Starting /dee2/code/volunteer_pipeline.sh SRR6031377 current disk space = 3085849759744 free memory = 1017282068 SRR6031377 SRAfilesize 9f35ad7a829b8bfe03da4208718ad2d6 SRR6031377.sra SRR6031377.sra file validated SRR6031377 is paired end SRR6031377 is conventional basespace SRR6031377 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031377_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.12925 34.0 33.0 34.0 33.0 34.0 2 33.3015 34.0 33.0 34.0 33.0 34.0 3 33.311 34.0 33.0 34.0 32.0 34.0 4 33.33675 34.0 33.0 34.0 33.0 34.0 5 33.307 34.0 33.0 34.0 33.0 34.0 6 37.0005 38.0 38.0 38.0 36.0 38.0 7 37.257 38.0 38.0 38.0 37.0 38.0 8 37.3135 38.0 38.0 38.0 37.0 38.0 9 37.38975 38.0 38.0 38.0 37.0 38.0 10-14 37.3028 38.0 38.0 38.0 37.0 38.0 15-19 37.30955 38.0 38.0 38.0 37.0 38.0 20-24 37.3305 38.0 38.0 38.0 37.0 38.0 25-29 37.27195 38.0 38.0 38.0 37.0 38.0 30-34 37.221450000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.2434 38.0 38.0 38.0 37.0 38.0 40-44 37.087599999999995 38.0 38.0 38.0 36.0 38.0 45-49 37.05555 38.0 38.0 38.0 36.0 38.0 50-54 37.0276 38.0 38.0 38.0 36.0 38.0 55-59 36.9159 38.0 38.0 38.0 36.0 38.0 60-64 36.91165 38.0 38.0 38.0 36.0 38.0 65-69 36.84045 38.0 38.0 38.0 35.6 38.0 70-74 36.8209 38.0 38.0 38.0 35.8 38.0 75-79 36.768950000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.70035 38.0 38.0 38.0 35.0 38.0 85-89 36.61565 38.0 38.0 38.0 34.6 38.0 90-94 36.56355 38.0 38.0 38.0 34.4 38.0 95-99 36.40725 38.0 38.0 38.0 34.0 38.0 100-104 36.43615 38.0 38.0 38.0 34.0 38.0 105-109 36.252449999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.1339 38.0 38.0 38.0 33.8 38.0 115-119 35.942750000000004 38.0 37.6 38.0 33.0 38.0 120-124 35.76105 38.0 37.0 38.0 32.4 38.0 125-129 35.57130000000001 38.0 36.8 38.0 31.6 38.0 130-134 35.35844999999999 38.0 36.4 38.0 31.0 38.0 135-139 35.1092 38.0 36.0 38.0 29.8 38.0 140-144 34.57039999999999 38.0 35.8 38.0 27.4 38.0 145-149 34.030649999999994 38.0 35.0 38.0 25.0 38.0 150 27.291 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 2.0 7 3.0 8 0.0 9 0.0 10 3.0 11 3.0 12 0.0 13 1.0 14 2.0 15 1.0 16 1.0 17 3.0 18 5.0 19 6.0 20 4.0 21 2.0 22 6.0 23 12.0 24 11.0 25 12.0 26 24.0 27 26.0 28 24.0 29 39.0 30 47.0 31 53.0 32 57.0 33 101.0 34 144.0 35 206.0 36 472.0 37 2728.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.83018867924528 14.18867924528302 8.80503144654088 28.17610062893082 2 24.425 16.875 31.125000000000004 27.575 3 19.35 26.025 28.925 25.7 4 21.775 31.624999999999996 24.325 22.275 5 21.38569284642321 34.44222111055527 24.23711855927964 19.93496748374187 6 17.0 36.875 24.9 21.224999999999998 7 13.875000000000002 23.400000000000002 44.224999999999994 18.5 8 17.075000000000003 23.375 32.25 27.3 9 17.8 24.45 32.05 25.7 10-14 20.075000000000003 29.93 26.765 23.23 15-19 20.05 29.154999999999998 27.465 23.330000000000002 20-24 19.395 29.195 27.834999999999997 23.575 25-29 19.615 29.565 27.810000000000002 23.01 30-34 20.405 28.525 27.33 23.74 35-39 19.835 28.98 28.075 23.11 40-44 19.75 29.095 27.395000000000003 23.76 45-49 20.45 28.605000000000004 27.565 23.380000000000003 50-54 19.975 28.23 27.965 23.830000000000002 55-59 19.805 28.475 27.935 23.785 60-64 19.905 27.79 28.525 23.78 65-69 20.05 28.59 27.375 23.985 70-74 19.994999999999997 29.054999999999996 27.775 23.175 75-79 20.7 28.884999999999998 27.005000000000003 23.41 80-84 20.26 28.555000000000003 27.589999999999996 23.595 85-89 20.74 28.26 27.54 23.46 90-94 20.51 28.439999999999998 27.339999999999996 23.71 95-99 20.075000000000003 28.884999999999998 27.575 23.465 100-104 20.424999999999997 28.93 27.43 23.215 105-109 19.78 27.845 28.249999999999996 24.125 110-114 20.625 28.349999999999998 27.57 23.455000000000002 115-119 20.57 28.18 27.63 23.62 120-124 20.765 28.000000000000004 27.08 24.154999999999998 125-129 20.369999999999997 28.02 28.285 23.325000000000003 130-134 20.655 28.62 27.310000000000002 23.415 135-139 21.04 28.449999999999996 27.41 23.1 140-144 20.285 28.405 27.43 23.880000000000003 145-149 20.8 28.499999999999996 27.439999999999998 23.26 150 21.235617808904454 27.063531765882942 27.43871935967984 24.262131065532767 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 2.0 3 2.0 4 0.5 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 2.0 22 3.0 23 3.0 24 4.0 25 2.5 26 2.5 27 11.0 28 15.0 29 15.5 30 24.5 31 35.0 32 33.0 33 36.0 34 53.5 35 75.5 36 102.5 37 120.0 38 138.0 39 163.0 40 185.5 41 202.5 42 233.5 43 254.5 44 262.5 45 262.5 46 257.0 47 249.5 48 227.5 49 206.0 50 166.5 51 130.0 52 118.5 53 102.0 54 70.5 55 48.0 56 38.0 57 31.0 58 23.5 59 22.5 60 20.5 61 12.5 62 7.5 63 7.0 64 4.5 65 2.5 66 2.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.625 2 0.0 3 0.0 4 0.0 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69902182091799 99.375 2 0.27589666415851516 0.5499999999999999 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.625 0.0 0.0 0.0 0.0 120-121 0.7375 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 1.0499999999999998 0.0 0.0 0.0 0.0 128-129 1.1375000000000002 0.0 0.0 0.0 0.0 130-131 1.2000000000000002 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.4125 0.0 0.0 0.0 0.0 136-137 1.5125000000000002 0.0 0.0 0.0 0.0 138 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031377 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031377_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5755 33.0 33.0 34.0 32.0 34.0 2 32.65925 33.0 33.0 34.0 32.0 34.0 3 32.60925 33.0 33.0 34.0 32.0 34.0 4 32.535 34.0 33.0 34.0 32.0 34.0 5 32.62025 33.0 33.0 34.0 32.0 34.0 6 36.66175 38.0 38.0 38.0 35.0 38.0 7 36.727 38.0 38.0 38.0 35.0 38.0 8 36.74625 38.0 38.0 38.0 35.0 38.0 9 36.673 38.0 38.0 38.0 36.0 38.0 10-14 36.71175 38.0 38.0 38.0 35.6 38.0 15-19 36.622400000000006 38.0 38.0 38.0 35.4 38.0 20-24 36.59775 38.0 38.0 38.0 35.4 38.0 25-29 36.6119 38.0 38.0 38.0 35.8 38.0 30-34 36.5958 38.0 38.0 38.0 36.0 38.0 35-39 36.44565 38.0 38.0 38.0 35.2 38.0 40-44 36.2715 38.0 38.0 38.0 34.8 38.0 45-49 36.4098 38.0 38.0 38.0 35.0 38.0 50-54 36.40409999999999 38.0 38.0 38.0 34.8 38.0 55-59 36.37325 38.0 38.0 38.0 34.8 38.0 60-64 36.32525 38.0 38.0 38.0 34.4 38.0 65-69 36.293949999999995 38.0 38.0 38.0 34.4 38.0 70-74 36.2864 38.0 38.0 38.0 34.6 38.0 75-79 36.200900000000004 38.0 38.0 38.0 34.2 38.0 80-84 35.6749 38.0 38.0 38.0 33.0 38.0 85-89 34.97805 38.0 38.0 38.0 29.4 38.0 90-94 35.107099999999996 38.0 38.0 38.0 29.6 38.0 95-99 34.97055 38.0 38.0 38.0 28.4 38.0 100-104 35.620850000000004 38.0 38.0 38.0 31.2 38.0 105-109 35.703 38.0 38.0 38.0 33.0 38.0 110-114 35.61130000000001 38.0 38.0 38.0 32.2 38.0 115-119 35.4933 38.0 37.6 38.0 31.8 38.0 120-124 35.54115 38.0 38.0 38.0 32.0 38.0 125-129 34.786500000000004 38.0 36.8 38.0 27.6 38.0 130-134 33.5499 38.0 35.8 38.0 16.2 38.0 135-139 32.59049999999999 38.0 34.6 38.0 8.6 38.0 140-144 32.4388 38.0 33.2 38.0 6.4 38.0 145-149 32.12925 38.0 33.0 38.0 2.0 38.0 150 25.771 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 12.0 3 10.0 4 10.0 5 3.0 6 4.0 7 3.0 8 6.0 9 2.0 10 2.0 11 3.0 12 6.0 13 7.0 14 2.0 15 6.0 16 8.0 17 7.0 18 4.0 19 5.0 20 8.0 21 7.0 22 13.0 23 21.0 24 29.0 25 33.0 26 34.0 27 54.0 28 58.0 29 47.0 30 47.0 31 66.0 32 85.0 33 125.0 34 120.0 35 180.0 36 390.0 37 2583.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.997997997998 20.27027027027027 11.461461461461461 20.27027027027027 2 26.933667083854818 23.804755944931163 30.037546933667088 19.22403003754693 3 21.60200250312891 26.708385481852314 33.46683354192741 18.222778473091363 4 24.86229344016024 33.22483725588383 23.184777165748624 18.728092138207312 5 24.142248935637365 37.766090658652644 21.362384172301528 16.729276233408466 6 20.390292719539655 36.8026019514636 22.81711283462597 19.989992494370778 7 18.613960470352765 19.68976732549412 41.155866900175134 20.540405303977984 8 19.5896922692019 23.892919689767325 28.896672504378284 27.62071553665249 9 20.740555416562422 23.867900925694272 28.77157868401301 26.619964973730298 10-14 22.605824076853796 28.314820374261984 27.319123386370457 21.76023216251376 15-19 22.937202902176633 27.730798098573928 28.68651488616462 20.645484113084812 20-24 23.317488116087066 27.9459594696022 28.051038278709033 20.6855141356017 25-29 23.022266700025018 27.755816862646988 28.136102076557417 21.085814360770577 30-34 22.854855656176515 27.73302646720368 28.333416720868566 21.07870115575124 35-39 23.287464845319406 28.289473684210524 27.963037364403377 20.460024106066694 40-44 23.61867311958056 27.838273845533372 28.14075418431135 20.402298850574713 45-49 23.00380228136882 27.491494896938164 28.32699619771863 21.177706623974384 50-54 22.97723292469352 28.2661996497373 27.960970728046036 20.79559669752314 55-59 23.74781085814361 27.56067050287716 27.68076057042782 21.010758068551414 60-64 23.607705779334502 27.380535401551164 27.975981986489867 21.035776832624467 65-69 23.16853482786229 27.61709367493995 28.56285028022418 20.651521216973578 70-74 24.046641977780002 27.099389450505456 27.554799319387445 21.299169252327093 75-79 23.09732299224418 27.92594445834376 28.42131598699024 20.555416562421815 80-84 23.237358836097265 27.91738732322718 28.054735985349478 20.790517855326076 85-89 23.530324984475264 27.93935003104947 27.602980749327262 20.927344235148002 90-94 23.96401028277635 26.89974293059126 27.93316195372751 21.203084832904885 95-99 23.056701030927833 27.984536082474225 28.061855670103093 20.896907216494846 100-104 23.54799879626843 27.740997090982045 28.142240946935498 20.568763165814026 105-109 23.457593194896173 27.46059544658494 28.211158368776584 20.870652989742304 110-114 24.103077307980985 27.415561671253442 27.820865649236925 20.660495371528647 115-119 23.300970873786408 27.709938945050546 28.04023621259133 20.948853968571715 120-124 23.952964723542657 27.76582436827621 27.630723042281712 20.650487865899425 125-129 23.418586984046595 28.047606989111166 27.936186376297794 20.59761965054444 130-134 23.87669801462905 28.140020898641588 27.33019853709509 20.653082549634274 135-139 23.720209468846853 28.48135086031848 27.177514160521532 20.620925510313135 140-144 24.097463424902642 27.444479528470687 28.181244079570572 20.2768129670561 145-149 23.785282258064516 27.908266129032256 28.064516129032256 20.241935483870968 150 23.74874874874875 27.077077077077078 28.678678678678676 20.495495495495494 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.5 21 1.0 22 1.5 23 3.0 24 4.5 25 6.0 26 8.5 27 11.5 28 10.0 29 9.0 30 14.5 31 22.0 32 27.0 33 32.5 34 45.5 35 66.0 36 82.0 37 109.5 38 133.0 39 156.5 40 197.5 41 231.5 42 261.5 43 269.0 44 265.0 45 263.5 46 259.0 47 251.0 48 226.0 49 203.0 50 183.0 51 146.5 52 117.5 53 96.0 54 72.5 55 54.5 56 39.0 57 29.5 58 21.0 59 19.0 60 17.5 61 8.5 62 4.0 63 5.0 64 4.0 65 1.0 66 1.0 67 1.0 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.1 2 0.125 3 0.125 4 0.15 5 0.17500000000000002 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.06999999999999999 15-19 0.075 20-24 0.075 25-29 0.075 30-34 0.065 35-39 0.44 40-44 0.8200000000000001 45-49 0.06 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.08 70-74 0.09 75-79 0.075 80-84 1.71 85-89 3.38 90-94 2.75 95-99 3.0 100-104 0.31 105-109 0.075 110-114 0.075 115-119 0.09 120-124 0.075 125-129 1.275 130-134 4.3 135-139 6.43 140-144 4.99 145-149 0.8 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.3769791404875597 0.75 3 0.07539582809751194 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.0625 0.0 0.0 0.0 0.0 98-99 0.0875 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.175 0.0 0.0 0.0 0.0 106-107 0.2 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3125 0.0 0.0 0.0 0.0 112-113 0.44999999999999996 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.1375 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3125 0.0 0.0 0.0 0.0 136-137 1.4125 0.0 0.0 0.0 0.0 138 1.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTTTTA 10 0.0073311003 141.6125 1 >>END_MODULE Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048309 spots for SRR6031377.sra Written 1048309 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra Read 1048303 spots for SRR6031377.sra Written 1048303 spots for SRR6031377.sra SRR ids: ['SRR6031377.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_dsdwr2am SRR6031377.sra spots: 20966066 blocks: [[1, 1048303], [1048304, 2096606], [2096607, 3144909], [3144910, 4193212], [4193213, 5241515], [5241516, 6289818], [6289819, 7338121], [7338122, 8386424], [8386425, 9434727], [9434728, 10483030], [10483031, 11531333], [11531334, 12579636], [12579637, 13627939], [13627940, 14676242], [14676243, 15724545], [15724546, 16772848], [16772849, 17821151], [17821152, 18869454], [18869455, 19917757], [19917758, 20966066]] SRR6031377 file size 7042062 SRR6031377 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031377 SRR6031377_1.fastq SRR6031377_2.fastq Input file: SRR6031377_1.fastq Paired file: SRR6031377_2.fastq trimmed: SRR6031377-trimmed-pair1.fastq, SRR6031377-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:35:30 2025 >> started Fri Feb 14 05:35:56 2025 >> done (25.452s) 20966066 read pairs processed; of these: 55118 ( 0.26%) short read pairs filtered out after trimming by size control 55243 ( 0.26%) empty read pairs filtered out after trimming by size control 20855705 (99.47%) read pairs available; of these: 8128269 (38.97%) trimmed read pairs available after processing 12727436 (61.03%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 12 0.00% 20 13 0.00% 21 17 0.00% 22 17 0.00% 23 26 0.00% 24 32 0.00% 25 22 0.00% 26 30 0.00% 27 25 0.00% 28 29 0.00% 29 31 0.00% 30 35 0.00% 31 42 0.00% 32 32 0.00% 33 33 0.00% 34 34 0.00% 35 48 0.00% 36 45 0.00% 37 39 0.00% 38 44 0.00% 39 70 0.00% 40 88 0.00% 41 81 0.00% 42 76 0.00% 43 75 0.00% 44 87 0.00% 45 80 0.00% 46 98 0.00% 47 115 0.00% 48 121 0.00% 49 144 0.00% 50 126 0.00% 51 120 0.00% 52 131 0.00% 53 123 0.00% 54 130 0.00% 55 160 0.00% 56 138 0.00% 57 177 0.00% 58 172 0.00% 59 194 0.00% 60 166 0.00% 61 192 0.00% 62 231 0.00% 63 226 0.00% 64 231 0.00% 65 274 0.00% 66 326 0.00% 67 376 0.00% 68 614 0.00% 69 1631 0.01% 70 1239 0.01% 71 602 0.00% 72 575 0.00% 73 563 0.00% 74 609 0.00% 75 658 0.00% 76 703 0.00% 77 754 0.00% 78 873 0.00% 79 968 0.00% 80 1085 0.01% 81 1303 0.01% 82 1552 0.01% 83 2137 0.01% 84 5785 0.03% 85 5839 0.03% 86 6479 0.03% 87 6235 0.03% 88 6133 0.03% 89 6222 0.03% 90 6304 0.03% 91 6315 0.03% 92 6484 0.03% 93 6657 0.03% 94 6853 0.03% 95 7240 0.03% 96 7891 0.04% 97 9550 0.05% 98 11420 0.05% 99 8667 0.04% 100 9096 0.04% 101 9633 0.05% 102 10062 0.05% 103 10846 0.05% 104 11572 0.06% 105 12165 0.06% 106 12604 0.06% 107 12936 0.06% 108 13277 0.06% 109 13572 0.07% 110 13865 0.07% 111 14374 0.07% 112 15286 0.07% 113 15813 0.08% 114 16547 0.08% 115 16847 0.08% 116 17347 0.08% 117 17754 0.09% 118 18269 0.09% 119 18884 0.09% 120 20206 0.10% 121 20653 0.10% 122 21987 0.11% 123 22946 0.11% 124 24996 0.12% 125 27352 0.13% 126 27703 0.13% 127 28552 0.14% 128 29938 0.14% 129 31774 0.15% 130 33470 0.16% 131 35950 0.17% 132 38471 0.18% 133 41183 0.20% 134 44675 0.21% 135 49255 0.24% 136 53741 0.26% 137 61901 0.30% 138 67337 0.32% 139 74694 0.36% 140 80820 0.39% 141 88706 0.43% 142 99986 0.48% 143 116643 0.56% 144 140767 0.67% 145 176373 0.85% 146 240089 1.15% 147 378360 1.81% 148 758886 3.64% 149 4875025 23.38% 150 12727436 61.03% 20855705 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=12.19 fanout-score-rank=9 prefix-density=0.46 prefix-fanout=3.6 sequence=AAAGAAAGAAAAAGCCAAGAAACATGACTAGAGGCAATTGCAGCTAGCCTATTCCATCATTATTTAGCGCCAACACCCTTTCAGGCTTTCAGCATTCATATGGATGAACTTAAAGGCCCAACCTTCTTAAACAAAACCACGAAAGGTGACAGTTTATCACTAAGAGACAGAATTCTACCTCTATTATTCTCAAAATAAATCCCAATATCCCTGCATAAAACTCCGCAGTGACAAATGTCTTCAGGACAGAAAACTAGCTTGTACCCTAATGTGCCAGCCTTCTCAATCTTGAACCAGTTGGTTAATGTATGAACACCAGGATTTCCTTCTTCCCCACCCGTTGTCACAAACCATTGCACCTCCGAGTTGGAAGATTTCTGAATCTTCCAAACTGACGAGTGGTCACAGGCTTTCTTGATAGAAAACTTGATGTTAAGATCAGTAGAAACTCGGATGACATCATCTTCGGAGCTGGCAGGTGAGAAGGTAACTGGAAGACCTTGTAACTGGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=15 fanout-score=375.51 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=36.7 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=2.2 sequence=TGCCGTTCATGCTGAAGCAGTGATCGATG criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=39.21 fanout-score-rank=1 prefix-density=0.38 prefix-fanout=8.2 sequence=AGCAATGGCAGC SRR6031377 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:36:45 Started mapping on | Feb 14 05:36:45 Finished on | Feb 14 05:39:26 Mapping speed, Million of reads per hour | 466.34 Number of input reads | 20855705 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 19529144 Uniquely mapped reads % | 93.64% Average mapped length | 295.01 Number of splices: Total | 18660302 Number of splices: Annotated (sjdb) | 18335142 Number of splices: GT/AG | 18343720 Number of splices: GC/AG | 253874 Number of splices: AT/AC | 12210 Number of splices: Non-canonical | 50498 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 701392 % of reads mapped to multiple loci | 3.36% Number of reads mapped to too many loci | 29245 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.82% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 690151 690151 690151 N_multimapping 701392 701392 701392 N_noFeature 476187 19317090 561719 N_ambiguous 267374 1316 140079 UnstrandedReadsAssigned:18785583 PositiveStrandReadsAssigned:210738 NegativeStrandReadsAssigned:18827346 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031377 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031377-trimmed-pair1.fastq SRR6031377-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,855,705 reads, 18,834,635 reads pseudoaligned [quant] estimated average fragment length: 279.466 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,100 rounds 52401 SRR6031377.ke.tsv 34699 SRR6031377.se.tsv 87100 total ==> SRR6031377.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.53 495 14.0236 Potri.005G024800.1.v4.1 1035 756.534 151 9.83636 Potri.004G059700.1.v4.1 961 682.621 12 0.866338 Potri.007G009000.2.v4.1 1416 1137.53 0 0 Potri.003G141000.2.v4.1 2943 2664.53 654 12.096 Potri.016G087400.1.v4.1 270 63.137 1356 1058.43 Potri.015G069301.1.v4.1 564 294.825 0 0 Potri.010G195200.1.v4.1 1773 1494.53 64 2.11038 Potri.012G127500.1.v4.1 977 698.581 3093 218.197 ==> SRR6031377.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 80 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 16 SRR6031377 completed mapping pipeline successfully