Starting /dee2/code/volunteer_pipeline.sh SRR6031374 current disk space = 3085506752512 free memory = 1582418192 SRR6031374 SRAfilesize f2475e8c68043cd35d23850e4e9a27b7 SRR6031374.sra SRR6031374.sra file validated SRR6031374 is paired end SRR6031374 is conventional basespace SRR6031374 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031374_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00475 34.0 33.0 34.0 33.0 34.0 2 33.397 34.0 34.0 34.0 33.0 34.0 3 33.4405 34.0 34.0 34.0 33.0 34.0 4 33.40025 34.0 34.0 34.0 33.0 34.0 5 33.4265 34.0 34.0 34.0 33.0 34.0 6 37.1885 38.0 38.0 38.0 36.0 38.0 7 37.448 38.0 38.0 38.0 37.0 38.0 8 37.53475 38.0 38.0 38.0 37.0 38.0 9 37.55175 38.0 38.0 38.0 38.0 38.0 10-14 37.5307 38.0 38.0 38.0 38.0 38.0 15-19 37.52615 38.0 38.0 38.0 38.0 38.0 20-24 37.52265 38.0 38.0 38.0 38.0 38.0 25-29 37.44455000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.45345 38.0 38.0 38.0 38.0 38.0 35-39 37.41895000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.2663 38.0 38.0 38.0 37.0 38.0 45-49 37.1775 38.0 38.0 38.0 36.8 38.0 50-54 37.14445 38.0 38.0 38.0 36.8 38.0 55-59 37.111149999999995 38.0 38.0 38.0 36.4 38.0 60-64 37.033 38.0 38.0 38.0 36.0 38.0 65-69 36.999399999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.96509999999999 38.0 38.0 38.0 36.0 38.0 75-79 36.97935 38.0 38.0 38.0 36.0 38.0 80-84 36.86735 38.0 38.0 38.0 35.8 38.0 85-89 36.8504 38.0 38.0 38.0 35.6 38.0 90-94 36.745400000000004 38.0 38.0 38.0 35.0 38.0 95-99 36.652300000000004 38.0 38.0 38.0 35.0 38.0 100-104 36.5333 38.0 38.0 38.0 34.6 38.0 105-109 36.3985 38.0 38.0 38.0 34.0 38.0 110-114 36.2795 38.0 38.0 38.0 34.0 38.0 115-119 36.18265 38.0 38.0 38.0 34.0 38.0 120-124 36.055899999999994 38.0 37.6 38.0 33.6 38.0 125-129 35.85215 38.0 37.2 38.0 33.0 38.0 130-134 35.65675 38.0 37.0 38.0 31.4 38.0 135-139 35.4443 38.0 36.4 38.0 31.0 38.0 140-144 35.0899 38.0 36.0 38.0 30.0 38.0 145-149 34.3732 38.0 35.4 38.0 26.8 38.0 150 28.60725 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 2.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 2.0 13 1.0 14 0.0 15 3.0 16 1.0 17 1.0 18 7.0 19 1.0 20 2.0 21 5.0 22 4.0 23 9.0 24 12.0 25 7.0 26 9.0 27 24.0 28 24.0 29 30.0 30 29.0 31 50.0 32 75.0 33 73.0 34 130.0 35 222.0 36 452.0 37 2821.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.720182324639154 15.598885793871867 7.191694099772095 32.48923778171689 2 22.0 17.75 34.1 26.150000000000002 3 17.349999999999998 25.124999999999996 28.575 28.95 4 22.85 32.65 23.425 21.075 5 20.876095118898625 35.644555694618276 24.505632040050063 18.973717146433042 6 16.7 36.0 25.35 21.95 7 13.950000000000001 23.5 43.525000000000006 19.025 8 15.7 22.95 32.725 28.625 9 17.375 23.325000000000003 33.4 25.900000000000002 10-14 19.650000000000002 29.49 27.46 23.400000000000002 15-19 19.6 27.55 28.655 24.195 20-24 19.63 28.82 27.57 23.98 25-29 19.32 29.17 27.935 23.575 30-34 19.605 28.53 28.025 23.84 35-39 19.485 28.775000000000002 28.01 23.73 40-44 19.685 29.085 27.77 23.46 45-49 19.115 28.775000000000002 27.97 24.14 50-54 19.605 28.475 28.09 23.830000000000002 55-59 19.755 28.1 28.71 23.435 60-64 19.88 28.1 28.310000000000002 23.71 65-69 19.655 28.16 28.01 24.175 70-74 19.61 28.720000000000002 28.155 23.515 75-79 19.465 28.38 28.215 23.94 80-84 19.895 28.265 28.125 23.715 85-89 19.855 29.21 27.43 23.505000000000003 90-94 20.025000000000002 27.905 28.265 23.805 95-99 20.150000000000002 28.035 28.410000000000004 23.405 100-104 19.605 28.265 28.29 23.84 105-109 20.495 28.075 27.865000000000002 23.565 110-114 19.705000000000002 28.08 27.62 24.595 115-119 19.99 28.360000000000003 28.125 23.525 120-124 19.919999999999998 28.720000000000002 28.03 23.330000000000002 125-129 20.29 27.800000000000004 27.57 24.34 130-134 20.225 28.07 27.875 23.830000000000002 135-139 20.225 27.584999999999997 28.084999999999997 24.104999999999997 140-144 20.565 28.01 27.68 23.745 145-149 20.07 28.000000000000004 27.76 24.169999999999998 150 20.52052052052052 28.703703703703702 27.102102102102105 23.673673673673672 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 1.5 22 2.5 23 4.5 24 5.0 25 3.0 26 6.0 27 11.5 28 13.0 29 18.5 30 26.5 31 32.5 32 37.0 33 44.0 34 56.5 35 85.5 36 97.0 37 103.0 38 135.5 39 156.5 40 194.0 41 227.5 42 246.5 43 267.0 44 283.0 45 276.0 46 260.0 47 254.5 48 235.5 49 191.0 50 146.0 51 121.0 52 99.5 53 78.0 54 67.0 55 60.0 56 36.0 57 27.0 58 28.5 59 19.0 60 8.5 61 5.0 62 5.0 63 3.5 64 6.0 65 6.0 66 2.0 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.275 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 1.0125 0.0 0.0 0.0 0.0 128-129 1.1625 0.0 0.0 0.0 0.0 130-131 1.275 0.0 0.0 0.0 0.0 132-133 1.35 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.6125 0.0 0.0 0.0 0.0 138 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATAAA 10 0.006973645 144.0 8 >>END_MODULE SRR6031374 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031374_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.66475 33.0 33.0 34.0 32.0 34.0 2 32.80625 34.0 33.0 34.0 32.0 34.0 3 32.74625 34.0 33.0 34.0 32.0 34.0 4 32.657 34.0 33.0 34.0 32.0 34.0 5 32.652 34.0 33.0 34.0 32.0 34.0 6 36.961 38.0 38.0 38.0 36.0 38.0 7 36.9695 38.0 38.0 38.0 37.0 38.0 8 36.938 38.0 38.0 38.0 36.0 38.0 9 36.95875 38.0 38.0 38.0 36.0 38.0 10-14 36.931799999999996 38.0 38.0 38.0 36.0 38.0 15-19 36.89295 38.0 38.0 38.0 36.0 38.0 20-24 36.93235 38.0 38.0 38.0 36.4 38.0 25-29 36.94105 38.0 38.0 38.0 37.0 38.0 30-34 36.91795 38.0 38.0 38.0 36.4 38.0 35-39 36.7888 38.0 38.0 38.0 36.4 38.0 40-44 36.57325 38.0 38.0 38.0 36.0 38.0 45-49 36.8058 38.0 38.0 38.0 36.0 38.0 50-54 36.83045 38.0 38.0 38.0 36.0 38.0 55-59 36.80625 38.0 38.0 38.0 36.0 38.0 60-64 36.7405 38.0 38.0 38.0 36.0 38.0 65-69 36.6505 38.0 38.0 38.0 36.0 38.0 70-74 36.59975 38.0 38.0 38.0 35.4 38.0 75-79 36.591249999999995 38.0 38.0 38.0 35.8 38.0 80-84 36.27745 38.0 38.0 38.0 35.0 38.0 85-89 35.7798 38.0 38.0 38.0 33.8 38.0 90-94 35.75055 38.0 38.0 38.0 33.4 38.0 95-99 35.7191 38.0 38.0 38.0 33.8 38.0 100-104 36.0638 38.0 38.0 38.0 33.8 38.0 105-109 36.12015 38.0 38.0 38.0 34.0 38.0 110-114 35.95175 38.0 38.0 38.0 34.0 38.0 115-119 35.856500000000004 38.0 38.0 38.0 33.6 38.0 120-124 35.64085 38.0 38.0 38.0 32.4 38.0 125-129 35.24065 38.0 37.4 38.0 30.4 38.0 130-134 34.3483 38.0 36.4 38.0 24.6 38.0 135-139 33.5989 38.0 36.0 38.0 15.8 38.0 140-144 33.505849999999995 38.0 35.8 38.0 14.6 38.0 145-149 33.111749999999994 38.0 35.6 38.0 8.8 38.0 150 27.085 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 5.0 4 1.0 5 3.0 6 4.0 7 1.0 8 1.0 9 1.0 10 2.0 11 1.0 12 5.0 13 3.0 14 8.0 15 6.0 16 8.0 17 4.0 18 4.0 19 4.0 20 8.0 21 8.0 22 15.0 23 18.0 24 32.0 25 19.0 26 27.0 27 43.0 28 41.0 29 37.0 30 45.0 31 47.0 32 67.0 33 93.0 34 107.0 35 176.0 36 348.0 37 2797.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.402610441767074 22.690763052208833 10.16566265060241 22.740963855421686 2 26.569563033651434 24.183827222501257 31.29080863887494 17.955801104972377 3 20.316423907584127 28.327473631341032 32.82270215971874 18.533400301356103 4 23.21608040201005 33.994974874371856 23.492462311557787 19.2964824120603 5 24.07035175879397 37.96482412060301 21.55778894472362 16.407035175879397 6 19.5 39.074999999999996 23.400000000000002 18.025 7 19.32983245811453 19.379844961240313 40.78519629907477 20.505126281570394 8 20.225 22.95 28.749999999999996 28.075 9 21.15 25.424999999999997 28.475 24.95 10-14 23.724744948989798 28.34066813362672 26.755351070214044 21.179235847169434 15-19 23.52117605880294 28.331416570828544 27.546377318865943 20.601030051502576 20-24 23.587358735873586 28.312831283128315 27.652765276527653 20.447044704470446 25-29 22.795698924731184 28.132033008252062 28.27706926731683 20.795198799699925 30-34 23.153473020953143 27.99419912986948 28.064209631444715 20.78811821773266 35-39 23.361623060312358 28.177572440114496 27.745693767890323 20.71511073168282 40-44 23.424285138944825 27.874546919049536 28.322593636729763 20.378574305275876 45-49 23.0026031237485 28.023628354024833 27.888466159391267 21.085302362835403 50-54 23.65354803220483 27.86417962694404 27.784167625143773 20.698104715707355 55-59 22.845711427856966 28.132033008252062 28.257064266066518 20.765191297824455 60-64 23.108466269940493 27.909186377956697 28.199229884482673 20.783117467620144 65-69 23.234646929385878 27.50550110022004 28.740748149629923 20.519103820764155 70-74 24.143621543231486 28.134220133019955 27.2890933640046 20.433064959743962 75-79 23.06615330766538 28.48642432121606 28.381419070953545 20.066003300165008 80-84 23.704114562323518 27.7228721258572 27.914481645824928 20.658531665994353 85-89 23.63367044641945 28.184697108999895 27.852691796914904 20.328940647665746 90-94 23.845409644075563 27.582870818269768 28.34156525281328 20.230154284841387 95-99 23.122328516181557 28.97923875432526 27.79360879299817 20.104823936495013 100-104 23.923277243589745 27.804487179487182 27.944711538461537 20.32752403846154 105-109 23.41351202680402 28.5042756413462 27.659148872330853 20.42306345951893 110-114 22.88843326498975 28.379256888533277 27.41911286693004 21.313196979546934 115-119 23.36817886260191 28.089831441004353 28.13484719651878 20.407142499874954 120-124 23.52705811743523 27.848354506351907 28.233470041012303 20.39111733520056 125-129 24.333568051503875 28.110854038829093 27.81913288401569 19.736445025651342 130-134 23.650940487203208 27.860006167129203 28.02960222016651 20.45945112550108 135-139 24.01858425558572 28.534140739193987 27.818960116934644 19.628314888285654 140-144 23.998343513821307 28.388031887358938 27.875556475825654 19.738068122994097 145-149 23.85473176612417 28.054048623668876 27.72252360859956 20.368696001607393 150 24.083375188347564 29.105976896032143 27.850326469110996 18.960321446509294 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 0.5 24 3.5 25 6.0 26 7.5 27 9.0 28 14.0 29 17.5 30 21.5 31 25.0 32 31.5 33 44.5 34 52.5 35 63.0 36 82.0 37 105.0 38 139.0 39 175.0 40 205.0 41 228.5 42 242.5 43 259.0 44 273.0 45 269.0 46 262.5 47 259.0 48 231.0 49 199.5 50 173.0 51 134.0 52 110.5 53 90.0 54 64.5 55 46.5 56 37.0 57 35.5 58 21.5 59 13.5 60 14.5 61 10.5 62 5.0 63 3.0 64 3.5 65 4.0 66 2.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.44999999999999996 3 0.44999999999999996 4 0.5 5 0.5 6 0.0 7 0.025 8 0.0 9 0.0 10-14 0.02 15-19 0.005 20-24 0.01 25-29 0.025 30-34 0.015 35-39 0.43499999999999994 40-44 0.6799999999999999 45-49 0.12 50-54 0.015 55-59 0.025 60-64 0.015 65-69 0.02 70-74 0.015 75-79 0.005 80-84 0.84 85-89 2.11 90-94 1.805 95-99 1.7399999999999998 100-104 0.16 105-109 0.015 110-114 0.015 115-119 0.034999999999999996 120-124 0.03 125-129 0.59 130-134 2.71 135-139 4.22 140-144 3.4099999999999997 145-149 0.45999999999999996 150 0.44999999999999996 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6625 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9874999999999999 0.0 0.0 0.0 0.0 128-129 1.1124999999999998 0.0 0.0 0.0 0.0 130-131 1.2000000000000002 0.0 0.0 0.0 0.0 132-133 1.2625 0.0 0.0 0.0 0.0 134-135 1.325 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940887 spots for SRR6031374.sra Written 940887 spots for SRR6031374.sra Read 940904 spots for SRR6031374.sra Written 940904 spots for SRR6031374.sra SRR ids: ['SRR6031374.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3iadhoww SRR6031374.sra spots: 18817757 blocks: [[1, 940887], [940888, 1881774], [1881775, 2822661], [2822662, 3763548], [3763549, 4704435], [4704436, 5645322], [5645323, 6586209], [6586210, 7527096], [7527097, 8467983], [8467984, 9408870], [9408871, 10349757], [10349758, 11290644], [11290645, 12231531], [12231532, 13172418], [13172419, 14113305], [14113306, 15054192], [15054193, 15995079], [15995080, 16935966], [16935967, 17876853], [17876854, 18817757]] SRR6031374 file size 6318266 SRR6031374 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031374 SRR6031374_1.fastq SRR6031374_2.fastq Input file: SRR6031374_1.fastq Paired file: SRR6031374_2.fastq trimmed: SRR6031374-trimmed-pair1.fastq, SRR6031374-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:05:26 2025 >> started Fri Feb 14 06:05:47 2025 >> done (20.765s) 18817757 read pairs processed; of these: 33090 ( 0.18%) short read pairs filtered out after trimming by size control 44245 ( 0.24%) empty read pairs filtered out after trimming by size control 18740422 (99.59%) read pairs available; of these: 6876126 (36.69%) trimmed read pairs available after processing 11864296 (63.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 7 0.00% 20 13 0.00% 21 6 0.00% 22 9 0.00% 23 12 0.00% 24 18 0.00% 25 13 0.00% 26 8 0.00% 27 10 0.00% 28 20 0.00% 29 12 0.00% 30 14 0.00% 31 10 0.00% 32 19 0.00% 33 13 0.00% 34 17 0.00% 35 22 0.00% 36 16 0.00% 37 20 0.00% 38 24 0.00% 39 23 0.00% 40 33 0.00% 41 36 0.00% 42 37 0.00% 43 29 0.00% 44 43 0.00% 45 42 0.00% 46 51 0.00% 47 45 0.00% 48 39 0.00% 49 60 0.00% 50 65 0.00% 51 71 0.00% 52 52 0.00% 53 77 0.00% 54 84 0.00% 55 102 0.00% 56 88 0.00% 57 125 0.00% 58 115 0.00% 59 123 0.00% 60 104 0.00% 61 138 0.00% 62 171 0.00% 63 184 0.00% 64 191 0.00% 65 199 0.00% 66 252 0.00% 67 248 0.00% 68 343 0.00% 69 577 0.00% 70 620 0.00% 71 430 0.00% 72 401 0.00% 73 435 0.00% 74 473 0.00% 75 548 0.00% 76 589 0.00% 77 572 0.00% 78 673 0.00% 79 804 0.00% 80 844 0.00% 81 986 0.01% 82 1207 0.01% 83 1520 0.01% 84 3546 0.02% 85 3604 0.02% 86 3804 0.02% 87 3707 0.02% 88 3948 0.02% 89 4069 0.02% 90 4120 0.02% 91 4242 0.02% 92 4695 0.03% 93 4786 0.03% 94 5016 0.03% 95 5058 0.03% 96 5498 0.03% 97 6076 0.03% 98 8019 0.04% 99 6343 0.03% 100 6801 0.04% 101 7078 0.04% 102 7516 0.04% 103 7934 0.04% 104 8476 0.05% 105 9093 0.05% 106 9454 0.05% 107 9847 0.05% 108 10215 0.05% 109 10808 0.06% 110 11092 0.06% 111 11601 0.06% 112 12230 0.07% 113 12912 0.07% 114 13664 0.07% 115 14235 0.08% 116 14976 0.08% 117 15356 0.08% 118 16192 0.09% 119 16728 0.09% 120 17254 0.09% 121 18025 0.10% 122 19254 0.10% 123 20134 0.11% 124 21467 0.11% 125 23745 0.13% 126 24530 0.13% 127 25309 0.14% 128 26326 0.14% 129 27669 0.15% 130 29087 0.16% 131 31452 0.17% 132 33151 0.18% 133 35918 0.19% 134 38968 0.21% 135 41659 0.22% 136 45779 0.24% 137 51518 0.27% 138 57570 0.31% 139 61395 0.33% 140 68085 0.36% 141 75413 0.40% 142 82829 0.44% 143 95585 0.51% 144 114668 0.61% 145 141402 0.75% 146 192645 1.03% 147 297914 1.59% 148 605747 3.23% 149 4234751 22.60% 150 11864296 63.31% 18740422 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=27 prefix-density=0.22 prefix-fanout=2.0 sequence=ACAGCCTGCGGCAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=167.05 fanout-score-rank=1 prefix-density=0.66 prefix-fanout=18.1 sequence=CCACCACCACCATATCTTGCCTGGCATCCAATGAAGGTGCCATGTAGGCGCGCATATCAGGATTTTCCTTCAACATGTCCTCGGTCAAGTAGATGTACCGCTTCTTGATCATGGACTTCTCGCACATTCGCTTGAATTTTTCTTTAAGTTCCGCCCTATGCTCACTGTTTGTGACGCGAAAGTAGTAGTCAGGGTAGGTGCTTTGATCAACACAGTTCGGAGGGTTTGATGTTCCAATGGCCATGATCGTGGCAGGACCCTCTGCCCGTTGCCCCTTCCGAACCTCATCGACGGTCACCATTTTTCCCGGGCCGGAAAGAACAAGGAAACTAACTCAGAGAGCTAGATATCGGTGGTGAAGTTATGG criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=36 prefix-density=0.16 prefix-fanout=2.0 sequence=AAGCGCTCAAGGATATGAAGTTAAGAAAATGCTATTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=386.98 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=33.7 sequence=AAGAAGAAGAAA SRR6031374 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:06:30 Started mapping on | Feb 14 06:06:30 Finished on | Feb 14 06:08:04 Mapping speed, Million of reads per hour | 717.72 Number of input reads | 18740422 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 17821171 Uniquely mapped reads % | 95.09% Average mapped length | 295.66 Number of splices: Total | 17561183 Number of splices: Annotated (sjdb) | 17208022 Number of splices: GT/AG | 17225772 Number of splices: GC/AG | 288051 Number of splices: AT/AC | 15629 Number of splices: Non-canonical | 31731 Mismatch rate per base, % | 0.20% Deletion rate per base | 0.02% Deletion average length | 2.88 Insertion rate per base | 0.02% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 437195 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 26626 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.39% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 515963 515963 515963 N_multimapping 437195 437195 437195 N_noFeature 669479 17645687 754865 N_ambiguous 186506 937 95874 UnstrandedReadsAssigned:16965186 PositiveStrandReadsAssigned:174547 NegativeStrandReadsAssigned:16970432 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031374 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031374-trimmed-pair1.fastq SRR6031374-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,740,422 reads, 17,096,110 reads pseudoaligned [quant] estimated average fragment length: 280.37 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,073 rounds 52401 SRR6031374.ke.tsv 34699 SRR6031374.se.tsv 87100 total ==> SRR6031374.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.63 790 25.9129 Potri.005G024800.1.v4.1 1035 755.63 608 45.8871 Potri.004G059700.1.v4.1 961 681.79 27 2.25844 Potri.007G009000.2.v4.1 1416 1136.63 0 0 Potri.003G141000.2.v4.1 2943 2663.63 736.538 15.7695 Potri.016G087400.1.v4.1 270 62.9342 1334 1208.83 Potri.015G069301.1.v4.1 564 295.028 0 0 Potri.010G195200.1.v4.1 1773 1493.63 225.697 8.61744 Potri.012G127500.1.v4.1 977 697.714 1075 87.8673 ==> SRR6031374.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 97 Potri.001G233950.v4.1 4 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 281 SRR6031374 completed mapping pipeline successfully