Starting /dee2/code/volunteer_pipeline.sh SRR6031375 current disk space = 3086105153536 free memory = 1467792092 SRR6031375 SRAfilesize cb4ecfcf8acce80505ebafa460113e92 SRR6031375.sra SRR6031375.sra file validated SRR6031375 is paired end SRR6031375 is conventional basespace SRR6031375 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031375_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.299 34.0 33.0 34.0 33.0 34.0 2 33.386 34.0 34.0 34.0 33.0 34.0 3 33.46625 34.0 34.0 34.0 33.0 34.0 4 33.4375 34.0 34.0 34.0 33.0 34.0 5 33.46225 34.0 34.0 34.0 33.0 34.0 6 37.164 38.0 38.0 38.0 36.0 38.0 7 37.3785 38.0 38.0 38.0 37.0 38.0 8 37.46725 38.0 38.0 38.0 37.0 38.0 9 37.48975 38.0 38.0 38.0 37.0 38.0 10-14 37.443000000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.47125 38.0 38.0 38.0 37.8 38.0 20-24 37.502500000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.4269 38.0 38.0 38.0 37.6 38.0 30-34 37.39234999999999 38.0 38.0 38.0 37.0 38.0 35-39 37.3367 38.0 38.0 38.0 37.0 38.0 40-44 37.10835 38.0 38.0 38.0 36.2 38.0 45-49 37.0862 38.0 38.0 38.0 36.0 38.0 50-54 37.05585 38.0 38.0 38.0 36.0 38.0 55-59 37.0269 38.0 38.0 38.0 36.0 38.0 60-64 37.03445000000001 38.0 38.0 38.0 36.0 38.0 65-69 36.95355 38.0 38.0 38.0 36.0 38.0 70-74 36.86905 38.0 38.0 38.0 35.6 38.0 75-79 36.8677 38.0 38.0 38.0 35.8 38.0 80-84 36.7752 38.0 38.0 38.0 35.0 38.0 85-89 36.743550000000006 38.0 38.0 38.0 35.0 38.0 90-94 36.666700000000006 38.0 38.0 38.0 34.8 38.0 95-99 36.6241 38.0 38.0 38.0 34.6 38.0 100-104 36.47475 38.0 38.0 38.0 34.0 38.0 105-109 36.35495 38.0 38.0 38.0 34.0 38.0 110-114 36.243900000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.1045 38.0 37.8 38.0 33.4 38.0 120-124 35.82845 38.0 37.2 38.0 32.2 38.0 125-129 35.72465 38.0 37.0 38.0 32.0 38.0 130-134 35.51025 38.0 36.4 38.0 31.0 38.0 135-139 35.3691 38.0 36.2 38.0 30.6 38.0 140-144 34.98909999999999 38.0 36.0 38.0 28.8 38.0 145-149 34.30285 38.0 35.6 38.0 26.6 38.0 150 28.3015 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 0.0 15 2.0 16 3.0 17 3.0 18 3.0 19 3.0 20 3.0 21 5.0 22 8.0 23 12.0 24 14.0 25 13.0 26 26.0 27 18.0 28 28.0 29 30.0 30 39.0 31 57.0 32 58.0 33 93.0 34 117.0 35 184.0 36 482.0 37 2796.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.43466265362428 13.669425633308252 9.480812641083523 35.415099071983946 2 21.775 18.3 35.375 24.55 3 19.900000000000002 25.4 27.125 27.575 4 22.400000000000002 31.5 23.075000000000003 23.025000000000002 5 20.599999999999998 36.075 24.45 18.875 6 18.675 35.225 25.85 20.25 7 13.350000000000001 22.650000000000002 45.425 18.575 8 17.150000000000002 21.65 31.974999999999998 29.225 9 17.25 21.95 33.275 27.525 10-14 19.73 29.515 26.655 24.099999999999998 15-19 19.85 28.67 27.905 23.575 20-24 19.835 28.48 28.28 23.405 25-29 19.61 28.735 27.415 24.240000000000002 30-34 19.96 28.349999999999998 27.71 23.98 35-39 19.925 28.555000000000003 28.345 23.175 40-44 19.85 28.425 27.67 24.055 45-49 19.585 28.294999999999998 28.38 23.74 50-54 20.005 28.15 27.985 23.86 55-59 20.085 27.955000000000002 28.18 23.78 60-64 20.305 27.825 27.505000000000003 24.365000000000002 65-69 19.800990049502477 28.47642382119106 27.36136806840342 24.361218060903045 70-74 20.12801920288043 28.579286893033956 28.21423213482022 23.07846176926539 75-79 20.131006550327516 28.07640382019101 27.621381069053452 24.17120856042802 80-84 20.033004950742612 28.374256138420762 28.074211131669752 23.518527779166874 85-89 19.925 28.410000000000004 28.405 23.26 90-94 20.22 28.754999999999995 27.650000000000002 23.375 95-99 20.39 28.1 27.605 23.905 100-104 20.24601230061503 28.73143657182859 27.281364068203413 23.741187059352967 105-109 20.041002050102506 28.436421821091056 28.221411070553525 23.301165058252913 110-114 20.363054458168726 27.839175876381457 28.164224633695056 23.633545031754764 115-119 19.763893752188487 28.282727227252263 27.837526887099195 24.11585213346006 120-124 20.23309323729492 28.211284513805523 28.211284513805523 23.344337735094037 125-129 19.98399279675854 28.197688960032014 28.09264168875994 23.7256765544495 130-134 20.144028805761153 27.91058211642328 28.020604120824167 23.9247849569914 135-139 20.244999999999997 28.310000000000002 27.474999999999998 23.97 140-144 20.51 28.89 26.790000000000003 23.810000000000002 145-149 20.505000000000003 28.03 27.900000000000002 23.565 150 20.525 28.799999999999997 28.1 22.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 1.0 18 0.5 19 0.5 20 1.0 21 1.5 22 1.0 23 2.0 24 3.0 25 4.5 26 6.0 27 7.5 28 12.0 29 11.5 30 15.5 31 25.0 32 34.0 33 49.0 34 59.0 35 68.0 36 86.0 37 102.5 38 131.0 39 164.5 40 194.0 41 225.0 42 248.0 43 269.0 44 273.5 45 280.0 46 275.0 47 241.5 48 210.5 49 190.0 50 168.5 51 140.5 52 109.5 53 77.0 54 69.0 55 60.0 56 39.0 57 28.5 58 29.0 59 24.0 60 15.0 61 12.0 62 7.5 63 4.0 64 2.0 65 4.5 66 5.0 67 2.5 68 2.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.015 75-79 0.005 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.005 110-114 0.015 115-119 0.045 120-124 0.04 125-129 0.045 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67385850476668 99.325 2 0.3010536879076769 0.6 3 0.025087807325639738 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.32499999999999996 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.375 0.0 0.0 0.0 0.0 114-115 0.375 0.0 0.0 0.0 0.0 116-117 0.3875 0.0 0.0 0.0 0.0 118-119 0.42500000000000004 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.5875 0.0 0.0 0.0 0.0 124-125 0.7125 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.875 0.0 0.0 0.0 0.0 130-131 0.975 0.0 0.0 0.0 0.0 132-133 1.025 0.0 0.0 0.0 0.0 134-135 1.0499999999999998 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031375 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031375_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.54525 33.0 33.0 34.0 32.0 34.0 2 32.614 34.0 33.0 34.0 32.0 34.0 3 32.7005 34.0 33.0 34.0 32.0 34.0 4 32.65125 34.0 33.0 34.0 32.0 34.0 5 32.72125 34.0 33.0 34.0 32.0 34.0 6 36.72825 38.0 38.0 38.0 36.0 38.0 7 36.8295 38.0 38.0 38.0 36.0 38.0 8 36.796 38.0 38.0 38.0 36.0 38.0 9 36.7495 38.0 38.0 38.0 36.0 38.0 10-14 36.705850000000005 38.0 38.0 38.0 36.0 38.0 15-19 36.6468 38.0 38.0 38.0 36.0 38.0 20-24 36.70119999999999 38.0 38.0 38.0 36.0 38.0 25-29 36.6936 38.0 38.0 38.0 36.0 38.0 30-34 36.6489 38.0 38.0 38.0 36.0 38.0 35-39 36.578649999999996 38.0 38.0 38.0 35.8 38.0 40-44 36.32885 38.0 38.0 38.0 35.4 38.0 45-49 36.53830000000001 38.0 38.0 38.0 35.6 38.0 50-54 36.56165 38.0 38.0 38.0 35.8 38.0 55-59 36.5243 38.0 38.0 38.0 36.0 38.0 60-64 36.59155 38.0 38.0 38.0 35.8 38.0 65-69 36.52315 38.0 38.0 38.0 35.6 38.0 70-74 36.4983 38.0 38.0 38.0 35.6 38.0 75-79 36.425650000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.0094 38.0 38.0 38.0 34.2 38.0 85-89 35.17475 38.0 38.0 38.0 30.8 38.0 90-94 35.119249999999994 38.0 38.0 38.0 31.0 38.0 95-99 34.9725 38.0 38.0 38.0 29.0 38.0 100-104 35.62595 38.0 38.0 38.0 30.6 38.0 105-109 35.9301 38.0 38.0 38.0 33.8 38.0 110-114 35.8569 38.0 38.0 38.0 33.8 38.0 115-119 35.83395 38.0 38.0 38.0 33.4 38.0 120-124 35.655449999999995 38.0 38.0 38.0 32.8 38.0 125-129 35.1327 38.0 38.0 38.0 30.6 38.0 130-134 33.8027 38.0 36.2 38.0 17.8 38.0 135-139 33.0334 38.0 35.8 38.0 13.2 38.0 140-144 32.8837 38.0 35.4 38.0 13.0 38.0 145-149 32.43405 38.0 34.4 38.0 4.2 38.0 150 26.52025 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 19.0 3 6.0 4 5.0 5 4.0 6 4.0 7 4.0 8 1.0 9 4.0 10 3.0 11 3.0 12 2.0 13 3.0 14 6.0 15 5.0 16 5.0 17 5.0 18 5.0 19 9.0 20 8.0 21 4.0 22 13.0 23 14.0 24 33.0 25 33.0 26 33.0 27 43.0 28 49.0 29 57.0 30 46.0 31 61.0 32 83.0 33 121.0 34 89.0 35 171.0 36 341.0 37 2708.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.575 18.525 12.925 26.974999999999998 2 26.35 24.3 33.175 16.175 3 21.15 26.650000000000002 31.75 20.45 4 23.375 35.4 22.825 18.4 5 25.374999999999996 36.875 21.9 15.85 6 19.175 37.85 24.625 18.35 7 19.5 18.575 41.05 20.875 8 19.625 23.474999999999998 29.975 26.924999999999997 9 20.9 23.95 31.0 24.15 10-14 23.265 28.58 26.915 21.240000000000002 15-19 22.825 28.035 28.4 20.74 20-24 22.650000000000002 28.04 28.410000000000004 20.9 25-29 22.52 28.449999999999996 28.22 20.810000000000002 30-34 22.58 28.125 28.42 20.875 35-39 22.65456551170837 28.095070952213806 28.711828711828712 20.538534824249112 40-44 23.570059517804903 27.82709573287602 28.346615555331383 20.256229193987693 45-49 23.628544281642245 28.029204380657095 28.019202880432065 20.32304845726859 50-54 23.285 28.000000000000004 28.205000000000002 20.51 55-59 23.41 28.4 27.744999999999997 20.445 60-64 23.54 28.405 27.634999999999998 20.419999999999998 65-69 22.355 28.57 28.12 20.955 70-74 23.105 28.02 28.285 20.59 75-79 23.335 27.305 28.375 20.985 80-84 23.438369328814932 28.09164938546356 27.73759546810986 20.732385817611654 85-89 23.1842853450504 28.14163866632205 28.31222538123546 20.36185060739209 90-94 23.577739885289102 27.504779620730634 28.067999793313696 20.849480700666565 95-99 22.780162382996327 27.553395045767182 28.411852924445363 21.254589646791125 100-104 23.349590225752927 28.09090452008648 27.904872039821004 20.654633214339587 105-109 23.41 27.57 28.305000000000003 20.715 110-114 23.31 27.400000000000002 28.985 20.305 115-119 23.57 27.725 28.485 20.22 120-124 23.75 27.735 28.355000000000004 20.16 125-129 22.756215888417223 28.325247624823124 28.446533252476247 20.472003234283402 130-134 23.308427817545326 29.14990333873243 27.34207638852605 20.199592455196196 135-139 24.122267942072355 27.932453374659328 27.80420028856944 20.141078394698873 140-144 24.28669736911757 28.75443332803981 27.182256100788738 19.776613202053888 145-149 23.768335862417807 28.265048052604957 27.713707637835107 20.252908447142133 150 24.0 27.950000000000003 27.450000000000003 20.599999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.5 14 1.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 5.5 25 7.0 26 9.0 27 9.5 28 11.5 29 16.0 30 25.0 31 31.0 32 36.5 33 47.0 34 63.0 35 77.5 36 91.5 37 125.5 38 154.0 39 169.0 40 191.5 41 211.0 42 238.5 43 279.0 44 278.5 45 262.0 46 257.5 47 244.5 48 212.0 49 177.5 50 152.5 51 135.0 52 112.5 53 80.0 54 62.5 55 49.5 56 36.5 57 28.5 58 23.5 59 18.5 60 18.0 61 15.5 62 8.0 63 4.5 64 3.5 65 2.5 66 1.5 67 0.5 68 1.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.28500000000000003 40-44 0.8699999999999999 45-49 0.015 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.145 85-89 3.2750000000000004 90-94 3.235 95-99 3.315 100-104 0.555 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.06 130-134 4.305 135-139 6.4350000000000005 140-144 5.545 145-149 1.15 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.037500000000000006 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.325 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.35 0.0 0.0 0.0 0.0 116-117 0.3625 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.4875 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.825 0.0 0.0 0.0 0.0 130-131 0.925 0.0 0.0 0.0 0.0 132-133 0.975 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.325 0.0 0.0 0.0 0.0 138 1.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATTATA 10 0.0072162314 142.3625 4 AAAAAAA 80 0.002311012 12.456718 60-64 >>END_MODULE Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086237 spots for SRR6031375.sra Written 1086237 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra Read 1086225 spots for SRR6031375.sra Written 1086225 spots for SRR6031375.sra SRR ids: ['SRR6031375.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_x1zdfsg5 SRR6031375.sra spots: 21724512 blocks: [[1, 1086225], [1086226, 2172450], [2172451, 3258675], [3258676, 4344900], [4344901, 5431125], [5431126, 6517350], [6517351, 7603575], [7603576, 8689800], [8689801, 9776025], [9776026, 10862250], [10862251, 11948475], [11948476, 13034700], [13034701, 14120925], [14120926, 15207150], [15207151, 16293375], [16293376, 17379600], [17379601, 18465825], [18465826, 19552050], [19552051, 20638275], [20638276, 21724512]] SRR6031375 file size 7297593 SRR6031375 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031375 SRR6031375_1.fastq SRR6031375_2.fastq Input file: SRR6031375_1.fastq Paired file: SRR6031375_2.fastq trimmed: SRR6031375-trimmed-pair1.fastq, SRR6031375-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:24:17 2025 >> started Fri Feb 14 05:24:42 2025 >> done (25.330s) 21724512 read pairs processed; of these: 26782 ( 0.12%) short read pairs filtered out after trimming by size control 22945 ( 0.11%) empty read pairs filtered out after trimming by size control 21674785 (99.77%) read pairs available; of these: 7765361 (35.83%) trimmed read pairs available after processing 13909424 (64.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 9 0.00% 21 6 0.00% 22 7 0.00% 23 10 0.00% 24 13 0.00% 25 4 0.00% 26 9 0.00% 27 8 0.00% 28 11 0.00% 29 15 0.00% 30 13 0.00% 31 6 0.00% 32 9 0.00% 33 21 0.00% 34 17 0.00% 35 22 0.00% 36 25 0.00% 37 14 0.00% 38 23 0.00% 39 26 0.00% 40 29 0.00% 41 32 0.00% 42 49 0.00% 43 43 0.00% 44 37 0.00% 45 40 0.00% 46 43 0.00% 47 53 0.00% 48 50 0.00% 49 71 0.00% 50 60 0.00% 51 77 0.00% 52 88 0.00% 53 91 0.00% 54 85 0.00% 55 101 0.00% 56 116 0.00% 57 126 0.00% 58 155 0.00% 59 161 0.00% 60 150 0.00% 61 154 0.00% 62 188 0.00% 63 214 0.00% 64 227 0.00% 65 258 0.00% 66 278 0.00% 67 323 0.00% 68 435 0.00% 69 615 0.00% 70 647 0.00% 71 502 0.00% 72 462 0.00% 73 552 0.00% 74 542 0.00% 75 637 0.00% 76 682 0.00% 77 709 0.00% 78 817 0.00% 79 910 0.00% 80 957 0.00% 81 1141 0.01% 82 1201 0.01% 83 1613 0.01% 84 3468 0.02% 85 3640 0.02% 86 3737 0.02% 87 3859 0.02% 88 3843 0.02% 89 4116 0.02% 90 4258 0.02% 91 4475 0.02% 92 4509 0.02% 93 4956 0.02% 94 5191 0.02% 95 5365 0.02% 96 5694 0.03% 97 6119 0.03% 98 6217 0.03% 99 6546 0.03% 100 6896 0.03% 101 7343 0.03% 102 7559 0.03% 103 8167 0.04% 104 8472 0.04% 105 8941 0.04% 106 9586 0.04% 107 9973 0.05% 108 10449 0.05% 109 10910 0.05% 110 11546 0.05% 111 12171 0.06% 112 12736 0.06% 113 13515 0.06% 114 14306 0.07% 115 14538 0.07% 116 14950 0.07% 117 15850 0.07% 118 16451 0.08% 119 16957 0.08% 120 17781 0.08% 121 18490 0.09% 122 19651 0.09% 123 20605 0.10% 124 21714 0.10% 125 22767 0.11% 126 24148 0.11% 127 25688 0.12% 128 26926 0.12% 129 28858 0.13% 130 30477 0.14% 131 32713 0.15% 132 35254 0.16% 133 37744 0.17% 134 40140 0.19% 135 44218 0.20% 136 49391 0.23% 137 55503 0.26% 138 62154 0.29% 139 67185 0.31% 140 73145 0.34% 141 80393 0.37% 142 88693 0.41% 143 103210 0.48% 144 125869 0.58% 145 160793 0.74% 146 222935 1.03% 147 344255 1.59% 148 723786 3.34% 149 4837567 22.32% 150 13909424 64.17% 21674785 reads passed initial QC criterion=sequence-density sequence-density=0.07 sequence-density-rank=1 fanout-score=4.39 fanout-score-rank=30 prefix-density=0.09 prefix-fanout=3.4 sequence=ACAAAGATCTGCAT criterion=fanout-score sequence-density=0.05 sequence-density-rank=27 fanout-score=488.13 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=34.2 sequence=TCTTCTTCTTCCT criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.23 fanout-score-rank=29 prefix-density=0.18 prefix-fanout=3.6 sequence=AAGAAGACCCTG criterion=fanout-score sequence-density=0.06 sequence-density-rank=19 fanout-score=518.09 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=34.4 sequence=AAGAAGAAGAAG SRR6031375 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:25:36 Started mapping on | Feb 14 05:25:37 Finished on | Feb 14 05:28:44 Mapping speed, Million of reads per hour | 417.27 Number of input reads | 21674785 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19974494 Uniquely mapped reads % | 92.16% Average mapped length | 296.03 Number of splices: Total | 18597790 Number of splices: Annotated (sjdb) | 18183956 Number of splices: GT/AG | 18277857 Number of splices: GC/AG | 268519 Number of splices: AT/AC | 15993 Number of splices: Non-canonical | 35421 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 471402 % of reads mapped to multiple loci | 2.17% Number of reads mapped to too many loci | 29662 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.29% % of reads unmapped: other | 1.24% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1259705 1259705 1259705 N_multimapping 471402 471402 471402 N_noFeature 814619 19754500 934184 N_ambiguous 204031 1170 102902 UnstrandedReadsAssigned:18955844 PositiveStrandReadsAssigned:218824 NegativeStrandReadsAssigned:18937408 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031375 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031375-trimmed-pair1.fastq SRR6031375-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,674,785 reads, 19,261,139 reads pseudoaligned [quant] estimated average fragment length: 297.415 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,078 rounds 52401 SRR6031375.ke.tsv 34699 SRR6031375.se.tsv 87100 total ==> SRR6031375.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1721.58 1240 38.2745 Potri.005G024800.1.v4.1 1035 738.585 262 18.8502 Potri.004G059700.1.v4.1 961 664.806 95 7.59355 Potri.007G009000.2.v4.1 1416 1119.58 5 0.237317 Potri.003G141000.2.v4.1 2943 2646.58 911.25 18.2965 Potri.016G087400.1.v4.1 270 57.8647 1485 1363.73 Potri.015G069301.1.v4.1 564 280.76 0 0 Potri.010G195200.1.v4.1 1773 1476.58 91 3.27491 Potri.012G127500.1.v4.1 977 680.697 1222 95.3967 ==> SRR6031375.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 24 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR6031375 completed mapping pipeline successfully