Starting /dee2/code/volunteer_pipeline.sh SRR6031378 current disk space = 3085443035136 free memory = 1579086500 SRR6031378 SRAfilesize f84fb7a8007f0e1720f57c650b1d48f7 SRR6031378.sra SRR6031378.sra file validated SRR6031378 is paired end SRR6031378 is conventional basespace SRR6031378 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031378_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.2635 34.0 33.0 34.0 33.0 34.0 2 33.453 34.0 34.0 34.0 33.0 34.0 3 33.48875 34.0 34.0 34.0 33.0 34.0 4 33.47375 34.0 34.0 34.0 33.0 34.0 5 33.489 34.0 34.0 34.0 33.0 34.0 6 37.252 38.0 38.0 38.0 36.0 38.0 7 37.4225 38.0 38.0 38.0 37.0 38.0 8 37.45775 38.0 38.0 38.0 38.0 38.0 9 37.5315 38.0 38.0 38.0 38.0 38.0 10-14 37.49265 38.0 38.0 38.0 37.8 38.0 15-19 37.4852 38.0 38.0 38.0 37.6 38.0 20-24 37.52395 38.0 38.0 38.0 38.0 38.0 25-29 37.47265 38.0 38.0 38.0 37.8 38.0 30-34 37.4587 38.0 38.0 38.0 37.8 38.0 35-39 37.39375 38.0 38.0 38.0 37.4 38.0 40-44 37.22835 38.0 38.0 38.0 37.0 38.0 45-49 37.151799999999994 38.0 38.0 38.0 36.6 38.0 50-54 37.1491 38.0 38.0 38.0 36.4 38.0 55-59 37.138850000000005 38.0 38.0 38.0 36.8 38.0 60-64 37.08255 38.0 38.0 38.0 36.2 38.0 65-69 37.0676 38.0 38.0 38.0 36.2 38.0 70-74 37.028150000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.972699999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.8387 38.0 38.0 38.0 35.8 38.0 85-89 36.8295 38.0 38.0 38.0 36.0 38.0 90-94 36.819900000000004 38.0 38.0 38.0 35.8 38.0 95-99 36.729299999999995 38.0 38.0 38.0 35.0 38.0 100-104 36.5832 38.0 38.0 38.0 35.0 38.0 105-109 36.4812 38.0 38.0 38.0 34.4 38.0 110-114 36.516000000000005 38.0 38.0 38.0 34.4 38.0 115-119 36.354 38.0 38.0 38.0 34.2 38.0 120-124 36.07785 38.0 38.0 38.0 33.8 38.0 125-129 36.09325 38.0 38.0 38.0 33.8 38.0 130-134 35.91935 38.0 37.8 38.0 32.8 38.0 135-139 35.739549999999994 38.0 37.6 38.0 33.0 38.0 140-144 35.51885 38.0 36.6 38.0 32.6 38.0 145-149 34.97975 38.0 36.0 38.0 31.0 38.0 150 29.2755 35.0 28.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 1.0 11 0.0 12 1.0 13 0.0 14 2.0 15 0.0 16 5.0 17 3.0 18 4.0 19 7.0 20 4.0 21 2.0 22 8.0 23 6.0 24 15.0 25 7.0 26 17.0 27 25.0 28 19.0 29 34.0 30 33.0 31 49.0 32 38.0 33 60.0 34 94.0 35 153.0 36 390.0 37 3020.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.425270032655106 13.966340115548856 8.465209746294901 30.143180105501134 2 23.474999999999998 16.45 32.324999999999996 27.750000000000004 3 20.025000000000002 24.875 26.75 28.349999999999998 4 23.225 30.175 23.9 22.7 5 22.325 34.55 24.95 18.175 6 18.95 34.275 24.9 21.875 7 13.925 25.3 43.025000000000006 17.75 8 17.75 22.45 32.275 27.525 9 16.900000000000002 23.9 33.7 25.5 10-14 19.650000000000002 29.775000000000002 26.985 23.59 15-19 20.02 29.07 27.54 23.369999999999997 20-24 19.655 29.294999999999998 27.22 23.830000000000002 25-29 19.935 29.39 27.305 23.369999999999997 30-34 19.845 29.645 27.150000000000002 23.36 35-39 20.27 28.455000000000002 27.93 23.345 40-44 19.67 29.134999999999998 27.384999999999998 23.810000000000002 45-49 19.88 28.994999999999997 27.76 23.365 50-54 20.09 28.64 27.685 23.585 55-59 20.53 28.58 27.38 23.51 60-64 20.215 29.304999999999996 27.235 23.244999999999997 65-69 20.41102055102755 28.021401070053503 27.91139556977849 23.656182809140457 70-74 20.10701070107011 28.85788578857886 27.482748274827486 23.552355235523553 75-79 20.645 28.384999999999998 27.32 23.65 80-84 20.437043704370435 28.472847284728473 27.25272527252725 23.837383738373838 85-89 20.51 28.384999999999998 27.51 23.595 90-94 20.349999999999998 29.325000000000003 26.790000000000003 23.535 95-99 20.255000000000003 29.060000000000002 26.584999999999997 24.099999999999998 100-104 20.066003300165008 29.011450572528624 27.33136656832842 23.59117955897795 105-109 20.979999999999997 28.18 27.245 23.595 110-114 20.165 28.33 27.925 23.580000000000002 115-119 20.863561314854657 28.568569570220642 27.45784760094061 23.110021513984087 120-124 20.80852554160204 28.64361835192875 26.942512633211585 23.605343473257616 125-129 21.2056028014007 27.898949474737368 27.503751875937972 23.391695847923963 130-134 20.994198839767954 28.370674134826967 27.270454090818163 23.364672934586917 135-139 21.42 28.24 26.279999999999998 24.060000000000002 140-144 20.745 29.360000000000003 26.834999999999997 23.06 145-149 21.22 29.005 26.525 23.25 150 21.725 28.375 26.875 23.025000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 1.0 23 2.5 24 3.0 25 4.5 26 4.5 27 6.5 28 12.0 29 13.5 30 22.0 31 31.5 32 36.0 33 40.0 34 48.5 35 71.5 36 92.0 37 110.5 38 141.0 39 160.0 40 191.5 41 226.0 42 246.5 43 262.5 44 252.0 45 241.5 46 259.0 47 249.5 48 223.5 49 196.5 50 167.5 51 166.5 52 135.0 53 98.0 54 73.0 55 50.5 56 42.0 57 33.5 58 22.0 59 15.0 60 13.5 61 9.5 62 6.5 63 3.5 64 3.5 65 4.0 66 2.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.475 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.01 75-79 0.0 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.065 120-124 0.065 125-129 0.05 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.26915322580645 98.475 2 0.655241935483871 1.3 3 0.07560483870967742 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0125 0.0 0.0 0.0 54-55 0.0 0.025 0.0 0.0 0.0 56-57 0.0 0.025 0.0 0.0 0.0 58-59 0.0 0.025 0.0 0.0 0.0 60-61 0.0125 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.025 0.025 0.0 0.0 0.0 70-71 0.025 0.025 0.0 0.0 0.0 72-73 0.025 0.025 0.0 0.0 0.0 74-75 0.025 0.025 0.0 0.0 0.0 76-77 0.025 0.025 0.0 0.0 0.0 78-79 0.025 0.025 0.0 0.0 0.0 80-81 0.025 0.025 0.0 0.0 0.0 82-83 0.025 0.025 0.0 0.0 0.0 84-85 0.025 0.025 0.0 0.0 0.0 86-87 0.037500000000000006 0.025 0.0 0.0 0.0 88-89 0.05 0.025 0.0 0.0 0.0 90-91 0.05 0.025 0.0 0.0 0.0 92-93 0.075 0.025 0.0 0.0 0.0 94-95 0.1125 0.025 0.0 0.0 0.0 96-97 0.16249999999999998 0.025 0.0 0.0 0.0 98-99 0.225 0.025 0.0 0.0 0.0 100-101 0.2875 0.025 0.0 0.0 0.0 102-103 0.35 0.025 0.0 0.0 0.0 104-105 0.45 0.025 0.0 0.0 0.0 106-107 0.475 0.025 0.0 0.0 0.0 108-109 0.5125 0.025 0.0 0.0 0.0 110-111 0.6125 0.025 0.0 0.0 0.0 112-113 0.7 0.025 0.0 0.0 0.0 114-115 0.7875 0.025 0.0 0.0 0.0 116-117 0.9625 0.025 0.0 0.0 0.0 118-119 1.0875 0.025 0.0 0.0 0.0 120-121 1.2125 0.025 0.0 0.0 0.0 122-123 1.3625 0.025 0.0 0.0 0.0 124-125 1.6 0.025 0.0 0.0 0.0 126-127 1.8875 0.025 0.0 0.0 0.0 128-129 2.1625 0.025 0.0 0.0 0.0 130-131 2.3499999999999996 0.025 0.0 0.0 0.0 132-133 2.6125 0.025 0.0 0.0 0.0 134-135 2.8875 0.025 0.0 0.0 0.0 136-137 3.1125 0.025 0.0 0.0 0.0 138 3.3 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031378 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031378_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.60975 33.0 33.0 34.0 32.0 34.0 2 32.69875 34.0 33.0 34.0 32.0 34.0 3 32.6715 34.0 33.0 34.0 32.0 34.0 4 32.542 34.0 33.0 34.0 32.0 34.0 5 32.567 34.0 33.0 34.0 32.0 34.0 6 36.557 38.0 38.0 38.0 36.0 38.0 7 36.66775 38.0 38.0 38.0 36.0 38.0 8 36.69 38.0 38.0 38.0 36.0 38.0 9 36.58825 38.0 38.0 38.0 36.0 38.0 10-14 36.594649999999994 38.0 38.0 38.0 35.8 38.0 15-19 36.4944 38.0 38.0 38.0 35.8 38.0 20-24 36.50995 38.0 38.0 38.0 36.0 38.0 25-29 36.47245 38.0 38.0 38.0 35.8 38.0 30-34 36.477700000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.3517 38.0 38.0 38.0 35.8 38.0 40-44 36.12525 38.0 38.0 38.0 34.8 38.0 45-49 36.34415 38.0 38.0 38.0 35.4 38.0 50-54 36.399950000000004 38.0 38.0 38.0 35.8 38.0 55-59 36.31635 38.0 38.0 38.0 35.2 38.0 60-64 36.27145 38.0 38.0 38.0 35.0 38.0 65-69 36.248450000000005 38.0 38.0 38.0 35.2 38.0 70-74 36.1676 38.0 38.0 38.0 35.0 38.0 75-79 36.1045 38.0 38.0 38.0 34.2 38.0 80-84 35.69735000000001 38.0 38.0 38.0 33.6 38.0 85-89 35.084950000000006 38.0 38.0 38.0 30.8 38.0 90-94 34.97675 38.0 38.0 38.0 30.6 38.0 95-99 34.8833 38.0 38.0 38.0 29.2 38.0 100-104 35.41915 38.0 38.0 38.0 30.8 38.0 105-109 35.678650000000005 38.0 38.0 38.0 33.4 38.0 110-114 35.65015 38.0 38.0 38.0 33.6 38.0 115-119 35.5313 38.0 38.0 38.0 33.0 38.0 120-124 35.46305 38.0 38.0 38.0 32.8 38.0 125-129 34.92975 38.0 38.0 38.0 30.4 38.0 130-134 33.7821 38.0 36.6 38.0 17.4 38.0 135-139 32.9865 38.0 36.0 38.0 6.4 38.0 140-144 32.9165 38.0 35.8 38.0 2.0 38.0 145-149 32.364999999999995 38.0 34.4 38.0 2.0 38.0 150 26.311 33.0 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 24.0 3 18.0 4 7.0 5 5.0 6 4.0 7 2.0 8 7.0 9 7.0 10 6.0 11 2.0 12 7.0 13 9.0 14 5.0 15 5.0 16 5.0 17 8.0 18 9.0 19 10.0 20 7.0 21 14.0 22 18.0 23 13.0 24 26.0 25 16.0 26 30.0 27 39.0 28 36.0 29 55.0 30 47.0 31 45.0 32 61.0 33 93.0 34 88.0 35 183.0 36 332.0 37 2757.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 44.3 20.225 13.025 22.45 2 28.349999999999998 21.6 32.225 17.825 3 20.0 25.074999999999996 35.55 19.375 4 23.724999999999998 34.35 23.775 18.15 5 24.275 36.425000000000004 22.1 17.2 6 18.775 37.3 24.025 19.900000000000002 7 19.650000000000002 18.875 40.225 21.25 8 19.475 24.0 28.749999999999996 27.775 9 20.95 24.7 29.025000000000002 25.324999999999996 10-14 22.825 28.455000000000002 27.145000000000003 21.575 15-19 23.16 27.375 28.139999999999997 21.325 20-24 22.400000000000002 28.305000000000003 28.035 21.26 25-29 23.075000000000003 27.665 28.28 20.979999999999997 30-34 22.61 27.97 28.349999999999998 21.07 35-39 22.984760376980148 27.84740324844596 27.807298977341087 21.360537397232807 40-44 22.484371849163136 28.528937285743094 27.959265981044567 21.027424884049204 45-49 23.124624924984996 26.9503900780156 28.845769153830762 21.079215843168633 50-54 23.24 26.815 28.64 21.305 55-59 23.1 28.1 28.425 20.375 60-64 22.85 27.805000000000003 28.310000000000002 21.035 65-69 23.665 27.405 28.12 20.810000000000002 70-74 23.745 26.805 28.74 20.71 75-79 23.345 26.810000000000002 28.455000000000002 21.39 80-84 22.79646017699115 27.94943109987358 28.126422250316057 21.127686472819214 85-89 23.055512602443173 27.993402401938045 28.0913354981702 20.859749497448586 90-94 23.212627669452182 27.463117713814096 28.360672650366244 20.96358196636748 95-99 22.77860863287092 28.183177762879687 27.89954102418648 21.138672580062916 100-104 23.57081804012268 27.542862889034144 27.839509276484485 21.04680979435869 105-109 23.474999999999998 27.255000000000003 28.810000000000002 20.46 110-114 23.385 27.279999999999998 28.83 20.505000000000003 115-119 23.674999999999997 27.839999999999996 28.01 20.474999999999998 120-124 23.69 27.665 27.845 20.8 125-129 23.611742711333434 27.66408973775959 28.088525087160832 20.635642463746148 130-134 23.87345197210948 27.843688208970757 27.833281298782392 20.449578520137372 135-139 24.09875232280329 27.53915582691797 27.379877886912663 20.98221396336607 140-144 23.68116247235969 28.187848794356114 27.73507423396862 20.395914499315573 145-149 24.14037216828479 27.472694174757283 27.993527508090615 20.393406148867314 150 24.675 27.05 27.725 20.549999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 1.5 17 1.0 18 0.0 19 0.5 20 0.5 21 2.0 22 2.0 23 1.5 24 4.5 25 5.5 26 5.0 27 10.0 28 14.0 29 17.0 30 19.5 31 22.0 32 27.5 33 36.0 34 53.5 35 70.0 36 86.0 37 110.5 38 133.0 39 162.5 40 195.5 41 224.0 42 244.0 43 261.5 44 265.0 45 266.0 46 269.5 47 250.5 48 217.0 49 196.5 50 189.5 51 153.0 52 113.5 53 87.5 54 67.0 55 53.5 56 41.5 57 32.0 58 26.5 59 19.5 60 13.0 61 7.5 62 4.0 63 5.5 64 4.5 65 1.5 66 0.0 67 0.0 68 0.5 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.26 40-44 0.8200000000000001 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.125 85-89 2.995 90-94 3.0700000000000003 95-99 3.045 100-104 0.555 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.045 130-134 3.91 135-139 5.825 140-144 5.029999999999999 145-149 1.1199999999999999 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.16645617580197 98.15 2 0.6819904016165698 1.35 3 0.10103561505430665 0.3 4 0.050517807527153326 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.037500000000000006 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.5375 0.0 0.0 0.0 0.0 110-111 0.6375 0.0 0.0 0.0 0.0 112-113 0.75 0.0 0.0 0.0 0.0 114-115 0.8375 0.0 0.0 0.0 0.0 116-117 1.0125 0.0 0.0 0.0 0.0 118-119 1.125 0.0 0.0 0.0 0.0 120-121 1.2375 0.0 0.0 0.0 0.0 122-123 1.3624999999999998 0.0 0.0 0.0 0.0 124-125 1.5375 0.0 0.0 0.0 0.0 126-127 1.8 0.0 0.0 0.0 0.0 128-129 2.0375 0.0 0.0 0.0 0.0 130-131 2.2249999999999996 0.0 0.0 0.0 0.0 132-133 2.4875 0.0 0.0 0.0 0.0 134-135 2.7625 0.0 0.0 0.0 0.0 136-137 2.9749999999999996 0.0 0.0 0.0 0.0 138 3.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917200 spots for SRR6031378.sra Written 917200 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra Read 917189 spots for SRR6031378.sra Written 917189 spots for SRR6031378.sra SRR ids: ['SRR6031378.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rjglwfun SRR6031378.sra spots: 18343791 blocks: [[1, 917189], [917190, 1834378], [1834379, 2751567], [2751568, 3668756], [3668757, 4585945], [4585946, 5503134], [5503135, 6420323], [6420324, 7337512], [7337513, 8254701], [8254702, 9171890], [9171891, 10089079], [10089080, 11006268], [11006269, 11923457], [11923458, 12840646], [12840647, 13757835], [13757836, 14675024], [14675025, 15592213], [15592214, 16509402], [16509403, 17426591], [17426592, 18343791]] SRR6031378 file size 6158580 SRR6031378 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031378 SRR6031378_1.fastq SRR6031378_2.fastq Input file: SRR6031378_1.fastq Paired file: SRR6031378_2.fastq trimmed: SRR6031378-trimmed-pair1.fastq, SRR6031378-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:18:15 2025 >> started Fri Feb 14 06:18:34 2025 >> done (18.697s) 18343791 read pairs processed; of these: 36878 ( 0.20%) short read pairs filtered out after trimming by size control 50270 ( 0.27%) empty read pairs filtered out after trimming by size control 18256643 (99.52%) read pairs available; of these: 6009205 (32.92%) trimmed read pairs available after processing 12247438 (67.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 4 0.00% 20 4 0.00% 21 5 0.00% 22 9 0.00% 23 11 0.00% 24 12 0.00% 25 20 0.00% 26 21 0.00% 27 20 0.00% 28 20 0.00% 29 22 0.00% 30 16 0.00% 31 13 0.00% 32 15 0.00% 33 16 0.00% 34 20 0.00% 35 22 0.00% 36 24 0.00% 37 22 0.00% 38 26 0.00% 39 36 0.00% 40 44 0.00% 41 48 0.00% 42 55 0.00% 43 51 0.00% 44 49 0.00% 45 64 0.00% 46 93 0.00% 47 71 0.00% 48 82 0.00% 49 90 0.00% 50 110 0.00% 51 104 0.00% 52 108 0.00% 53 91 0.00% 54 115 0.00% 55 127 0.00% 56 129 0.00% 57 133 0.00% 58 150 0.00% 59 183 0.00% 60 204 0.00% 61 193 0.00% 62 239 0.00% 63 255 0.00% 64 257 0.00% 65 294 0.00% 66 429 0.00% 67 730 0.00% 68 830 0.00% 69 1043 0.01% 70 1181 0.01% 71 677 0.00% 72 646 0.00% 73 658 0.00% 74 797 0.00% 75 784 0.00% 76 837 0.00% 77 930 0.01% 78 948 0.01% 79 1126 0.01% 80 1231 0.01% 81 1480 0.01% 82 1677 0.01% 83 2225 0.01% 84 4602 0.03% 85 4667 0.03% 86 4761 0.03% 87 4838 0.03% 88 4952 0.03% 89 5197 0.03% 90 5368 0.03% 91 5605 0.03% 92 5733 0.03% 93 6176 0.03% 94 6434 0.04% 95 6862 0.04% 96 7123 0.04% 97 7743 0.04% 98 7967 0.04% 99 8392 0.05% 100 8606 0.05% 101 9165 0.05% 102 9869 0.05% 103 10515 0.06% 104 11107 0.06% 105 11881 0.07% 106 12660 0.07% 107 12802 0.07% 108 13300 0.07% 109 13712 0.08% 110 14089 0.08% 111 14780 0.08% 112 15638 0.09% 113 16573 0.09% 114 17190 0.09% 115 18128 0.10% 116 18795 0.10% 117 19473 0.11% 118 19766 0.11% 119 20293 0.11% 120 20797 0.11% 121 21939 0.12% 122 22782 0.12% 123 24383 0.13% 124 25553 0.14% 125 26764 0.15% 126 28796 0.16% 127 29360 0.16% 128 30870 0.17% 129 32265 0.18% 130 33371 0.18% 131 35312 0.19% 132 37891 0.21% 133 39608 0.22% 134 42595 0.23% 135 45364 0.25% 136 49281 0.27% 137 55139 0.30% 138 59979 0.33% 139 63552 0.35% 140 67365 0.37% 141 72205 0.40% 142 77180 0.42% 143 86728 0.48% 144 101268 0.55% 145 124136 0.68% 146 162389 0.89% 147 238205 1.30% 148 469632 2.57% 149 3477802 19.05% 150 12247438 67.08% 18256643 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=31 prefix-density=0.31 prefix-fanout=2.0 sequence=AATCCTGGATTTGCTTCACCTGCTACATTGGAAGCACCTCGGATCACGATGAATGGCTTTTCATTTGATAAAGATGTCCAAGCTACAGCAGCGCTTTCTTGATCGGCAGTTGAGACGTTAAAAACTTTGTGAAGGAAATCTCCATATGCTTTATTTTTAATGTAAGAATCAGAACTAGAGCCGTTAGTTCCAAACACAATCTTAGGCTTGGAAGGTAGGCAAGCTCTATCGTAGCATTGTCTCAACTCCAAATCCTGAAGCACTTGAGTGGCAGCACTATACCAGGATGTTGTGCTGGGAAACCAGAAAACATCCTGCGGTGATTGTCCTTTAGAGAACAATTTTATTTTATCATAGTCTACGCTAGCCAACAAGTTCTCTCCGTTCACTGGATAATTAAACTCGCCAAAGTTCAGCGTCCCTTCATCTGACCCGAATTTCTTCCAATTCCAAGCTCCTGTGAAAGCAACAGCAAGCGGCACGGAAACATCACCTGGCACTATACTTTCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=55.12 fanout-score-rank=1 prefix-density=0.32 prefix-fanout=12.0 sequence=CTTCTCATCAAGGT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=17 prefix-density=0.70 prefix-fanout=1.6 sequence=TTTCTTCTCTTCGCCTTTGTTCTCTCCGTGCCGTCAATAGAAGCTTATACTGAGCCGGTGCTTGACATTCAGGGCGAAGAACTTAAAGCAGGCACGGAATACATCATCACTTCTGCTATCTGGGGGGCTGGAGGCGGGGATGTTTCGGCGACCAATAAAACGTGCCCGGATGATGTTATTCAATACTCGTTGGACCAGTTACAAGGTCTTCCAGTTACCTTCTCACCTGCCAGCTCCGAAGATGATGTCATCCGAGTTTCTACTGATCTTAACATCAAGTTTTCTATCAAGAAAGCCTGTGACCACTCGTCAGTTTGGAAGATTCAGAAATCTTCCAACTCGGAGGTGCAATGGTTTGTGACAACGGGTGGGGAAGAAGGAAATCCTGGTGTTCATACATTAACCAACTGGTTCAAGATTGAGAAGGCTGGCACATTAGGGTACAAGCTAGTTTTCTGTCCTGAAGACATTTGTCACTGCGGAGTTTTATGCAGGGATATTGGGATTTATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=62.61 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=7.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR6031378 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:19:21 Started mapping on | Feb 14 06:19:21 Finished on | Feb 14 06:21:48 Mapping speed, Million of reads per hour | 447.10 Number of input reads | 18256643 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 17107166 Uniquely mapped reads % | 93.70% Average mapped length | 294.89 Number of splices: Total | 16308413 Number of splices: Annotated (sjdb) | 16024625 Number of splices: GT/AG | 16039614 Number of splices: GC/AG | 211696 Number of splices: AT/AC | 10160 Number of splices: Non-canonical | 46943 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.77 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 655289 % of reads mapped to multiple loci | 3.59% Number of reads mapped to too many loci | 28644 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.51% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 531804 531804 531804 N_multimapping 655289 655289 655289 N_noFeature 406646 16852608 549450 N_ambiguous 231018 1400 118262 UnstrandedReadsAssigned:16469502 PositiveStrandReadsAssigned:253158 NegativeStrandReadsAssigned:16439454 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031378 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031378-trimmed-pair1.fastq SRR6031378-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,256,643 reads, 16,430,496 reads pseudoaligned [quant] estimated average fragment length: 261.901 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR6031378.ke.tsv 34699 SRR6031378.se.tsv 87100 total ==> SRR6031378.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.1 347 11.0912 Potri.005G024800.1.v4.1 1035 774.099 121 8.77879 Potri.004G059700.1.v4.1 961 700.155 13 1.04279 Potri.007G009000.2.v4.1 1416 1155.1 0 0 Potri.003G141000.2.v4.1 2943 2682.1 398.131 8.33675 Potri.016G087400.1.v4.1 270 69.8561 1285 1033.11 Potri.015G069301.1.v4.1 564 309.862 0 0 Potri.010G195200.1.v4.1 1773 1512.1 43 1.59711 Potri.012G127500.1.v4.1 977 716.12 1880 147.441 ==> SRR6031378.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 199 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 290 Potri.001G212900.v4.1 108 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR6031378 completed mapping pipeline successfully