44 2025 >> started Fri Feb 14 05:21:09 2025 >> done (25.520s) 23911632 read pairs processed; of these: 48056 ( 0.20%) short read pairs filtered out after trimming by size control 35698 ( 0.15%) empty read pairs filtered out after trimming by size control 23827878 (99.65%) read pairs available; of these: 12823748 (53.82%) trimmed read pairs available after processing 11004130 (46.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 8 0.00% 21 6 0.00% 22 11 0.00% 23 12 0.00% 24 10 0.00% 25 15 0.00% 26 19 0.00% 27 21 0.00% 28 24 0.00% 29 20 0.00% 30 18 0.00% 31 15 0.00% 32 19 0.00% 33 23 0.00% 34 9 0.00% 35 23 0.00% 36 18 0.00% 37 33 0.00% 38 33 0.00% 39 39 0.00% 40 44 0.00% 41 45 0.00% 42 53 0.00% 43 57 0.00% 44 61 0.00% 45 80 0.00% 46 82 0.00% 47 89 0.00% 48 98 0.00% 49 82 0.00% 50 99 0.00% 51 102 0.00% 52 107 0.00% 53 126 0.00% 54 139 0.00% 55 120 0.00% 56 121 0.00% 57 161 0.00% 58 158 0.00% 59 195 0.00% 60 202 0.00% 61 213 0.00% 62 212 0.00% 63 274 0.00% 64 288 0.00% 65 313 0.00% 66 323 0.00% 67 385 0.00% 68 492 0.00% 69 913 0.00% 70 1111 0.00% 71 885 0.00% 72 814 0.00% 73 710 0.00% 74 719 0.00% 75 809 0.00% 76 876 0.00% 77 1023 0.00% 78 1045 0.00% 79 1177 0.00% 80 1271 0.01% 81 1533 0.01% 82 1828 0.01% 83 2455 0.01% 84 5030 0.02% 85 5167 0.02% 86 5393 0.02% 87 5611 0.02% 88 5688 0.02% 89 5908 0.02% 90 6079 0.03% 91 6194 0.03% 92 6359 0.03% 93 6872 0.03% 94 7175 0.03% 95 7761 0.03% 96 8425 0.04% 97 9459 0.04% 98 10160 0.04% 99 9692 0.04% 100 10256 0.04% 101 10970 0.05% 102 11690 0.05% 103 12487 0.05% 104 13468 0.06% 105 14339 0.06% 106 14774 0.06% 107 15498 0.07% 108 16307 0.07% 109 17460 0.07% 110 18266 0.08% 111 19178 0.08% 112 19991 0.08% 113 21343 0.09% 114 22283 0.09% 115 23583 0.10% 116 24894 0.10% 117 25975 0.11% 118 27394 0.11% 119 29066 0.12% 120 30424 0.13% 121 32864 0.14% 122 34625 0.15% 123 37204 0.16% 124 40726 0.17% 125 44636 0.19% 126 46349 0.19% 127 48044 0.20% 128 49519 0.21% 129 52591 0.22% 130 55689 0.23% 131 58697 0.25% 132 63537 0.27% 133 68437 0.29% 134 74200 0.31% 135 80500 0.34% 136 88021 0.37% 137 98567 0.41% 138 109408 0.46% 139 119272 0.50% 140 132125 0.55% 141 145581 0.61% 142 165298 0.69% 143 195603 0.82% 144 242638 1.02% 145 314342 1.32% 146 437930 1.84% 147 679494 2.85% 148 1424133 5.98% 149 7350818 30.85% 150 11004130 46.18% 23827878 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=31 prefix-density=0.30 prefix-fanout=2.1 sequence=AATCCTGGATTTGCTTCACCTGCTACATTGGAAGCACCTCGGATCACGATGAATGGCTTTTCATTTGATAAAGATGTCCAAGCTACAGCAGCGCTTTCTTGATCGGCAGTTGAGACGTTAAAAACTTTGTGAAGGAAATCTCCATATGCTTTATTTTTAATGTAAGAATCAGAACTAGAGCCGTTAGTTCCAAACACAATCTTAGGCTTGGAAGGTAGGCAAGCTCTATCGTAGCATTGTCTCAACTCCAAATCCTGAAGCACTTGAGTGGCAGCACTATACCAGGATGTTGTGCTGGGAAACCAGAAAACATCCTGCGGTGATTGTCCTTTAGAGAACAATTTTATTTTATCATAGTCTACGCTAGCCAACAAGTTCTCTCCGTTCACTGGATAATTAAACTCGCCAAAGTTCAGCGTCCCTTCATCTGACCCGAATTTCTTCCAATTCCAAGCTCCTGTGAAAGCAACAGCAAGCGGCACGGAAACATCACCTGGCACTATACTTTCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=17 fanout-score=373.40 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=36.1 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.57 fanout-score-rank=20 prefix-density=0.38 prefix-fanout=2.2 sequence=TTAACTTCTGGTAACAACGAAAAGGCCCTTCAAGACTCTGGTCTCTTCACACCTGATGCTGAAACGCCTTATGTTGACATTGCGGGGAGAAGGTTCCACATTGGGACACTTAATGCTCGTTATATTGTATATGTTAAGATCGGGGGAAATTCTGTAAATGCTGCCATTGCTGTGCAAATCCTCTTGAATAGATTCCGTATTCATGGAATTATTCACTTTGGTAGTGCTGGGAGCCTTGATAAAGAAAGTATAGTGCCAGGTGATGTTTCCGTGCCGCTTGCTGTTGCTTTCACAGGAGCTTGGAATTGGAAGAAATTCGGGTCAGATGAAGGGACGCTGAACTTTGGCGAGTTTAATTATCCAGTGAACGGAGAGAACTTGTTGGCTAGCGTAGACTATGATAAAATAAAATTGTTCTCTAAAGGACAATCACCGCAGGATGTTTTCTGGTTTCCCAGCACAACATCCTGGTATAGTGCTGCCACTCAAGTGCTTCAGGATTTGGAGTTGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=18 fanout-score=43.22 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=9.5 sequence=AGCAATGGCAGC SRR6031372 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:21:51 Started mapping on | Feb 14 05:21:51 Finished on | Feb 14 05:25:06 Mapping speed, Million of reads per hour | 439.90 Number of input reads | 23827878 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 22294073 Uniquely mapped reads % | 93.56% Average mapped length | 293.97 Number of splices: Total | 21382932 Number of splices: Annotated (sjdb) | 21023817 Number of splices: GT/AG | 21031399 Number of splices: GC/AG | 282754 Number of splices: AT/AC | 13291 Number of splices: Non-canonical | 55488 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 837768 % of reads mapped to multiple loci | 3.52% Number of reads mapped to too many loci | 22084 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.80% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 749483 749483 749483 N_multimapping 837768 837768 837768 N_noFeature 539728 22053033 656928 N_ambiguous 290884 1437 166074 UnstrandedReadsAssigned:21463461 PositiveStrandReadsAssigned:239603 NegativeStrandReadsAssigned:21471071 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031372-trimmed-pair1.fastq SRR6031372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,827,878 reads, 21,428,342 reads pseudoaligned [quant] estimated average fragment length: 288.38 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,095 rounds 52401 SRR6031372.ke.tsv 34699 SRR6031372.se.tsv 87100 total ==> SRR6031372.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1730.62 526 13.567 Potri.005G024800.1.v4.1 1035 747.62 125 7.46329 Potri.004G059700.1.v4.1 961 673.787 11 0.728738 Potri.007G009000.2.v4.1 1416 1128.62 1 0.0395506 Potri.003G141000.2.v4.1 2943 2655.62 637.437 10.7145 Potri.016G087400.1.v4.1 270 63.5514 1611 1131.55 Potri.015G069301.1.v4.1 564 289.813 0 0 Potri.010G195200.1.v4.1 1773 1485.62 89 2.67414 Potri.012G127500.1.v4.1 977 689.726 2191 141.797 ==> SRR6031372.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 178 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 338 Potri.001G212900.v4.1 101 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR6031372 completed mapping pipeline successfully