Starting /dee2/code/volunteer_pipeline.sh SRR6031379 current disk space = 3085311569920 free memory = 1572952544 SRR6031379 SRAfilesize 6e891acba77ca9b6d0063d326c22a053 SRR6031379.sra SRR6031379.sra file validated SRR6031379 is paired end SRR6031379 is conventional basespace SRR6031379 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031379_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92 34.0 33.0 34.0 33.0 34.0 2 33.44175 34.0 34.0 34.0 33.0 34.0 3 33.49925 34.0 34.0 34.0 33.0 34.0 4 33.485 34.0 34.0 34.0 33.0 34.0 5 33.535 34.0 34.0 34.0 33.0 34.0 6 37.23775 38.0 38.0 38.0 36.0 38.0 7 37.43475 38.0 38.0 38.0 37.0 38.0 8 37.546 38.0 38.0 38.0 38.0 38.0 9 37.582 38.0 38.0 38.0 38.0 38.0 10-14 37.5621 38.0 38.0 38.0 38.0 38.0 15-19 37.59259999999999 38.0 38.0 38.0 38.0 38.0 20-24 37.56075 38.0 38.0 38.0 38.0 38.0 25-29 37.501400000000004 38.0 38.0 38.0 38.0 38.0 30-34 37.44005 38.0 38.0 38.0 37.6 38.0 35-39 37.4119 38.0 38.0 38.0 37.8 38.0 40-44 37.3548 38.0 38.0 38.0 37.0 38.0 45-49 37.29005 38.0 38.0 38.0 37.0 38.0 50-54 37.27804999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.1941 38.0 38.0 38.0 36.8 38.0 60-64 37.2017 38.0 38.0 38.0 37.0 38.0 65-69 37.119600000000005 38.0 38.0 38.0 36.4 38.0 70-74 37.08025 38.0 38.0 38.0 36.6 38.0 75-79 37.00019999999999 38.0 38.0 38.0 36.2 38.0 80-84 37.0273 38.0 38.0 38.0 36.0 38.0 85-89 36.997 38.0 38.0 38.0 36.0 38.0 90-94 36.91625 38.0 38.0 38.0 35.8 38.0 95-99 36.820100000000004 38.0 38.0 38.0 35.6 38.0 100-104 36.7074 38.0 38.0 38.0 35.2 38.0 105-109 36.569599999999994 38.0 38.0 38.0 34.6 38.0 110-114 35.9114 38.0 37.2 38.0 29.8 38.0 115-119 36.4322 38.0 38.0 38.0 34.0 38.0 120-124 36.3652 38.0 38.0 38.0 34.0 38.0 125-129 36.230850000000004 38.0 38.0 38.0 34.0 38.0 130-134 35.96235 38.0 38.0 38.0 33.2 38.0 135-139 35.6464 38.0 37.8 38.0 31.4 38.0 140-144 35.38135 38.0 37.2 38.0 31.0 38.0 145-149 34.75915 38.0 36.0 38.0 30.0 38.0 150 27.36025 33.0 22.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 2.0 10 2.0 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 3.0 17 1.0 18 2.0 19 3.0 20 2.0 21 6.0 22 4.0 23 8.0 24 8.0 25 10.0 26 13.0 27 18.0 28 22.0 29 28.0 30 44.0 31 36.0 32 47.0 33 81.0 34 100.0 35 177.0 36 397.0 37 2980.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.17737003058104 13.226299694189603 10.77981651376147 29.81651376146789 2 24.725 16.225 31.75 27.3 3 19.575 26.0 26.275 28.15 4 22.85 29.475 24.2 23.474999999999998 5 22.5 34.849999999999994 23.225 19.425 6 18.025 35.85 26.025 20.1 7 14.025000000000002 25.074999999999996 42.675000000000004 18.224999999999998 8 17.849999999999998 25.224999999999998 29.2 27.725 9 16.775000000000002 23.75 33.5 25.974999999999998 10-14 19.77 30.28 27.43 22.52 15-19 19.515 29.455 27.994999999999997 23.035 20-24 19.88 29.175 27.589999999999996 23.355 25-29 19.905 29.294999999999998 28.16 22.64 30-34 19.98 29.25 28.16 22.61 35-39 20.315 29.299999999999997 27.395000000000003 22.99 40-44 20.51 28.765 28.33 22.395 45-49 19.939999999999998 29.205 27.58 23.275000000000002 50-54 19.34 29.265 27.88 23.515 55-59 19.595000000000002 28.93 27.525 23.95 60-64 19.21 29.220000000000002 27.994999999999997 23.575 65-69 19.415 28.925 27.77 23.89 70-74 19.575 28.735 28.015 23.674999999999997 75-79 20.255000000000003 28.455000000000002 27.73 23.56 80-84 20.615 28.42 28.02 22.945 85-89 20.075000000000003 28.660000000000004 28.12 23.145 90-94 20.794999999999998 27.97 27.884999999999998 23.35 95-99 20.375 28.335 28.299999999999997 22.99 100-104 20.544999999999998 28.660000000000004 27.944999999999997 22.85 105-109 20.03 28.325 27.855 23.79 110-114 20.330000000000002 28.38 27.805000000000003 23.485 115-119 20.155 28.494999999999997 27.63 23.72 120-124 20.395 28.1 28.33 23.175 125-129 20.39 28.08 27.965 23.565 130-134 20.79 28.255000000000003 27.165 23.79 135-139 20.945 28.485 27.51 23.06 140-144 20.365 28.92 27.235 23.48 145-149 20.87 28.194999999999997 27.650000000000002 23.285 150 20.775 28.025 27.325 23.875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 4.0 1 2.5 2 1.0 3 0.5 4 0.0 5 0.5 6 0.5 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 1.0 19 1.0 20 1.0 21 0.5 22 3.5 23 6.0 24 4.5 25 4.5 26 7.5 27 9.0 28 16.0 29 18.0 30 22.5 31 36.0 32 46.5 33 56.5 34 57.5 35 81.0 36 111.0 37 119.5 38 131.0 39 158.0 40 182.5 41 221.0 42 234.0 43 238.0 44 262.0 45 261.0 46 267.0 47 257.5 48 220.0 49 198.5 50 172.5 51 127.5 52 108.5 53 96.0 54 70.0 55 54.5 56 38.5 57 22.0 58 16.0 59 11.5 60 11.5 61 9.0 62 3.0 63 3.5 64 3.5 65 1.0 66 2.0 67 2.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4777470455116922 0.95 3 0.0 0.0 4 0.0 0.0 5 0.025144581342720643 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.1375 0.0 0.0 0.0 0.0 96-97 0.175 0.0 0.0 0.0 0.0 98-99 0.225 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.38749999999999996 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.7 0.0 0.0 0.0 0.0 120-121 0.8 0.0 0.0 0.0 0.0 122-123 0.975 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.4 0.0 0.0 0.0 0.0 128-129 1.6125 0.0 0.0 0.0 0.0 130-131 1.8624999999999998 0.0 0.0 0.0 0.0 132-133 2.0250000000000004 0.0 0.0 0.0 0.0 134-135 2.2249999999999996 0.0 0.0 0.0 0.0 136-137 2.4749999999999996 0.0 0.0 0.0 0.0 138 2.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031379 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031379_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 34 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 13.7765 18.0 2.0 25.0 2.0 32.0 2 14.06325 18.0 2.0 25.0 2.0 32.0 3 14.06375 18.0 2.0 25.0 2.0 32.0 4 13.20175 15.0 2.0 25.0 2.0 32.0 5 12.78675 15.0 2.0 25.0 2.0 31.0 6 14.104 15.0 2.0 26.0 2.0 37.0 7 13.913 15.0 2.0 26.0 2.0 37.0 8 13.77775 14.0 2.0 26.0 2.0 37.0 9 13.71825 14.0 2.0 26.0 2.0 37.0 10-14 13.35285 4.4 2.0 26.0 2.0 37.0 15-19 12.5992 2.0 2.0 20.8 2.0 37.0 20-24 11.95455 2.0 2.0 16.0 2.0 36.2 25-29 11.537899999999999 2.0 2.0 16.0 2.0 36.0 30-34 11.1692 2.0 2.0 16.0 2.0 36.0 35-39 10.774799999999999 2.0 2.0 16.0 2.0 35.8 40-44 10.459050000000001 2.0 2.0 16.0 2.0 35.4 45-49 10.09145 2.0 2.0 16.0 2.0 34.8 50-54 9.88825 2.0 2.0 16.0 2.0 34.6 55-59 9.692499999999999 2.0 2.0 16.0 2.0 34.8 60-64 9.3163 2.0 2.0 16.0 2.0 33.8 65-69 9.121599999999999 2.0 2.0 16.0 2.0 33.8 70-74 8.802449999999999 2.0 2.0 15.4 2.0 33.0 75-79 8.495299999999999 2.0 2.0 14.8 2.0 31.6 80-84 8.2324 2.0 2.0 14.0 2.0 30.8 85-89 7.8788 2.0 2.0 4.2 2.0 29.0 90-94 7.7423 2.0 2.0 2.0 2.0 29.0 95-99 7.4199 2.0 2.0 2.0 2.0 28.4 100-104 7.129099999999999 2.0 2.0 2.0 2.0 28.0 105-109 6.8207 2.0 2.0 2.0 2.0 26.6 110-114 6.491200000000001 2.0 2.0 2.0 2.0 26.4 115-119 6.093 2.0 2.0 2.0 2.0 23.4 120-124 5.793899999999999 2.0 2.0 2.0 2.0 22.6 125-129 5.46795 2.0 2.0 2.0 2.0 15.0 130-134 5.0710500000000005 2.0 2.0 2.0 2.0 15.0 135-139 4.7055 2.0 2.0 2.0 2.0 13.6 140-144 4.4185 2.0 2.0 2.0 2.0 4.2 145-149 3.8512 2.0 2.0 2.0 2.0 2.0 150 3.25875 2.0 2.0 2.0 2.0 2.0 >>END_MODULE >>Per sequence quality scores fail #Quality Count 2 1939.0 3 260.0 4 170.0 5 109.0 6 110.0 7 95.0 8 69.0 9 75.0 10 55.0 11 68.0 12 60.0 13 58.0 14 49.0 15 54.0 16 49.0 17 72.0 18 46.0 19 49.0 20 40.0 21 45.0 22 45.0 23 29.0 24 40.0 25 29.0 26 43.0 27 31.0 28 31.0 29 22.0 30 31.0 31 45.0 32 28.0 33 38.0 34 36.0 35 38.0 36 24.0 37 18.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 19.68898921494858 33.358414848256835 24.278906445949335 22.67368949084525 2 17.678300455235206 38.94790085988872 22.05361659079413 21.320182094081943 3 15.05185934733114 41.892233746521626 22.489248671894764 20.566658234252465 4 16.09311740890688 40.61234817813765 22.596153846153847 20.698380566801617 5 16.16902834008097 40.561740890688256 21.73582995951417 21.5334008097166 6 15.544303797468354 39.39240506329114 22.68354430379747 22.379746835443036 7 15.561740890688258 44.66093117408907 20.318825910931174 19.458502024291498 8 15.793470007593013 41.736269298911665 20.399898759807645 22.070361933687675 9 14.047076689445708 43.30549228043533 20.475828904074916 22.17160212604404 10-14 14.305239179954443 43.55353075170843 20.268286509744367 21.872943558592763 15-19 13.592183861496407 44.76055482433938 19.85926900880834 21.78799230535588 20-24 13.65799331780905 44.892173736964665 19.62134251290878 21.828490432317505 25-29 13.763604150847886 45.203745887117186 19.41280688433308 21.619843077701848 30-34 12.92771816157117 46.91233043126139 19.09293379226564 21.0670176149018 35-39 13.203057763377716 47.49658279754974 17.75426517491014 21.546094264162406 40-44 13.401174564601053 47.70656136087485 17.421020656136086 21.47124341838801 45-49 13.297899266008606 47.3955960516325 17.86383194128069 21.44267274107821 50-54 12.748620881623566 48.36277139531353 17.030214079659903 21.858393643403005 55-59 13.389015439129334 47.851176917236145 17.074158440901037 21.685649202733483 60-64 12.77274338075229 49.091277274338076 16.762010833797397 21.37396851111224 65-69 12.69174302637574 48.2711486862755 17.14169999493748 21.89540829241128 70-74 12.665789207249164 49.52414700820087 15.784144983294524 22.025918801255443 75-79 12.246241077304713 50.42778312155116 15.683693616159571 21.64228218498456 80-84 12.105716166270062 50.50377196091337 15.923244392688979 21.46726748012759 85-89 12.080400992354818 50.8581843957268 15.270112905675662 21.79130170624272 90-94 12.089302890700147 50.75684706120589 14.93444033817648 22.219409709917482 95-99 10.99240506329114 51.98481012658228 14.891139240506329 22.131645569620254 100-104 11.623550853034983 51.78453905735838 14.742064496532173 21.84984559307447 105-109 11.287710062765742 51.97914557602754 14.253897550111358 22.47924681109536 110-114 10.942403077234538 52.54074299018119 14.27776090697439 22.23909302560988 115-119 11.009870918754745 52.47785370792204 13.414325487218425 23.097949886104786 120-124 11.046982584042123 52.749088699878484 13.23410287565816 22.969825840421223 125-129 11.321518987341772 52.946835443037976 13.230379746835444 22.50126582278481 130-134 10.695484915974895 53.90767361814133 12.477222109738815 22.919619356144967 135-139 10.39493670886076 54.39493670886076 12.278481012658228 22.931645569620255 140-144 10.562560129626815 54.30148361942378 12.552534305534458 22.58342194541496 145-149 11.00759493670886 53.741772151898736 12.415189873417722 22.835443037974684 150 8.481012658227847 62.607594936708864 10.253164556962027 18.658227848101266 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 68.0 1 45.5 2 15.5 3 6.5 4 4.5 5 3.5 6 6.0 7 7.5 8 5.0 9 4.0 10 5.5 11 8.5 12 8.5 13 9.5 14 10.5 15 15.0 16 20.0 17 23.0 18 32.0 19 42.5 20 47.5 21 58.5 22 66.0 23 68.5 24 78.0 25 73.5 26 85.5 27 98.5 28 103.5 29 118.0 30 129.0 31 133.5 32 138.5 33 147.0 34 150.0 35 147.5 36 149.0 37 156.0 38 145.5 39 145.0 40 156.0 41 147.0 42 137.0 43 123.5 44 121.0 45 127.5 46 103.0 47 93.5 48 89.0 49 68.0 50 50.5 51 48.0 52 48.0 53 33.0 54 26.0 55 21.0 56 14.5 57 12.0 58 10.0 59 6.5 60 6.0 61 5.0 62 2.5 63 1.5 64 0.5 65 0.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 1.15 3 1.175 4 1.2 5 1.2 6 1.25 7 1.2 8 1.225 9 1.225 10-14 1.225 15-19 1.23 20-24 1.23 25-29 1.225 30-34 1.22 35-39 1.2349999999999999 40-44 1.24 45-49 1.225 50-54 1.205 55-59 1.225 60-64 1.2349999999999999 65-69 1.2349999999999999 70-74 1.23 75-79 1.2349999999999999 80-84 1.2449999999999999 85-89 1.2449999999999999 90-94 1.2349999999999999 95-99 1.25 100-104 1.2349999999999999 105-109 1.22 110-114 1.21 115-119 1.225 120-124 1.24 125-129 1.25 130-134 1.22 135-139 1.25 140-144 1.2550000000000001 145-149 1.25 150 1.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77023232065356 97.7 2 0.10211896859841717 0.2 3 0.0 0.0 4 0.0 0.0 5 0.025529742149604292 0.125 6 0.025529742149604292 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.07658922644881287 1.825 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 34 0.8500000000000001 No Hit ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 26 0.65 No Hit NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 13 0.325 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit GAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0 0.0 0.0 0.0 0.0 90-91 0.0 0.0 0.0 0.0 0.0 92-93 0.0 0.0 0.0 0.0 0.0 94-95 0.0 0.0 0.0 0.0 0.0 96-97 0.0 0.0 0.0 0.0 0.0 98-99 0.0 0.0 0.0 0.0 0.0 100-101 0.0 0.0 0.0 0.0 0.0 102-103 0.0 0.0 0.0 0.0 0.0 104-105 0.0 0.0 0.0 0.0 0.0 106-107 0.0 0.0 0.0 0.0 0.0 108-109 0.0 0.0 0.0 0.0 0.0 110-111 0.0 0.0 0.0 0.0 0.0 112-113 0.0 0.0 0.0 0.0 0.0 114-115 0.0 0.0 0.0 0.0 0.0 116-117 0.0 0.0 0.0 0.0 0.0 118-119 0.0125 0.0 0.0 0.0 0.0 120-121 0.025 0.0 0.0 0.0 0.0 122-123 0.025 0.0 0.0 0.0 0.0 124-125 0.025 0.0 0.0 0.0 0.0 126-127 0.025 0.0 0.0 0.0 0.0 128-129 0.025 0.0 0.0 0.0 0.0 130-131 0.025 0.0 0.0 0.0 0.0 132-133 0.05 0.0 0.0 0.0 0.0 134-135 0.0625 0.0 0.0 0.0 0.0 136-137 0.1 0.0 0.0 0.0 0.0 138 0.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029162 spots for SRR6031379.sra Written 1029162 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra Read 1029146 spots for SRR6031379.sra Written 1029146 spots for SRR6031379.sra SRR ids: ['SRR6031379.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ytmn7f5 SRR6031379.sra spots: 20582936 blocks: [[1, 1029146], [1029147, 2058292], [2058293, 3087438], [3087439, 4116584], [4116585, 5145730], [5145731, 6174876], [6174877, 7204022], [7204023, 8233168], [8233169, 9262314], [9262315, 10291460], [10291461, 11320606], [11320607, 12349752], [12349753, 13378898], [13378899, 14408044], [14408045, 15437190], [15437191, 16466336], [16466337, 17495482], [17495483, 18524628], [18524629, 19553774], [19553775, 20582936]] SRR6031379 file size 6912980 SRR6031379 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031379 SRR6031379_1.fastq SRR6031379_2.fastq Input file: SRR6031379_1.fastq Paired file: SRR6031379_2.fastq trimmed: SRR6031379-trimmed-pair1.fastq, SRR6031379-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:23:12 2025 >> started Fri Feb 14 06:23:36 2025 >> done (24.121s) 20582936 read pairs processed; of these: 740384 ( 3.60%) short read pairs filtered out after trimming by size control 2147502 (10.43%) empty read pairs filtered out after trimming by size control 17695050 (85.97%) read pairs available; of these: 11626685 (65.71%) trimmed read pairs available after processing 6068365 (34.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 6 0.00% 21 9 0.00% 22 21 0.00% 23 22 0.00% 24 19 0.00% 25 39 0.00% 26 29 0.00% 27 38 0.00% 28 38 0.00% 29 28 0.00% 30 35 0.00% 31 36 0.00% 32 35 0.00% 33 50 0.00% 34 49 0.00% 35 52 0.00% 36 59 0.00% 37 59 0.00% 38 73 0.00% 39 102 0.00% 40 80 0.00% 41 103 0.00% 42 107 0.00% 43 115 0.00% 44 131 0.00% 45 171 0.00% 46 195 0.00% 47 231 0.00% 48 274 0.00% 49 287 0.00% 50 290 0.00% 51 310 0.00% 52 347 0.00% 53 341 0.00% 54 324 0.00% 55 322 0.00% 56 321 0.00% 57 343 0.00% 58 345 0.00% 59 363 0.00% 60 406 0.00% 61 411 0.00% 62 451 0.00% 63 470 0.00% 64 533 0.00% 65 658 0.00% 66 782 0.00% 67 1103 0.01% 68 1578 0.01% 69 3258 0.02% 70 2934 0.02% 71 1873 0.01% 72 1550 0.01% 73 1540 0.01% 74 1571 0.01% 75 1710 0.01% 76 1899 0.01% 77 1937 0.01% 78 2236 0.01% 79 2629 0.01% 80 3178 0.02% 81 3852 0.02% 82 5179 0.03% 83 12948 0.07% 84 76032 0.43% 85 70526 0.40% 86 64541 0.36% 87 57750 0.33% 88 53663 0.30% 89 52335 0.30% 90 51012 0.29% 91 50587 0.29% 92 49863 0.28% 93 49342 0.28% 94 49190 0.28% 95 48786 0.28% 96 48425 0.27% 97 47975 0.27% 98 47923 0.27% 99 47916 0.27% 100 48671 0.28% 101 50237 0.28% 102 49743 0.28% 103 50388 0.28% 104 51208 0.29% 105 52902 0.30% 106 54138 0.31% 107 55003 0.31% 108 56872 0.32% 109 58006 0.33% 110 59592 0.34% 111 61136 0.35% 112 63275 0.36% 113 66037 0.37% 114 67919 0.38% 115 69859 0.39% 116 72763 0.41% 117 75394 0.43% 118 78789 0.45% 119 82551 0.47% 120 85406 0.48% 121 90143 0.51% 122 94268 0.53% 123 99050 0.56% 124 104437 0.59% 125 109311 0.62% 126 114423 0.65% 127 121412 0.69% 128 125385 0.71% 129 131227 0.74% 130 137426 0.78% 131 144916 0.82% 132 152479 0.86% 133 163815 0.93% 134 173224 0.98% 135 185573 1.05% 136 192561 1.09% 137 203917 1.15% 138 215081 1.22% 139 227067 1.28% 140 237564 1.34% 141 251541 1.42% 142 266531 1.51% 143 289174 1.63% 144 319689 1.81% 145 357853 2.02% 146 436185 2.47% 147 566232 3.20% 148 900463 5.09% 149 2979488 16.84% 150 6068365 34.29% 17695050 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=25.24 fanout-score-rank=5 prefix-density=0.38 prefix-fanout=25.2 sequence=AGATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCTACATCTCGTATGCCGTCTTCTGCTTGAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=22 fanout-score=47.99 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=13.6 sequence=AGCACCACCACCA criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=31 prefix-density=0.14 prefix-fanout=3.0 sequence=ACCCAGAAGATGAGCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=29 fanout-score=496.21 fanout-score-rank=1 prefix-density=0.58 prefix-fanout=31.0 sequence=AAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCAACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTTCGGCTGCGGGGTGGAGTTTTGGATCTGCTTGCTTCT SRR6031379 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:24:30 Started mapping on | Feb 14 06:24:31 Finished on | Feb 14 06:27:41 Mapping speed, Million of reads per hour | 335.27 Number of input reads | 17695050 Average input read length | 280 UNIQUE READS: Uniquely mapped reads number | 15537388 Uniquely mapped reads % | 87.81% Average mapped length | 276.95 Number of splices: Total | 13310220 Number of splices: Annotated (sjdb) | 13034244 Number of splices: GT/AG | 13093473 Number of splices: GC/AG | 168963 Number of splices: AT/AC | 8840 Number of splices: Non-canonical | 38944 Mismatch rate per base, % | 0.77% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.03% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 542645 % of reads mapped to multiple loci | 3.07% Number of reads mapped to too many loci | 20832 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.93% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2329016 2329016 2329016 N_multimapping 542645 542645 542645 N_noFeature 435669 15313535 537081 N_ambiguous 258609 1489 135494 UnstrandedReadsAssigned:14843110 PositiveStrandReadsAssigned:222364 NegativeStrandReadsAssigned:14864813 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR6031379 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031379-trimmed-pair1.fastq SRR6031379-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 17,695,050 reads, 15,459,273 reads pseudoaligned [quant] estimated average fragment length: 299.671 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR6031379.ke.tsv 34699 SRR6031379.se.tsv 87100 total ==> SRR6031379.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1719.33 427 13.4772 Potri.005G024800.1.v4.1 1035 736.329 319 23.5098 Potri.004G059700.1.v4.1 961 662.447 23 1.88412 Potri.007G009000.2.v4.1 1416 1117.33 0 0 Potri.003G141000.2.v4.1 2943 2644.33 315.111 6.46665 Potri.016G087400.1.v4.1 270 62.0244 1101 963.287 Potri.015G069301.1.v4.1 564 278.206 0 0 Potri.010G195200.1.v4.1 1773 1474.33 24 0.88338 Potri.012G127500.1.v4.1 977 678.415 2278 182.217 ==> SRR6031379.se.tsv <== Potri.001G166300.v4.1 45 Potri.001G448400.v4.1 960 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 407 Potri.001G212900.v4.1 455 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 0 SRR6031379 completed mapping pipeline successfully