Starting /dee2/code/volunteer_pipeline.sh SRR6031376 current disk space = 3085970616320 free memory = 1017045772 SRR6031376 SRAfilesize dd469505c868dffc7957cf3ac99e6efc SRR6031376.sra SRR6031376.sra file validated SRR6031376 is paired end SRR6031376 is conventional basespace SRR6031376 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031376_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8655 34.0 33.0 34.0 33.0 34.0 2 33.38125 34.0 34.0 34.0 33.0 34.0 3 33.444 34.0 34.0 34.0 33.0 34.0 4 33.434 34.0 34.0 34.0 33.0 34.0 5 33.48525 34.0 34.0 34.0 33.0 34.0 6 37.1645 38.0 38.0 38.0 36.0 38.0 7 37.3425 38.0 38.0 38.0 37.0 38.0 8 37.47575 38.0 38.0 38.0 37.0 38.0 9 37.44625 38.0 38.0 38.0 37.0 38.0 10-14 37.532050000000005 38.0 38.0 38.0 37.4 38.0 15-19 37.5113 38.0 38.0 38.0 38.0 38.0 20-24 37.5093 38.0 38.0 38.0 38.0 38.0 25-29 37.4946 38.0 38.0 38.0 37.8 38.0 30-34 37.4478 38.0 38.0 38.0 37.4 38.0 35-39 37.39375 38.0 38.0 38.0 37.0 38.0 40-44 37.29279999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.300349999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.2972 38.0 38.0 38.0 37.0 38.0 55-59 37.1742 38.0 38.0 38.0 36.8 38.0 60-64 37.18910000000001 38.0 38.0 38.0 37.0 38.0 65-69 37.035450000000004 38.0 38.0 38.0 36.4 38.0 70-74 37.046400000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.95545 38.0 38.0 38.0 36.0 38.0 80-84 37.0148 38.0 38.0 38.0 36.2 38.0 85-89 36.9754 38.0 38.0 38.0 36.0 38.0 90-94 36.847950000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.8191 38.0 38.0 38.0 35.8 38.0 100-104 36.664 38.0 38.0 38.0 35.2 38.0 105-109 36.53025 38.0 38.0 38.0 34.8 38.0 110-114 35.860749999999996 38.0 37.2 38.0 31.2 38.0 115-119 36.3317 38.0 38.0 38.0 34.0 38.0 120-124 36.25945 38.0 38.0 38.0 34.0 38.0 125-129 36.18855 38.0 38.0 38.0 34.0 38.0 130-134 35.8624 38.0 38.0 38.0 32.8 38.0 135-139 35.57355 38.0 37.0 38.0 31.4 38.0 140-144 35.353100000000005 38.0 36.6 38.0 31.0 38.0 145-149 34.6629 38.0 36.0 38.0 29.4 38.0 150 27.05875 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 1.0 11 3.0 12 3.0 13 2.0 14 1.0 15 1.0 16 3.0 17 1.0 18 3.0 19 2.0 20 1.0 21 3.0 22 3.0 23 8.0 24 11.0 25 6.0 26 23.0 27 15.0 28 25.0 29 24.0 30 30.0 31 47.0 32 60.0 33 73.0 34 102.0 35 202.0 36 444.0 37 2901.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.24770642201835 13.761467889908257 10.423037716615697 28.567787971457697 2 23.325000000000003 17.025000000000002 31.574999999999996 28.075 3 20.625 25.474999999999998 27.6 26.3 4 23.400000000000002 31.025000000000002 24.25 21.325 5 23.225 33.800000000000004 24.55 18.425 6 16.64164164164164 36.96196196196196 25.675675675675674 20.72072072072072 7 12.5 25.0 44.6 17.9 8 16.55 24.025 30.599999999999998 28.825 9 17.424999999999997 25.15 32.675 24.75 10-14 19.7 30.535 27.36 22.405 15-19 19.56 28.83 27.884999999999998 23.724999999999998 20-24 19.575 29.49 28.000000000000004 22.935 25-29 19.33 29.609999999999996 27.955000000000002 23.105 30-34 19.885 29.175 27.700000000000003 23.24 35-39 19.155 29.09 27.655 24.099999999999998 40-44 18.790000000000003 29.62 28.365000000000002 23.225 45-49 19.095000000000002 29.43 27.49 23.985 50-54 19.564999999999998 29.435 27.625 23.375 55-59 19.335 29.325000000000003 28.03 23.31 60-64 19.220000000000002 29.404999999999998 27.85 23.525 65-69 19.435 29.575000000000003 27.3 23.69 70-74 18.965 29.095 28.175 23.765 75-79 19.42 29.95 27.525 23.105 80-84 19.28 29.265 27.560000000000002 23.895 85-89 19.915 29.48 27.71 22.895 90-94 19.634999999999998 29.205 27.744999999999997 23.415 95-99 19.375 28.999999999999996 28.565 23.06 100-104 19.99 29.24 27.525 23.244999999999997 105-109 19.865 28.865000000000002 27.794999999999998 23.474999999999998 110-114 19.54 28.88 27.555000000000003 24.025 115-119 20.05 29.145 27.68 23.125 120-124 19.805 28.96 28.025 23.21 125-129 20.735 28.23 27.955000000000002 23.080000000000002 130-134 19.91 28.95 27.694999999999997 23.445 135-139 20.075000000000003 29.07 27.495000000000005 23.36 140-144 20.315 28.435 27.265 23.985 145-149 20.21 28.849999999999998 27.384999999999998 23.555 150 19.5 28.549999999999997 27.625 24.325 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 1.0 15 1.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.0 22 2.0 23 3.0 24 3.0 25 6.0 26 7.0 27 6.0 28 10.5 29 23.5 30 37.0 31 44.0 32 48.0 33 53.5 34 61.5 35 77.5 36 105.0 37 131.0 38 152.0 39 183.5 40 209.5 41 224.5 42 254.0 43 265.0 44 257.0 45 269.0 46 273.0 47 239.5 48 204.0 49 179.0 50 140.5 51 114.0 52 105.5 53 88.5 54 58.0 55 31.0 56 26.0 57 24.5 58 18.0 59 13.5 60 9.5 61 8.5 62 6.5 63 3.0 64 2.0 65 3.0 66 2.0 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.7491219267436 99.4 2 0.17561465127947817 0.35000000000000003 3 0.050175614651279475 0.15 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.625 0.0 0.0 0.0 0.0 106-107 0.6875 0.0 0.0 0.0 0.0 108-109 0.7875 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.0 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.3 0.0 0.0 0.0 0.0 118-119 1.3875 0.0 0.0 0.0 0.0 120-121 1.5 0.0 0.0 0.0 0.0 122-123 1.7375 0.0 0.0 0.0 0.0 124-125 2.0375 0.0 0.0 0.0 0.0 126-127 2.2125 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.7875 0.0 0.0 0.0 0.0 132-133 3.05 0.0 0.0 0.0 0.0 134-135 3.3875 0.0 0.0 0.0 0.0 136-137 3.6125 0.0 0.0 0.0 0.0 138 3.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTACCA 10 0.0069754543 143.9875 7 >>END_MODULE SRR6031376 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031376_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.22175 33.0 33.0 34.0 32.0 34.0 2 32.27 33.0 33.0 34.0 31.0 34.0 3 32.3785 33.0 33.0 34.0 31.0 34.0 4 32.32825 33.0 33.0 34.0 32.0 34.0 5 32.2195 33.0 33.0 34.0 31.0 34.0 6 36.3275 38.0 38.0 38.0 35.0 38.0 7 36.34875 38.0 38.0 38.0 35.0 38.0 8 36.45425 38.0 38.0 38.0 35.0 38.0 9 36.369 38.0 38.0 38.0 35.0 38.0 10-14 36.2798 38.0 38.0 38.0 34.2 38.0 15-19 36.23800000000001 38.0 38.0 38.0 34.0 38.0 20-24 36.10635 38.0 38.0 38.0 34.0 38.0 25-29 36.07340000000001 38.0 38.0 38.0 34.0 38.0 30-34 36.06994999999999 38.0 38.0 38.0 33.8 38.0 35-39 35.88225 38.0 38.0 38.0 33.2 38.0 40-44 35.82635 38.0 38.0 38.0 32.8 38.0 45-49 35.7471 38.0 38.0 38.0 31.6 38.0 50-54 35.55345 38.0 37.0 38.0 30.2 38.0 55-59 35.446650000000005 38.0 37.0 38.0 29.6 38.0 60-64 35.20465 38.0 37.0 38.0 28.6 38.0 65-69 35.157050000000005 38.0 36.8 38.0 28.6 38.0 70-74 34.933350000000004 38.0 36.2 38.0 27.6 38.0 75-79 34.78965000000001 38.0 36.0 38.0 27.0 38.0 80-84 34.4504 38.0 35.8 38.0 25.6 38.0 85-89 34.175799999999995 38.0 35.2 38.0 23.8 38.0 90-94 33.97295 38.0 35.0 38.0 19.8 38.0 95-99 33.57995 38.0 34.0 38.0 16.2 38.0 100-104 33.28895000000001 38.0 34.0 38.0 15.0 38.0 105-109 32.881150000000005 38.0 33.8 38.0 15.0 38.0 110-114 32.2836 37.6 32.0 38.0 15.0 38.0 115-119 31.793649999999996 37.0 30.2 38.0 15.0 38.0 120-124 30.995349999999995 36.6 28.0 38.0 14.2 38.0 125-129 30.27475 35.8 26.4 38.0 13.2 38.0 130-134 29.56325 35.0 23.8 38.0 13.0 38.0 135-139 28.54015 35.0 21.8 38.0 2.0 38.0 140-144 27.602449999999997 34.6 18.4 38.0 2.0 38.0 145-149 24.9177 32.6 9.0 38.0 2.0 38.0 150 18.523 21.0 2.0 35.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 53.0 3 1.0 4 4.0 5 3.0 6 6.0 7 2.0 8 2.0 9 3.0 10 1.0 11 9.0 12 5.0 13 12.0 14 13.0 15 13.0 16 16.0 17 16.0 18 13.0 19 17.0 20 19.0 21 23.0 22 23.0 23 34.0 24 35.0 25 36.0 26 48.0 27 50.0 28 67.0 29 72.0 30 102.0 31 148.0 32 168.0 33 254.0 34 359.0 35 584.0 36 961.0 37 828.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.221971407072985 20.71733132681214 15.550539252570855 18.510158013544018 2 29.383527033855483 22.86508337544214 29.737241030823647 18.014148559878727 3 21.576553815058112 25.94744820616473 34.73976755937342 17.73623041940374 4 25.088428499242042 33.628094997473475 23.496715512885295 17.78676099039919 5 25.138959070237494 35.47246083880748 22.056594239514908 17.33198585144012 6 19.438827098078868 37.51263902932255 24.115267947421636 18.933265925176947 7 21.045982819605864 20.38908539666498 39.79282465891865 18.77210712481051 8 20.84912812736922 24.816780389183727 27.975739196360877 26.358352287086177 9 22.289613343442003 25.145312105130145 29.390952741976246 23.174121809451606 10-14 23.74406145759628 28.909329829172144 26.94329323764278 20.4033154755888 15-19 23.331985442782045 28.58370400323494 28.28042862919531 19.80388192478771 20-24 23.407804286291952 27.967044076021025 28.15911847957946 20.46603315810756 25-29 23.339735166279187 28.034974224198926 28.3584352572526 20.266855352269282 30-34 22.992571630703925 28.394562635807773 28.748294507049373 19.864571226438933 35-39 23.18034775576223 28.477557622321072 28.351192883137887 19.99090173877881 40-44 23.228187240926093 28.43494085532302 28.263067435041954 20.07380446870893 45-49 23.169067475360123 29.011877685114985 28.329542582764724 19.48951225676017 50-54 23.466397170288026 28.468923698837795 28.595250126326427 19.46942900454775 55-59 23.805913570887036 28.344705585039172 27.81905483952489 20.0303260045489 60-64 23.494919880705655 28.322296921599353 28.039225597735427 20.14355759995956 65-69 22.696254359803874 29.13612697770813 28.443613203255318 19.724005459232675 70-74 23.85645691180187 28.273944907758402 28.52666161233258 19.342936568107152 75-79 23.570742556740637 28.195925794874388 28.534600414497298 19.69873123388768 80-84 23.422649140546007 28.3164812942366 28.397371081900907 19.86349848331648 85-89 24.237827999393296 28.23701906061985 27.7516557965519 19.773497143434955 90-94 23.752716979224587 29.050194611535158 27.690441287974522 19.506647121265733 95-99 23.005359490342805 28.349681464253212 28.319344726463747 20.325614318940236 100-104 23.52524895111965 29.029975231259165 28.206035485012382 19.238740332608806 105-109 23.031436369149905 28.49489538057212 28.338218942686748 20.135449307591227 110-114 23.347483323226196 28.825550838892255 27.890640792399434 19.93632504548211 115-119 23.45716451857468 29.507202426080365 28.1223148850139 18.91331817033106 120-124 23.18774643615408 28.672530583358608 28.520877565463554 19.61884541502376 125-129 23.58829179515697 29.123906779232595 27.996562357818107 19.291239067792326 130-134 24.052360254725563 28.237137369857475 28.348327099969676 19.362175275447285 135-139 23.560341776631784 28.67182365134739 27.903331816573136 19.864502755447695 140-144 23.5817575083426 29.047426433410863 27.859237536656888 19.511578521589644 145-149 24.10899347859057 28.850917547141197 27.62246600272989 19.417622971538346 150 23.919089759797725 31.378002528445002 26.194690265486724 18.508217446270546 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 28.0 1 21.0 2 7.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.0 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.5 19 1.5 20 1.0 21 2.0 22 2.5 23 2.5 24 6.0 25 7.5 26 8.0 27 6.0 28 5.5 29 13.0 30 17.0 31 27.0 32 38.5 33 45.0 34 70.0 35 83.0 36 84.5 37 110.5 38 148.5 39 175.5 40 194.5 41 230.0 42 264.0 43 270.5 44 267.0 45 281.0 46 267.0 47 231.0 48 212.0 49 188.5 50 153.0 51 130.0 52 102.5 53 73.0 54 65.0 55 44.0 56 26.5 57 23.5 58 19.5 59 11.0 60 5.5 61 8.5 62 9.0 63 7.5 64 5.0 65 1.5 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 1.05 3 1.05 4 1.05 5 1.05 6 1.0999999999999999 7 1.05 8 1.075 9 1.075 10-14 1.0699999999999998 15-19 1.08 20-24 1.08 25-29 1.0699999999999998 30-34 1.055 35-39 1.08 40-44 1.09 45-49 1.075 50-54 1.05 55-59 1.075 60-64 1.085 65-69 1.085 70-74 1.075 75-79 1.085 80-84 1.0999999999999999 85-89 1.105 90-94 1.085 95-99 1.11 100-104 1.085 105-109 1.0699999999999998 110-114 1.06 115-119 1.075 120-124 1.09 125-129 1.095 130-134 1.0699999999999998 135-139 1.105 140-144 1.11 145-149 1.095 150 1.125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.46781550937659 98.125 2 0.3801317790167258 0.75 3 0.025342118601115054 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.07602635580334516 0.525 8 0.025342118601115054 0.2 9 0.0 0.0 >10 0.025342118601115054 0.325 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 8 0.2 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.525 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6875 0.0 0.0 0.0 0.0 112-113 0.725 0.0 0.0 0.0 0.0 114-115 0.825 0.0 0.0 0.0 0.0 116-117 0.925 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.1625 0.0 0.0 0.0 0.0 124-125 1.3250000000000002 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.6749999999999998 0.0 0.0 0.0 0.0 130-131 1.7999999999999998 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.1875 0.0 0.0 0.0 0.0 136-137 2.3499999999999996 0.0 0.0 0.0 0.0 138 2.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACTGG 10 0.006973645 144.0 3 GTGGAAA 10 0.006973645 144.0 8 >>END_MODULE Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra Read 880222 spots for SRR6031376.sra Written 880222 spots for SRR6031376.sra Read 880210 spots for SRR6031376.sra Written 880210 spots for SRR6031376.sra SRR ids: ['SRR6031376.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6va_atik SRR6031376.sra spots: 17604212 blocks: [[1, 880210], [880211, 1760420], [1760421, 2640630], [2640631, 3520840], [3520841, 4401050], [4401051, 5281260], [5281261, 6161470], [6161471, 7041680], [7041681, 7921890], [7921891, 8802100], [8802101, 9682310], [9682311, 10562520], [10562521, 11442730], [11442731, 12322940], [12322941, 13203150], [13203151, 14083360], [14083361, 14963570], [14963571, 15843780], [15843781, 16723990], [16723991, 17604212]] SRR6031376 file size 5909406 SRR6031376 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031376 SRR6031376_1.fastq SRR6031376_2.fastq Input file: SRR6031376_1.fastq Paired file: SRR6031376_2.fastq trimmed: SRR6031376-trimmed-pair1.fastq, SRR6031376-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:35:49 2025 >> started Fri Feb 14 05:36:19 2025 >> done (30.018s) 17604212 read pairs processed; of these: 55751 ( 0.32%) short read pairs filtered out after trimming by size control 235108 ( 1.34%) empty read pairs filtered out after trimming by size control 17313353 (98.35%) read pairs available; of these: 8640316 (49.91%) trimmed read pairs available after processing 8673037 (50.09%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 6 0.00% 20 12 0.00% 21 14 0.00% 22 13 0.00% 23 14 0.00% 24 12 0.00% 25 11 0.00% 26 12 0.00% 27 23 0.00% 28 17 0.00% 29 16 0.00% 30 26 0.00% 31 22 0.00% 32 24 0.00% 33 24 0.00% 34 17 0.00% 35 17 0.00% 36 35 0.00% 37 26 0.00% 38 29 0.00% 39 33 0.00% 40 27 0.00% 41 38 0.00% 42 48 0.00% 43 48 0.00% 44 55 0.00% 45 78 0.00% 46 51 0.00% 47 101 0.00% 48 114 0.00% 49 100 0.00% 50 101 0.00% 51 121 0.00% 52 151 0.00% 53 153 0.00% 54 175 0.00% 55 201 0.00% 56 210 0.00% 57 206 0.00% 58 251 0.00% 59 221 0.00% 60 267 0.00% 61 305 0.00% 62 290 0.00% 63 339 0.00% 64 414 0.00% 65 456 0.00% 66 514 0.00% 67 704 0.00% 68 1096 0.01% 69 3260 0.02% 70 3173 0.02% 71 1817 0.01% 72 1270 0.01% 73 1190 0.01% 74 1261 0.01% 75 1294 0.01% 76 1358 0.01% 77 1464 0.01% 78 1684 0.01% 79 1822 0.01% 80 2003 0.01% 81 2343 0.01% 82 2734 0.02% 83 3567 0.02% 84 7183 0.04% 85 7237 0.04% 86 7816 0.05% 87 8326 0.05% 88 8520 0.05% 89 8410 0.05% 90 9049 0.05% 91 9191 0.05% 92 9728 0.06% 93 9913 0.06% 94 10361 0.06% 95 10638 0.06% 96 11112 0.06% 97 11614 0.07% 98 12058 0.07% 99 13091 0.08% 100 13618 0.08% 101 14555 0.08% 102 15406 0.09% 103 16053 0.09% 104 16748 0.10% 105 17781 0.10% 106 18586 0.11% 107 19302 0.11% 108 20134 0.12% 109 21309 0.12% 110 21723 0.13% 111 23339 0.13% 112 24797 0.14% 113 25964 0.15% 114 26940 0.16% 115 28719 0.17% 116 29843 0.17% 117 30573 0.18% 118 32428 0.19% 119 33753 0.19% 120 34838 0.20% 121 36769 0.21% 122 39404 0.23% 123 42246 0.24% 124 44983 0.26% 125 47218 0.27% 126 49821 0.29% 127 53068 0.31% 128 55879 0.32% 129 58495 0.34% 130 61276 0.35% 131 65379 0.38% 132 70524 0.41% 133 77006 0.44% 134 83884 0.48% 135 91138 0.53% 136 97127 0.56% 137 105110 0.61% 138 112459 0.65% 139 119659 0.69% 140 130171 0.75% 141 142335 0.82% 142 157185 0.91% 143 178420 1.03% 144 212247 1.23% 145 255441 1.48% 146 334312 1.93% 147 481166 2.78% 148 887878 5.13% 149 3871574 22.36% 150 8673037 50.09% 17313353 reads passed initial QC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=2.14 fanout-score-rank=36 prefix-density=0.34 prefix-fanout=2.1 sequence=GCCGCACTTGCA criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=437.75 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=29.5 sequence=TCATCATCACCACCATCACCATCCCTGATTGATCTTTGATTCACAACAAGACCAACCAACCGTACAATGTTTACATAACTTGGGATAATCTCACAAGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCACGGTAGAACCGTAGAACCATAACAACAAGAGACATATTGCAGATGAGTACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGGTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAAAAACATGAGCACCAATATTCTTAGTAGCAAGGTTGCTACCAGGGTGGAACACGCTCCTCCAAACATTGCTACGCGCCGACACTGGGGTTGTAGGGGTCACTGGTGTCGTCGGTGTCCCTGGAGTTCCTGGCATAGTCATGGACCTCTGAAACTTATTAACAGGACTGCTCCCCTCTCCGACGTC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=7.88 fanout-score-rank=12 prefix-density=0.68 prefix-fanout=2.0 sequence=GGCTGCAAGTGTGGAGCCAACTGTACCTGCGATCCTTGCACTTGTAAATGAGAGCGATCCGCTGGCTGCGTTGATTCAAGAAATGATCATCGCATCGACGGATTGACAAGAAATAATATTTCATCTACTAGGCGTTTATAAGGGTTGTCTCTTGTCTTCAACAAGTTTCAATAAAGTAGCTAGTATATATTCATGGCTTGTTTTCTGCAAATCTTCTTGGATTTGCAGCTCTGGGGCTTCCTCTCTAGTATCAAGTATCAAGTCTCAAGTCGTGTTAGCTGCTTGTCGTCCTGTTTATCTTTCAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=389.96 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=32.9 sequence=AAGAAGAAGAAA SRR6031376 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:37:06 Started mapping on | Feb 14 05:37:07 Finished on | Feb 14 05:39:13 Mapping speed, Million of reads per hour | 494.67 Number of input reads | 17313353 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 16490129 Uniquely mapped reads % | 95.25% Average mapped length | 291.61 Number of splices: Total | 15734613 Number of splices: Annotated (sjdb) | 15189746 Number of splices: GT/AG | 15454643 Number of splices: GC/AG | 230130 Number of splices: AT/AC | 13268 Number of splices: Non-canonical | 36572 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.03% Deletion average length | 3.29 Insertion rate per base | 0.02% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 307781 % of reads mapped to multiple loci | 1.78% Number of reads mapped to too many loci | 36528 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.70% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 577739 577739 577739 N_multimapping 307781 307781 307781 N_noFeature 889186 16205184 1066468 N_ambiguous 188217 1319 79877 UnstrandedReadsAssigned:15412726 PositiveStrandReadsAssigned:283626 NegativeStrandReadsAssigned:15343784 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031376 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031376-trimmed-pair1.fastq SRR6031376-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,313,353 reads, 15,375,168 reads pseudoaligned [quant] estimated average fragment length: 265.851 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,153 rounds 52401 SRR6031376.ke.tsv 34699 SRR6031376.se.tsv 87100 total ==> SRR6031376.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.15 479 16.2074 Potri.005G024800.1.v4.1 1035 770.149 439 33.8131 Potri.004G059700.1.v4.1 961 696.333 9 0.766692 Potri.007G009000.2.v4.1 1416 1151.15 0 0 Potri.003G141000.2.v4.1 2943 2678.15 750.929 16.6326 Potri.016G087400.1.v4.1 270 74.8496 1110 879.689 Potri.015G069301.1.v4.1 564 310.028 0 0 Potri.010G195200.1.v4.1 1773 1508.15 298 11.7211 Potri.012G127500.1.v4.1 977 712.262 6498 541.172 ==> SRR6031376.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 3 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 93 SRR6031376 completed mapping pipeline successfully