Starting /dee2/code/volunteer_pipeline.sh SRR6031381 current disk space = 3085297012736 free memory = 1582237700 SRR6031381 SRAfilesize 34132b7a2be4a42276c239905788eb9b SRR6031381.sra SRR6031381.sra file validated SRR6031381 is paired end SRR6031381 is conventional basespace SRR6031381 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031381_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.884 34.0 33.0 34.0 33.0 34.0 2 33.35075 34.0 33.0 34.0 33.0 34.0 3 33.31925 34.0 33.0 34.0 33.0 34.0 4 33.46575 34.0 34.0 34.0 33.0 34.0 5 33.49125 34.0 34.0 34.0 33.0 34.0 6 37.21675 38.0 38.0 38.0 36.0 38.0 7 37.39125 38.0 38.0 38.0 37.0 38.0 8 37.528 38.0 38.0 38.0 37.0 38.0 9 37.58675 38.0 38.0 38.0 38.0 38.0 10-14 37.469 38.0 38.0 38.0 37.2 38.0 15-19 37.4423 38.0 38.0 38.0 37.0 38.0 20-24 37.439550000000004 38.0 38.0 38.0 37.6 38.0 25-29 37.4345 38.0 38.0 38.0 37.4 38.0 30-34 37.427800000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.316 38.0 38.0 38.0 37.0 38.0 40-44 37.18405 38.0 38.0 38.0 36.6 38.0 45-49 37.168 38.0 38.0 38.0 36.0 38.0 50-54 37.088300000000004 38.0 38.0 38.0 36.0 38.0 55-59 37.04435 38.0 38.0 38.0 36.0 38.0 60-64 37.12814999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.090999999999994 38.0 38.0 38.0 36.2 38.0 70-74 36.969449999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.787800000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.6769 38.0 38.0 38.0 35.6 38.0 85-89 36.551050000000004 38.0 38.0 38.0 34.8 38.0 90-94 36.55595 38.0 38.0 38.0 35.0 38.0 95-99 36.45335 38.0 38.0 38.0 34.2 38.0 100-104 36.37805 38.0 38.0 38.0 34.0 38.0 105-109 36.17315 38.0 38.0 38.0 33.8 38.0 110-114 36.0895 38.0 38.0 38.0 33.6 38.0 115-119 36.076350000000005 38.0 38.0 38.0 33.8 38.0 120-124 35.88615 38.0 37.8 38.0 33.2 38.0 125-129 35.6228 38.0 37.0 38.0 31.2 38.0 130-134 35.3799 38.0 36.6 38.0 31.0 38.0 135-139 35.06925 38.0 36.0 38.0 30.6 38.0 140-144 34.5921 38.0 35.6 38.0 28.2 38.0 145-149 34.07255 38.0 35.8 38.0 25.2 38.0 150 26.32 33.0 20.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 2.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 1.0 13 3.0 14 1.0 15 4.0 16 7.0 17 3.0 18 9.0 19 7.0 20 5.0 21 6.0 22 2.0 23 8.0 24 13.0 25 14.0 26 16.0 27 21.0 28 37.0 29 23.0 30 25.0 31 41.0 32 62.0 33 89.0 34 124.0 35 207.0 36 512.0 37 2755.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.487309644670056 12.18274111675127 13.045685279187818 37.28426395939086 2 25.025 16.475 32.25 26.25 3 20.674999999999997 21.775 27.05 30.5 4 23.1 29.2 23.05 24.65 5 22.775000000000002 34.25 23.525 19.45 6 18.075 36.825 24.525 20.575 7 12.875 26.125 42.725 18.275 8 17.025000000000002 27.150000000000002 29.925 25.900000000000002 9 16.85 26.200000000000003 31.7 25.25 10-14 18.955 31.245 27.235 22.564999999999998 15-19 18.845 30.61 27.13 23.415 20-24 19.03 29.849999999999998 27.794999999999998 23.325000000000003 25-29 19.45680988345921 29.725403891361978 27.609663382183765 23.20812284299505 30-34 19.205 29.360000000000003 27.860000000000003 23.575 35-39 18.975 29.775000000000002 27.87 23.380000000000003 40-44 19.77 29.49 27.85 22.89 45-49 19.67 29.435 27.529999999999998 23.365 50-54 19.689999999999998 28.725 28.155 23.43 55-59 19.34 29.110000000000003 27.74 23.810000000000002 60-64 18.715 29.585 28.165000000000003 23.535 65-69 19.79 29.395 27.47 23.345 70-74 19.49 28.999999999999996 28.49 23.02 75-79 19.74 29.165000000000003 27.415 23.68 80-84 19.37 28.970000000000002 28.04 23.62 85-89 20.419999999999998 29.235 26.950000000000003 23.395 90-94 19.650000000000002 29.470000000000002 27.29 23.59 95-99 19.794999999999998 29.185 27.68 23.34 100-104 20.02 28.68 28.060000000000002 23.24 105-109 20.07 28.99 27.355 23.585 110-114 19.86 28.970000000000002 27.425 23.745 115-119 19.994999999999997 28.994999999999997 27.439999999999998 23.57 120-124 20.72 28.794999999999998 27.07 23.415 125-129 20.205000000000002 29.360000000000003 26.99 23.445 130-134 20.885 28.025 27.045 24.044999999999998 135-139 20.305 28.49 27.375 23.830000000000002 140-144 20.605 28.325 27.32 23.75 145-149 20.715 28.285 27.515 23.485 150 21.475 26.75 27.750000000000004 24.025 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 1.0 3 1.5 4 1.5 5 1.0 6 1.5 7 2.0 8 1.0 9 0.5 10 1.0 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 2.0 22 6.5 23 8.5 24 5.5 25 5.0 26 9.0 27 10.0 28 10.5 29 18.0 30 27.0 31 32.0 32 46.5 33 62.5 34 74.5 35 81.5 36 97.0 37 127.0 38 156.5 39 182.0 40 190.0 41 219.5 42 246.0 43 255.0 44 271.0 45 263.0 46 253.0 47 238.5 48 206.0 49 178.0 50 146.0 51 119.5 52 105.5 53 81.5 54 62.5 55 51.5 56 35.5 57 25.0 58 19.0 59 17.0 60 15.0 61 9.0 62 6.0 63 3.0 64 1.0 65 2.5 66 2.5 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.034999999999999996 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57135653050932 98.725 2 0.3530005042864347 0.7000000000000001 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.4 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACGATGCTATCTCGTATGC 16 0.4 TruSeq Adapter, Index 9 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 1.0 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.2625 0.0 0.0 0.0 0.0 106-107 1.5125000000000002 0.0 0.0 0.0 0.0 108-109 1.65 0.0 0.0 0.0 0.0 110-111 1.7625 0.0 0.0 0.0 0.0 112-113 2.0374999999999996 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.7 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.175 0.0 0.0 0.0 0.0 122-123 3.4875 0.0 0.0 0.0 0.0 124-125 3.725 0.0 0.0 0.0 0.0 126-127 3.9375 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.5875 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 5.675 0.0 0.0 0.0 0.0 138 6.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGAACT 10 0.006973645 144.0 9 AGATCAG 10 0.006973645 144.0 4 TTTAATC 10 0.006973645 144.0 5 >>END_MODULE SRR6031381 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031381_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63 33.0 33.0 34.0 32.0 34.0 2 32.7505 33.0 33.0 34.0 32.0 34.0 3 32.78575 34.0 33.0 34.0 32.0 34.0 4 32.71925 34.0 33.0 34.0 32.0 34.0 5 32.72375 34.0 33.0 34.0 32.0 34.0 6 36.87875 38.0 38.0 38.0 36.0 38.0 7 36.83125 38.0 38.0 38.0 36.0 38.0 8 36.869 38.0 38.0 38.0 36.0 38.0 9 36.90725 38.0 38.0 38.0 36.0 38.0 10-14 36.83535 38.0 38.0 38.0 36.0 38.0 15-19 36.789 38.0 38.0 38.0 36.0 38.0 20-24 36.75085 38.0 38.0 38.0 36.0 38.0 25-29 36.77385 38.0 38.0 38.0 36.0 38.0 30-34 36.745250000000006 38.0 38.0 38.0 36.0 38.0 35-39 36.642 38.0 38.0 38.0 36.0 38.0 40-44 36.33225 38.0 38.0 38.0 35.4 38.0 45-49 36.5628 38.0 38.0 38.0 35.6 38.0 50-54 36.5997 38.0 38.0 38.0 36.0 38.0 55-59 36.60535 38.0 38.0 38.0 35.8 38.0 60-64 36.605 38.0 38.0 38.0 36.0 38.0 65-69 36.4885 38.0 38.0 38.0 35.4 38.0 70-74 36.38505 38.0 38.0 38.0 35.0 38.0 75-79 36.357150000000004 38.0 38.0 38.0 35.0 38.0 80-84 35.784800000000004 38.0 38.0 38.0 34.2 38.0 85-89 34.935300000000005 38.0 38.0 38.0 30.0 38.0 90-94 34.84645 38.0 38.0 38.0 29.4 38.0 95-99 34.7776 38.0 38.0 38.0 28.6 38.0 100-104 35.444449999999996 38.0 38.0 38.0 30.2 38.0 105-109 35.81055 38.0 38.0 38.0 33.8 38.0 110-114 35.7527 38.0 38.0 38.0 33.6 38.0 115-119 35.7178 38.0 38.0 38.0 33.8 38.0 120-124 35.47715 38.0 38.0 38.0 32.2 38.0 125-129 34.797900000000006 38.0 37.4 38.0 28.6 38.0 130-134 33.24395 38.0 36.2 38.0 12.8 38.0 135-139 32.4091 38.0 35.2 38.0 2.0 38.0 140-144 32.1029 38.0 33.8 38.0 2.0 38.0 145-149 31.606649999999995 38.0 33.2 38.0 2.0 38.0 150 23.9665 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 7.0 4 4.0 5 4.0 6 2.0 7 6.0 8 3.0 9 3.0 10 5.0 11 4.0 12 5.0 13 6.0 14 7.0 15 12.0 16 12.0 17 7.0 18 6.0 19 7.0 20 7.0 21 8.0 22 12.0 23 27.0 24 33.0 25 20.0 26 29.0 27 63.0 28 56.0 29 48.0 30 47.0 31 42.0 32 79.0 33 119.0 34 86.0 35 177.0 36 375.0 37 2658.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.375 21.3 17.75 26.575 2 30.349999999999998 23.7 29.675 16.275000000000002 3 21.125 27.1 32.95 18.825 4 23.45 33.375 24.425 18.75 5 25.6 35.3 21.875 17.224999999999998 6 21.425 36.35 24.15 18.075 7 20.175 19.650000000000002 40.775 19.400000000000002 8 22.225 25.474999999999998 26.700000000000003 25.6 9 22.55 24.45 28.9 24.099999999999998 10-14 23.73 28.38 26.700000000000003 21.19 15-19 23.485 28.255000000000003 27.805000000000003 20.455000000000002 20-24 23.0 28.645 27.994999999999997 20.36 25-29 23.325000000000003 28.549999999999997 27.505000000000003 20.62 30-34 22.28 29.160000000000004 27.825 20.735 35-39 22.90631742686537 28.476090119925736 27.38722464749862 21.23036780571027 40-44 23.90876520159459 28.182873290609074 27.476409143664533 20.431952364131806 45-49 22.486865148861646 28.61646234676007 28.10607955966975 20.79059294470853 50-54 23.86 27.875 27.71 20.555 55-59 23.39 27.994999999999997 27.825 20.79 60-64 23.175 28.345 28.189999999999998 20.29 65-69 23.655 28.675 27.634999999999998 20.035 70-74 23.9 27.744999999999997 27.544999999999998 20.810000000000002 75-79 23.355 28.415000000000003 27.68 20.549999999999997 80-84 23.319615912208505 27.927653304882387 28.710054361631865 20.042676421277246 85-89 23.505272453379046 28.133603449171474 28.289439509635862 20.07168458781362 90-94 24.132188394483475 27.894873796513142 27.848035389018992 20.124902419984387 95-99 23.975420507212412 28.27162422538145 27.662344425350206 20.090610842055927 100-104 23.92180572349859 28.597339782345827 27.63502619911326 19.845828295042324 105-109 23.875 28.62 27.57 19.935 110-114 24.095 28.225 27.985 19.695 115-119 24.215 27.834999999999997 28.07 19.88 120-124 24.13 27.889999999999997 27.905 20.075000000000003 125-129 24.02390236491619 28.16123968197701 27.437079049982277 20.377778903124526 130-134 23.881146463318434 28.293452537470422 27.899027083881144 19.926373915330004 135-139 24.135330244585713 27.825665337786877 28.33746363538412 19.701540782243292 140-144 24.312907710405305 27.868677146829217 27.804512886322318 20.01390225644316 145-149 24.87175580273249 28.24419726750978 27.55853522271319 19.325511707044544 150 24.3 28.325 26.950000000000003 20.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 1.0 9 0.5 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 1.5 23 2.5 24 4.0 25 6.0 26 9.0 27 10.0 28 9.5 29 12.5 30 16.0 31 25.5 32 46.0 33 59.0 34 63.5 35 70.0 36 86.5 37 114.5 38 135.5 39 158.0 40 188.5 41 212.5 42 233.0 43 274.5 44 292.0 45 277.0 46 265.0 47 241.0 48 207.0 49 198.0 50 173.0 51 133.0 52 118.5 53 94.5 54 66.0 55 45.5 56 38.0 57 32.0 58 20.5 59 13.5 60 12.5 61 8.0 62 6.5 63 3.5 64 1.0 65 1.5 66 1.0 67 1.0 68 0.5 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.35500000000000004 40-44 0.915 45-49 0.075 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.585 85-89 3.7449999999999997 90-94 3.925 95-99 3.9849999999999994 100-104 0.76 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.265 130-134 4.925 135-139 7.19 140-144 6.49 145-149 1.555 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59758551307847 99.0 2 0.35211267605633806 0.7000000000000001 3 0.025150905432595575 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025150905432595575 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 9 0.22499999999999998 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2 0.0 0.0 0.0 0.0 106-107 1.4375 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2750000000000004 0.0 0.0 0.0 0.0 116-117 2.6 0.0 0.0 0.0 0.0 118-119 2.775 0.0 0.0 0.0 0.0 120-121 2.9875 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.675 0.0 0.0 0.0 0.0 128-129 3.9875 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.2875 0.0 0.0 0.0 0.0 138 5.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166285 spots for SRR6031381.sra Written 1166285 spots for SRR6031381.sra Read 1166298 spots for SRR6031381.sra Written 1166298 spots for SRR6031381.sra SRR ids: ['SRR6031381.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9t3s01ql SRR6031381.sra spots: 23325713 blocks: [[1, 1166285], [1166286, 2332570], [2332571, 3498855], [3498856, 4665140], [4665141, 5831425], [5831426, 6997710], [6997711, 8163995], [8163996, 9330280], [9330281, 10496565], [10496566, 11662850], [11662851, 12829135], [12829136, 13995420], [13995421, 15161705], [15161706, 16327990], [16327991, 17494275], [17494276, 18660560], [18660561, 19826845], [19826846, 20993130], [20993131, 22159415], [22159416, 23325713]] SRR6031381 file size 7837060 SRR6031381 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031381 SRR6031381_1.fastq SRR6031381_2.fastq Input file: SRR6031381_1.fastq Paired file: SRR6031381_2.fastq trimmed: SRR6031381-trimmed-pair1.fastq, SRR6031381-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:33:07 2025 >> started Fri Feb 14 06:33:31 2025 >> done (24.211s) 23325713 read pairs processed; of these: 39167 ( 0.17%) short read pairs filtered out after trimming by size control 87661 ( 0.38%) empty read pairs filtered out after trimming by size control 23198885 (99.46%) read pairs available; of these: 9063617 (39.07%) trimmed read pairs available after processing 14135268 (60.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 15 0.00% 21 15 0.00% 22 14 0.00% 23 18 0.00% 24 13 0.00% 25 29 0.00% 26 21 0.00% 27 32 0.00% 28 35 0.00% 29 15 0.00% 30 35 0.00% 31 19 0.00% 32 23 0.00% 33 42 0.00% 34 46 0.00% 35 40 0.00% 36 40 0.00% 37 57 0.00% 38 60 0.00% 39 70 0.00% 40 72 0.00% 41 68 0.00% 42 80 0.00% 43 95 0.00% 44 122 0.00% 45 113 0.00% 46 123 0.00% 47 145 0.00% 48 159 0.00% 49 175 0.00% 50 195 0.00% 51 221 0.00% 52 234 0.00% 53 237 0.00% 54 252 0.00% 55 253 0.00% 56 294 0.00% 57 243 0.00% 58 318 0.00% 59 316 0.00% 60 361 0.00% 61 396 0.00% 62 440 0.00% 63 543 0.00% 64 592 0.00% 65 644 0.00% 66 811 0.00% 67 882 0.00% 68 1162 0.01% 69 2522 0.01% 70 3225 0.01% 71 1758 0.01% 72 1597 0.01% 73 1681 0.01% 74 1927 0.01% 75 1921 0.01% 76 2023 0.01% 77 2250 0.01% 78 2460 0.01% 79 2850 0.01% 80 3220 0.01% 81 3540 0.02% 82 4356 0.02% 83 5270 0.02% 84 8125 0.04% 85 8586 0.04% 86 8950 0.04% 87 9105 0.04% 88 9698 0.04% 89 10310 0.04% 90 10676 0.05% 91 11933 0.05% 92 12569 0.05% 93 13557 0.06% 94 14406 0.06% 95 15521 0.07% 96 16216 0.07% 97 16821 0.07% 98 17624 0.08% 99 18551 0.08% 100 19337 0.08% 101 20845 0.09% 102 22660 0.10% 103 24200 0.10% 104 25725 0.11% 105 26811 0.12% 106 28435 0.12% 107 28656 0.12% 108 29064 0.13% 109 29897 0.13% 110 30791 0.13% 111 31878 0.14% 112 34110 0.15% 113 35223 0.15% 114 36192 0.16% 115 38174 0.16% 116 39023 0.17% 117 39986 0.17% 118 40543 0.17% 119 40825 0.18% 120 41894 0.18% 121 43497 0.19% 122 45115 0.19% 123 47795 0.21% 124 49477 0.21% 125 51961 0.22% 126 53231 0.23% 127 54707 0.24% 128 56181 0.24% 129 57630 0.25% 130 59656 0.26% 131 61525 0.27% 132 64480 0.28% 133 67829 0.29% 134 71284 0.31% 135 75262 0.32% 136 80693 0.35% 137 86733 0.37% 138 93524 0.40% 139 97825 0.42% 140 102680 0.44% 141 108374 0.47% 142 117918 0.51% 143 130522 0.56% 144 149892 0.65% 145 181323 0.78% 146 234685 1.01% 147 343691 1.48% 148 674987 2.91% 149 4883425 21.05% 150 14135268 60.93% 23198885 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.83 fanout-score-rank=32 prefix-density=0.56 prefix-fanout=1.4 sequence=ATTCCTTTGCAGTTTGAACAGCATTACCAGCTTTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=10 fanout-score=455.33 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=34.7 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.59 fanout-score-rank=39 prefix-density=0.44 prefix-fanout=2.2 sequence=ACAAAGCTGGTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=507.98 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=30.2 sequence=AAGAAGAAGAGA SRR6031381 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:34:14 Started mapping on | Feb 14 06:34:15 Finished on | Feb 14 06:36:25 Mapping speed, Million of reads per hour | 642.43 Number of input reads | 23198885 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 22115796 Uniquely mapped reads % | 95.33% Average mapped length | 293.13 Number of splices: Total | 20718213 Number of splices: Annotated (sjdb) | 20294647 Number of splices: GT/AG | 20378265 Number of splices: GC/AG | 290595 Number of splices: AT/AC | 13158 Number of splices: Non-canonical | 36195 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 1.67 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 572182 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 64602 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.85% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 549033 549033 549033 N_multimapping 572182 572182 572182 N_noFeature 690252 21829011 805095 N_ambiguous 281207 1446 108608 UnstrandedReadsAssigned:21144337 PositiveStrandReadsAssigned:285339 NegativeStrandReadsAssigned:21202093 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031381 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031381-trimmed-pair1.fastq SRR6031381-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,198,885 reads, 21,445,067 reads pseudoaligned [quant] estimated average fragment length: 248.138 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 SRR6031381.ke.tsv 34699 SRR6031381.se.tsv 87100 total ==> SRR6031381.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1770.86 351 7.76934 Potri.005G024800.1.v4.1 1035 787.862 108 5.37323 Potri.004G059700.1.v4.1 961 713.869 5 0.274545 Potri.007G009000.2.v4.1 1416 1168.86 0 0 Potri.003G141000.2.v4.1 2943 2695.86 511 7.42993 Potri.016G087400.1.v4.1 270 77.7197 1827.53 921.709 Potri.015G069301.1.v4.1 564 321.355 0 0 Potri.010G195200.1.v4.1 1773 1525.86 62 1.59271 Potri.012G127500.1.v4.1 977 729.869 4238 227.603 ==> SRR6031381.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 23 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 6 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 289 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR6031381 completed mapping pipeline successfully