Starting /dee2/code/volunteer_pipeline.sh SRR6031380 current disk space = 3085227814912 free memory = 1574281720 SRR6031380 SRAfilesize 24c394ef2d2808a22f016487944f191d SRR6031380.sra SRR6031380.sra file validated SRR6031380 is paired end SRR6031380 is conventional basespace SRR6031380 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031380_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.84225 34.0 33.0 34.0 33.0 34.0 2 33.35025 34.0 33.0 34.0 33.0 34.0 3 33.36225 34.0 33.0 34.0 33.0 34.0 4 33.36425 34.0 34.0 34.0 33.0 34.0 5 33.4305 34.0 34.0 34.0 33.0 34.0 6 37.1965 38.0 38.0 38.0 36.0 38.0 7 37.3885 38.0 38.0 38.0 37.0 38.0 8 37.4535 38.0 38.0 38.0 37.0 38.0 9 37.42825 38.0 38.0 38.0 37.0 38.0 10-14 37.4132 38.0 38.0 38.0 37.0 38.0 15-19 37.44045 38.0 38.0 38.0 37.2 38.0 20-24 37.50195 38.0 38.0 38.0 37.4 38.0 25-29 37.430749999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.41785 38.0 38.0 38.0 37.0 38.0 35-39 37.352799999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.17855000000001 38.0 38.0 38.0 36.6 38.0 45-49 37.16145 38.0 38.0 38.0 36.4 38.0 50-54 37.1027 38.0 38.0 38.0 36.0 38.0 55-59 37.09685 38.0 38.0 38.0 36.0 38.0 60-64 37.098400000000005 38.0 38.0 38.0 36.0 38.0 65-69 37.083800000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.04965 38.0 38.0 38.0 36.0 38.0 75-79 36.93295 38.0 38.0 38.0 36.0 38.0 80-84 36.884100000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.82235 38.0 38.0 38.0 35.6 38.0 90-94 36.75834999999999 38.0 38.0 38.0 35.2 38.0 95-99 36.70975 38.0 38.0 38.0 35.0 38.0 100-104 36.6126 38.0 38.0 38.0 35.0 38.0 105-109 36.46195 38.0 38.0 38.0 34.2 38.0 110-114 36.4254 38.0 38.0 38.0 34.0 38.0 115-119 36.23945 38.0 38.0 38.0 34.0 38.0 120-124 36.21075 38.0 38.0 38.0 34.0 38.0 125-129 35.898250000000004 38.0 37.2 38.0 33.0 38.0 130-134 35.82155 38.0 37.0 38.0 33.0 38.0 135-139 35.64925 38.0 36.8 38.0 32.2 38.0 140-144 35.20865 38.0 36.0 38.0 30.6 38.0 145-149 34.7541 38.0 36.0 38.0 31.0 38.0 150 28.4805 33.0 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 0.0 15 4.0 16 0.0 17 3.0 18 5.0 19 10.0 20 3.0 21 5.0 22 7.0 23 3.0 24 4.0 25 6.0 26 15.0 27 13.0 28 18.0 29 31.0 30 25.0 31 43.0 32 61.0 33 101.0 34 120.0 35 215.0 36 454.0 37 2847.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.58102264054948 17.50190791147291 4.70618163317222 41.21088781480539 2 16.425 18.525 46.975 18.075 3 13.5 23.799999999999997 33.35 29.349999999999998 4 20.025000000000002 30.725 26.1 23.150000000000002 5 22.15 36.55 24.9 16.400000000000002 6 16.7 37.075 25.2 21.025 7 12.875 23.65 46.225 17.25 8 15.049999999999999 21.95 34.725 28.275 9 16.150000000000002 21.675 35.525 26.650000000000002 10-14 19.445 29.15 27.22 24.185000000000002 15-19 19.74 28.575 27.91 23.775 20-24 19.689999999999998 28.23 27.685 24.395 25-29 19.48 28.46 28.000000000000004 24.060000000000002 30-34 19.39 28.549999999999997 27.975 24.085 35-39 19.835 28.93 26.72 24.515 40-44 20.150000000000002 28.694999999999997 27.93 23.225 45-49 20.735 28.1 27.755000000000003 23.41 50-54 20.805 28.7 27.13 23.365 55-59 20.41 28.854999999999997 27.435 23.3 60-64 20.215 28.765 27.195000000000004 23.825 65-69 20.04 28.499999999999996 27.529999999999998 23.93 70-74 19.88 29.099999999999998 27.91 23.11 75-79 20.45 28.595 27.74 23.215 80-84 20.57 28.015 27.325 24.09 85-89 20.125 28.565 27.415 23.895 90-94 20.45 28.715000000000003 27.165 23.669999999999998 95-99 20.75 28.744999999999997 26.85 23.655 100-104 20.724999999999998 28.249999999999996 27.33 23.695 105-109 20.29 28.185 27.515 24.01 110-114 20.755000000000003 28.645 26.840000000000003 23.76 115-119 21.490000000000002 28.444999999999997 27.16 22.905 120-124 20.635 28.235 27.235 23.895 125-129 20.935000000000002 28.38 27.250000000000004 23.435 130-134 21.19 28.005000000000003 27.025 23.78 135-139 20.97 28.095 27.045 23.89 140-144 21.26 27.650000000000002 27.305 23.785 145-149 20.52 28.225 27.54 23.715 150 21.375 27.925 26.775 23.925 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 1.5 25 2.5 26 4.5 27 6.5 28 10.5 29 18.5 30 21.5 31 22.0 32 36.5 33 46.0 34 58.5 35 82.0 36 93.5 37 113.5 38 140.5 39 165.5 40 181.5 41 210.5 42 257.5 43 266.5 44 275.5 45 270.0 46 249.5 47 251.5 48 239.5 49 207.5 50 168.5 51 130.0 52 100.0 53 92.5 54 80.0 55 50.0 56 33.0 57 34.0 58 26.0 59 15.5 60 11.0 61 6.0 62 5.0 63 3.0 64 1.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31714719271623 98.175 2 0.4805260495700557 0.95 3 0.12645422357106728 0.375 4 0.025290844714213456 0.1 5 0.025290844714213456 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025290844714213456 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGGCCTGATCTCGTATGC 11 0.27499999999999997 TruSeq Adapter, Index 18 (97% over 37bp) GTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.8 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 1.0 0.0 0.0 0.0 0.0 96-97 1.1 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.5625 0.0 0.0 0.0 0.0 102-103 1.8375 0.0 0.0 0.0 0.0 104-105 2.025 0.0 0.0 0.0 0.0 106-107 2.2 0.0 0.0 0.0 0.0 108-109 2.4124999999999996 0.0 0.0 0.0 0.0 110-111 2.5125 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 3.1624999999999996 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.8375 0.0 0.0 0.0 0.0 120-121 4.2 0.0 0.0 0.0 0.0 122-123 4.6125 0.0 0.0 0.0 0.0 124-125 5.1375 0.0 0.0 0.0 0.0 126-127 5.5375 0.0 0.0 0.0 0.0 128-129 5.949999999999999 0.0 0.0 0.0 0.0 130-131 6.3625 0.0 0.0 0.0 0.0 132-133 6.887499999999999 0.0 0.0 0.0 0.0 134-135 7.425000000000001 0.0 0.0 0.0 0.0 136-137 7.95 0.0 0.0 0.0 0.0 138 8.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACCTCT 10 0.0067147487 145.81013 1 >>END_MODULE SRR6031380 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031380_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62025 33.0 33.0 34.0 32.0 34.0 2 32.7775 33.0 33.0 34.0 32.0 34.0 3 32.7625 34.0 33.0 34.0 32.0 34.0 4 32.7465 34.0 33.0 34.0 32.0 34.0 5 32.70775 34.0 33.0 34.0 32.0 34.0 6 36.8685 38.0 38.0 38.0 36.0 38.0 7 36.943 38.0 38.0 38.0 36.0 38.0 8 36.96625 38.0 38.0 38.0 36.0 38.0 9 36.8815 38.0 38.0 38.0 36.0 38.0 10-14 36.87985 38.0 38.0 38.0 36.0 38.0 15-19 36.82195 38.0 38.0 38.0 36.0 38.0 20-24 36.88805000000001 38.0 38.0 38.0 36.0 38.0 25-29 36.882999999999996 38.0 38.0 38.0 36.0 38.0 30-34 36.8573 38.0 38.0 38.0 36.0 38.0 35-39 36.760949999999994 38.0 38.0 38.0 36.0 38.0 40-44 36.4035 38.0 38.0 38.0 35.0 38.0 45-49 36.708749999999995 38.0 38.0 38.0 35.6 38.0 50-54 36.74750000000001 38.0 38.0 38.0 35.8 38.0 55-59 36.75015 38.0 38.0 38.0 36.0 38.0 60-64 36.70790000000001 38.0 38.0 38.0 35.6 38.0 65-69 36.69070000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.68235 38.0 38.0 38.0 35.8 38.0 75-79 36.60744999999999 38.0 38.0 38.0 35.4 38.0 80-84 35.97675 38.0 38.0 38.0 34.2 38.0 85-89 35.184450000000005 38.0 38.0 38.0 31.8 38.0 90-94 35.0766 38.0 38.0 38.0 30.4 38.0 95-99 35.00265 38.0 38.0 38.0 29.4 38.0 100-104 35.7406 38.0 38.0 38.0 30.8 38.0 105-109 36.19895 38.0 38.0 38.0 34.0 38.0 110-114 36.13385 38.0 38.0 38.0 34.0 38.0 115-119 35.92775 38.0 38.0 38.0 33.6 38.0 120-124 35.7323 38.0 38.0 38.0 32.8 38.0 125-129 34.90205 38.0 37.0 38.0 28.4 38.0 130-134 33.5287 38.0 36.0 38.0 14.4 38.0 135-139 32.6297 38.0 34.8 38.0 6.4 38.0 140-144 32.40815 38.0 33.8 38.0 2.0 38.0 145-149 31.927100000000003 38.0 33.0 38.0 2.0 38.0 150 25.31775 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 2.0 5 1.0 6 1.0 7 0.0 8 2.0 9 0.0 10 1.0 11 2.0 12 6.0 13 3.0 14 6.0 15 4.0 16 9.0 17 5.0 18 7.0 19 7.0 20 6.0 21 8.0 22 14.0 23 21.0 24 33.0 25 34.0 26 35.0 27 64.0 28 49.0 29 50.0 30 60.0 31 65.0 32 72.0 33 128.0 34 111.0 35 202.0 36 382.0 37 2597.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.23405851462866 27.38184546136534 6.27656914228557 30.107526881720432 2 23.400000000000002 25.900000000000002 38.425 12.275 3 16.625 27.650000000000002 35.975 19.75 4 21.125 35.575 23.95 19.35 5 22.775000000000002 39.425 21.45 16.35 6 18.675 39.825 22.825 18.675 7 18.5 20.325 40.925 20.25 8 18.125 24.25 30.375000000000004 27.250000000000004 9 20.150000000000002 23.400000000000002 31.424999999999997 25.025 10-14 23.04 27.755000000000003 26.82 22.384999999999998 15-19 23.035 28.34 27.855 20.77 20-24 22.884999999999998 28.125 27.93 21.060000000000002 25-29 23.080000000000002 28.815 27.62 20.485 30-34 22.575 27.725 28.439999999999998 21.26 35-39 23.047169337419 28.165971768724567 27.43758476917667 21.34927412467976 40-44 23.461849827970045 27.656344869459627 27.641165755919854 21.240639546650474 45-49 23.14 27.66 28.055000000000003 21.145 50-54 22.869999999999997 27.345000000000002 27.96 21.825 55-59 22.82 27.665 27.925 21.59 60-64 22.605 27.98 28.235 21.18 65-69 23.485 27.79 27.735 20.990000000000002 70-74 23.5 28.29 26.99 21.22 75-79 22.855 27.375 28.58 21.19 80-84 23.230831890846147 27.588840240301394 28.08777110273903 21.09255676611343 85-89 23.455377574370708 28.44289577699189 27.527563969211567 20.574162679425836 90-94 23.642987249544625 27.83242258652095 27.71792870153526 20.806661462399166 95-99 23.584218196960233 27.831563606079534 27.717051842598377 20.867166354361856 100-104 24.07966203983102 27.41903037618185 27.781130557231947 20.72017702675518 105-109 23.56 27.62 28.12 20.7 110-114 23.84 27.735 27.82 20.605 115-119 23.93 28.325 27.705000000000002 20.04 120-124 23.905 28.77 27.22 20.105 125-129 23.860807721615444 28.371856743713487 27.650495300990602 20.116840233680467 130-134 24.610674127646096 27.635538193527953 27.6249802037692 20.12880747505675 135-139 24.572476668285052 27.598856341371313 27.091762421103738 20.736904569239897 140-144 25.200299113342588 27.83356479008653 26.920200833244312 20.045935263326566 145-149 25.399888285177475 28.11658965114508 26.897882496318488 19.58563956735896 150 24.4 27.6 28.775000000000002 19.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 1.0 21 2.5 22 2.0 23 2.0 24 3.5 25 5.0 26 6.0 27 6.5 28 7.5 29 9.0 30 15.5 31 24.5 32 36.0 33 50.5 34 56.5 35 60.0 36 82.0 37 110.5 38 135.0 39 163.5 40 203.0 41 236.0 42 253.0 43 267.5 44 272.0 45 275.5 46 274.0 47 258.5 48 234.5 49 210.5 50 178.0 51 135.0 52 102.0 53 86.5 54 69.5 55 41.5 56 30.5 57 25.5 58 17.0 59 12.5 60 9.5 61 10.0 62 7.0 63 2.5 64 1.5 65 2.0 66 2.0 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.46499999999999997 40-44 1.18 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.79 85-89 3.8600000000000003 90-94 3.925 95-99 3.94 100-104 0.58 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.575 130-134 5.285 135-139 7.315 140-144 6.39 145-149 1.5350000000000001 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44556451612904 98.65 2 0.4788306451612903 0.95 3 0.0 0.0 4 0.025201612903225805 0.1 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (100% over 50bp) CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5375 0.0 0.0 0.0 0.0 90-91 0.725 0.0 0.0 0.0 0.0 92-93 0.8125 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.05 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.7374999999999998 0.0 0.0 0.0 0.0 104-105 1.9249999999999998 0.0 0.0 0.0 0.0 106-107 2.0999999999999996 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.5875 0.0 0.0 0.0 0.0 114-115 3.0125 0.0 0.0 0.0 0.0 116-117 3.2875 0.0 0.0 0.0 0.0 118-119 3.6500000000000004 0.0 0.0 0.0 0.0 120-121 3.9625000000000004 0.0 0.0 0.0 0.0 122-123 4.3625 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.237500000000001 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 6.0125 0.0 0.0 0.0 0.0 132-133 6.512499999999999 0.0 0.0 0.0 0.0 134-135 7.012499999999999 0.0 0.0 0.0 0.0 136-137 7.525 0.0 0.0 0.0 0.0 138 7.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATAGCT 10 0.007122333 142.9875 8 >>END_MODULE Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214011 spots for SRR6031380.sra Written 1214011 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra Read 1214000 spots for SRR6031380.sra Written 1214000 spots for SRR6031380.sra SRR ids: ['SRR6031380.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_co_6o_c8 SRR6031380.sra spots: 24280011 blocks: [[1, 1214000], [1214001, 2428000], [2428001, 3642000], [3642001, 4856000], [4856001, 6070000], [6070001, 7284000], [7284001, 8498000], [8498001, 9712000], [9712001, 10926000], [10926001, 12140000], [12140001, 13354000], [13354001, 14568000], [14568001, 15782000], [15782001, 16996000], [16996001, 18210000], [18210001, 19424000], [19424001, 20638000], [20638001, 21852000], [21852001, 23066000], [23066001, 24280011]] SRR6031380 file size 8158576 SRR6031380 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031380 SRR6031380_1.fastq SRR6031380_2.fastq Input file: SRR6031380_1.fastq Paired file: SRR6031380_2.fastq trimmed: SRR6031380-trimmed-pair1.fastq, SRR6031380-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:33:34 2025 >> started Fri Feb 14 06:34:01 2025 >> done (26.067s) 24280011 read pairs processed; of these: 26579 ( 0.11%) short read pairs filtered out after trimming by size control 116473 ( 0.48%) empty read pairs filtered out after trimming by size control 24136959 (99.41%) read pairs available; of these: 9741796 (40.36%) trimmed read pairs available after processing 14395163 (59.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 13 0.00% 20 18 0.00% 21 23 0.00% 22 16 0.00% 23 20 0.00% 24 33 0.00% 25 37 0.00% 26 35 0.00% 27 27 0.00% 28 43 0.00% 29 42 0.00% 30 34 0.00% 31 55 0.00% 32 46 0.00% 33 54 0.00% 34 61 0.00% 35 71 0.00% 36 76 0.00% 37 92 0.00% 38 95 0.00% 39 106 0.00% 40 125 0.00% 41 152 0.00% 42 157 0.00% 43 182 0.00% 44 224 0.00% 45 258 0.00% 46 285 0.00% 47 289 0.00% 48 329 0.00% 49 402 0.00% 50 460 0.00% 51 495 0.00% 52 477 0.00% 53 565 0.00% 54 568 0.00% 55 653 0.00% 56 712 0.00% 57 782 0.00% 58 875 0.00% 59 968 0.00% 60 1058 0.00% 61 1268 0.01% 62 1262 0.01% 63 1490 0.01% 64 1549 0.01% 65 1733 0.01% 66 2045 0.01% 67 2625 0.01% 68 3178 0.01% 69 4400 0.02% 70 4681 0.02% 71 3529 0.01% 72 3599 0.01% 73 3910 0.02% 74 4215 0.02% 75 4556 0.02% 76 4987 0.02% 77 5328 0.02% 78 5820 0.02% 79 6211 0.03% 80 6928 0.03% 81 7825 0.03% 82 8735 0.04% 83 9814 0.04% 84 11999 0.05% 85 13035 0.05% 86 13670 0.06% 87 14447 0.06% 88 15086 0.06% 89 15926 0.07% 90 16978 0.07% 91 17914 0.07% 92 19717 0.08% 93 20823 0.09% 94 21812 0.09% 95 23134 0.10% 96 24071 0.10% 97 25121 0.10% 98 26299 0.11% 99 27091 0.11% 100 28247 0.12% 101 29392 0.12% 102 31165 0.13% 103 32768 0.14% 104 34229 0.14% 105 35195 0.15% 106 36317 0.15% 107 38006 0.16% 108 38771 0.16% 109 39544 0.16% 110 40047 0.17% 111 42064 0.17% 112 43772 0.18% 113 45137 0.19% 114 46192 0.19% 115 48086 0.20% 116 49226 0.20% 117 50520 0.21% 118 51208 0.21% 119 51886 0.21% 120 53820 0.22% 121 54483 0.23% 122 56853 0.24% 123 58935 0.24% 124 60687 0.25% 125 62116 0.26% 126 64407 0.27% 127 66618 0.28% 128 67514 0.28% 129 70068 0.29% 130 72104 0.30% 131 73671 0.31% 132 77265 0.32% 133 80062 0.33% 134 82778 0.34% 135 86800 0.36% 136 93063 0.39% 137 98461 0.41% 138 107124 0.44% 139 112289 0.47% 140 116419 0.48% 141 123641 0.51% 142 131949 0.55% 143 148748 0.62% 144 170501 0.71% 145 199606 0.83% 146 282850 1.17% 147 362816 1.50% 148 704522 2.92% 149 4772019 19.77% 150 14395163 59.64% 24136959 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=37 prefix-density=0.24 prefix-fanout=2.2 sequence=AACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAAGGAGTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTTGTTGCGAAGAAGGTACTCAATTTCCTGGGCCAATTGCTCAGTAGTGAGATCTGGAAGGTAAGAAAGAGTCTCGAACTTCTTCAATCCAGTTGGAGGCCACACCTGCATGCATTGAACTCTTCCGCCATTGCTTGCAATGGAAGTAATGTCATTGTTAGCCTTTCTGGTGACCGGGAAAGCTGAGGTAGACTTGAGGCCGTTGAATGGTGCAACCATGTTGGCCTGTGCAGGGGTGCGGTTAACT criterion=fanout-score sequence-density=0.07 sequence-density-rank=26 fanout-score=399.16 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=32.0 sequence=TTCTTCTTCTTCCT criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.63 fanout-score-rank=35 prefix-density=0.29 prefix-fanout=2.4 sequence=ACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCTGCCGCAGCTTTCCCAGTCAGTACCAGAAAGGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=138.06 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=25.4 sequence=AGGAAGAAGAAGA SRR6031380 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:34:44 Started mapping on | Feb 14 06:34:44 Finished on | Feb 14 06:36:35 Mapping speed, Million of reads per hour | 782.82 Number of input reads | 24136959 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 23302768 Uniquely mapped reads % | 96.54% Average mapped length | 291.29 Number of splices: Total | 23024709 Number of splices: Annotated (sjdb) | 22648853 Number of splices: GT/AG | 22620642 Number of splices: GC/AG | 352948 Number of splices: AT/AC | 13764 Number of splices: Non-canonical | 37355 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.23 Insertion rate per base | 0.01% Insertion average length | 1.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 557890 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 29720 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.99% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 301266 301266 301266 N_multimapping 557890 557890 557890 N_noFeature 645337 23020763 776934 N_ambiguous 274612 1072 123624 UnstrandedReadsAssigned:22382819 PositiveStrandReadsAssigned:280933 NegativeStrandReadsAssigned:22402210 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031380 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031380-trimmed-pair1.fastq SRR6031380-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,136,959 reads, 22,683,599 reads pseudoaligned [quant] estimated average fragment length: 242.295 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,055 rounds 52401 SRR6031380.ke.tsv 34699 SRR6031380.se.tsv 87100 total ==> SRR6031380.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.7 288 7.22741 Potri.005G024800.1.v4.1 1035 793.705 77 4.32551 Potri.004G059700.1.v4.1 961 719.773 2 0.123891 Potri.007G009000.2.v4.1 1416 1174.7 5 0.189778 Potri.003G141000.2.v4.1 2943 2701.7 418.412 6.90513 Potri.016G087400.1.v4.1 270 84.4078 1230 649.723 Potri.015G069301.1.v4.1 564 328.351 0 0 Potri.010G195200.1.v4.1 1773 1531.7 5 0.145546 Potri.012G127500.1.v4.1 977 735.735 1485 89.9933 ==> SRR6031380.se.tsv <== Potri.001G166300.v4.1 2 Potri.001G448400.v4.1 12 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 196 Potri.001G212900.v4.1 55 Potri.001G182400.v4.1 9 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 213 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 3 SRR6031380 completed mapping pipeline successfully