Starting /dee2/code/volunteer_pipeline.sh SRR6031382 current disk space = 3085526102016 free memory = 1486431308 SRR6031382 SRAfilesize 7013e6e52a017c37ed55fbedb6f3917f SRR6031382.sra SRR6031382.sra file validated SRR6031382 is paired end SRR6031382 is conventional basespace SRR6031382 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031382_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.114 34.0 33.0 34.0 33.0 34.0 2 33.3185 34.0 33.0 34.0 33.0 34.0 3 33.32425 34.0 33.0 34.0 33.0 34.0 4 33.4 34.0 33.0 34.0 33.0 34.0 5 33.323 34.0 33.0 34.0 33.0 34.0 6 37.05375 38.0 38.0 38.0 36.0 38.0 7 37.27375 38.0 38.0 38.0 37.0 38.0 8 37.39375 38.0 38.0 38.0 37.0 38.0 9 37.40975 38.0 38.0 38.0 37.0 38.0 10-14 37.39195 38.0 38.0 38.0 37.0 38.0 15-19 37.467 38.0 38.0 38.0 37.0 38.0 20-24 37.467200000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.42265 38.0 38.0 38.0 37.0 38.0 30-34 37.41335 38.0 38.0 38.0 37.0 38.0 35-39 37.36025 38.0 38.0 38.0 37.0 38.0 40-44 37.2737 38.0 38.0 38.0 37.0 38.0 45-49 37.26215 38.0 38.0 38.0 37.0 38.0 50-54 37.204049999999995 38.0 38.0 38.0 36.8 38.0 55-59 37.12185 38.0 38.0 38.0 36.0 38.0 60-64 37.101800000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.0606 38.0 38.0 38.0 36.0 38.0 70-74 37.03935 38.0 38.0 38.0 36.0 38.0 75-79 36.9649 38.0 38.0 38.0 36.0 38.0 80-84 36.8772 38.0 38.0 38.0 36.0 38.0 85-89 36.83775 38.0 38.0 38.0 35.6 38.0 90-94 36.8364 38.0 38.0 38.0 35.8 38.0 95-99 36.72359999999999 38.0 38.0 38.0 35.2 38.0 100-104 36.682500000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.57315 38.0 38.0 38.0 34.4 38.0 110-114 36.48815 38.0 38.0 38.0 34.4 38.0 115-119 36.345150000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.208600000000004 38.0 38.0 38.0 34.0 38.0 125-129 36.0149 38.0 37.4 38.0 33.4 38.0 130-134 35.904999999999994 38.0 37.6 38.0 33.0 38.0 135-139 35.60509999999999 38.0 36.6 38.0 31.8 38.0 140-144 35.230000000000004 38.0 36.0 38.0 31.0 38.0 145-149 34.481649999999995 38.0 36.0 38.0 29.2 38.0 150 27.80175 33.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 2.0 16 1.0 17 2.0 18 3.0 19 3.0 20 1.0 21 5.0 22 8.0 23 4.0 24 6.0 25 12.0 26 19.0 27 21.0 28 25.0 29 38.0 30 32.0 31 48.0 32 59.0 33 79.0 34 119.0 35 170.0 36 458.0 37 2881.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.41057934508816 13.85390428211587 10.35264483627204 34.38287153652393 2 21.85 16.975 34.35 26.825 3 18.75 25.3 26.275 29.675 4 22.725 31.0 22.650000000000002 23.625 5 22.40300375469337 34.242803504380475 24.680851063829788 18.67334167709637 6 17.075000000000003 36.875 25.1 20.95 7 13.450000000000001 24.75 44.2 17.599999999999998 8 17.849999999999998 23.200000000000003 32.65 26.3 9 17.65 23.875 33.425 25.05 10-14 20.369999999999997 30.09 26.729999999999997 22.81 15-19 19.435 28.799999999999997 27.834999999999997 23.93 20-24 19.915 28.725 27.99 23.369999999999997 25-29 19.535 28.95 28.185 23.330000000000002 30-34 19.67 29.044999999999998 27.855 23.43 35-39 19.86 27.985 28.18 23.974999999999998 40-44 19.89 28.525 28.395 23.189999999999998 45-49 19.395 29.215000000000003 27.615000000000002 23.775 50-54 20.0 29.020000000000003 27.715 23.265 55-59 19.67 28.694999999999997 27.544999999999998 24.09 60-64 19.689999999999998 28.43 28.544999999999998 23.335 65-69 20.72 28.32 27.834999999999997 23.125 70-74 20.560000000000002 28.59 27.560000000000002 23.29 75-79 19.685 28.52 28.21 23.585 80-84 20.435 28.685 27.72 23.16 85-89 20.47 28.294999999999998 27.655 23.580000000000002 90-94 19.55 28.860000000000003 27.96 23.630000000000003 95-99 19.689999999999998 28.355000000000004 28.305000000000003 23.65 100-104 20.724999999999998 28.465 27.74 23.07 105-109 19.725 28.634999999999998 27.465 24.175 110-114 20.39 27.865000000000002 27.750000000000004 23.995 115-119 20.465 28.515 27.665 23.355 120-124 20.49 28.175 27.77 23.565 125-129 19.950000000000003 28.035 27.91 24.104999999999997 130-134 20.815 28.74 27.365000000000002 23.080000000000002 135-139 20.36 28.325 27.565 23.75 140-144 20.585 28.384999999999998 27.33 23.7 145-149 20.695 28.494999999999997 27.229999999999997 23.580000000000002 150 21.060530265132567 27.988994497248626 26.863431715857928 24.087043521760883 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 0.5 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 2.5 23 5.0 24 5.0 25 4.5 26 6.0 27 7.5 28 8.5 29 14.0 30 21.0 31 30.5 32 35.5 33 43.0 34 57.5 35 69.0 36 88.0 37 120.0 38 149.5 39 167.0 40 195.5 41 217.0 42 236.0 43 263.5 44 282.0 45 277.5 46 258.5 47 253.0 48 231.0 49 188.5 50 174.0 51 150.0 52 106.0 53 90.5 54 70.5 55 44.5 56 32.5 57 24.5 58 17.0 59 12.0 60 10.5 61 5.5 62 4.0 63 3.0 64 0.5 65 1.0 66 1.5 67 2.5 68 2.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.75 2 0.0 3 0.0 4 0.0 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.2625 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.3625 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.625 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.875 0.0 0.0 0.0 0.0 120-121 1.0 0.0 0.0 0.0 0.0 122-123 1.1375000000000002 0.0 0.0 0.0 0.0 124-125 1.275 0.0 0.0 0.0 0.0 126-127 1.3875 0.0 0.0 0.0 0.0 128-129 1.5375 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.925 0.0 0.0 0.0 0.0 134-135 2.0 0.0 0.0 0.0 0.0 136-137 2.125 0.0 0.0 0.0 0.0 138 2.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTTTG 10 0.006973645 144.0 8 TTCTCTA 10 0.006973645 144.0 7 TCTCTAT 10 0.006973645 144.0 8 >>END_MODULE SRR6031382 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031382_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62425 33.0 33.0 34.0 32.0 34.0 2 32.69125 33.0 33.0 34.0 32.0 34.0 3 32.721 34.0 33.0 34.0 32.0 34.0 4 32.68925 34.0 33.0 34.0 32.0 34.0 5 32.60275 34.0 33.0 34.0 32.0 34.0 6 36.74025 38.0 38.0 38.0 36.0 38.0 7 36.789 38.0 38.0 38.0 36.0 38.0 8 36.669 38.0 38.0 38.0 36.0 38.0 9 36.6705 38.0 38.0 38.0 36.0 38.0 10-14 36.77055 38.0 38.0 38.0 36.0 38.0 15-19 36.70934999999999 38.0 38.0 38.0 36.0 38.0 20-24 36.702999999999996 38.0 38.0 38.0 36.0 38.0 25-29 36.75705000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.756099999999996 38.0 38.0 38.0 36.0 38.0 35-39 36.65075 38.0 38.0 38.0 36.0 38.0 40-44 36.392 38.0 38.0 38.0 35.2 38.0 45-49 36.60575 38.0 38.0 38.0 35.4 38.0 50-54 36.5432 38.0 38.0 38.0 35.2 38.0 55-59 36.60515 38.0 38.0 38.0 35.6 38.0 60-64 36.52505 38.0 38.0 38.0 35.0 38.0 65-69 36.45605 38.0 38.0 38.0 35.0 38.0 70-74 36.4683 38.0 38.0 38.0 35.0 38.0 75-79 36.43775 38.0 38.0 38.0 35.0 38.0 80-84 35.613200000000006 38.0 38.0 38.0 33.0 38.0 85-89 34.8424 38.0 38.0 38.0 29.4 38.0 90-94 34.915099999999995 38.0 38.0 38.0 28.8 38.0 95-99 34.74995 38.0 38.0 38.0 27.8 38.0 100-104 35.6873 38.0 38.0 38.0 30.6 38.0 105-109 36.001050000000006 38.0 38.0 38.0 33.8 38.0 110-114 35.878699999999995 38.0 38.0 38.0 33.6 38.0 115-119 35.77955 38.0 38.0 38.0 33.2 38.0 120-124 35.70975 38.0 38.0 38.0 33.0 38.0 125-129 34.8658 38.0 37.2 38.0 27.8 38.0 130-134 33.348400000000005 38.0 36.2 38.0 15.6 38.0 135-139 32.2236 38.0 34.8 38.0 2.0 38.0 140-144 31.9775 38.0 33.0 38.0 2.0 38.0 145-149 31.89345 38.0 33.0 38.0 2.0 38.0 150 25.6445 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 3.0 4 5.0 5 0.0 6 4.0 7 2.0 8 4.0 9 2.0 10 3.0 11 6.0 12 6.0 13 5.0 14 5.0 15 4.0 16 2.0 17 6.0 18 0.0 19 8.0 20 11.0 21 11.0 22 12.0 23 22.0 24 37.0 25 25.0 26 40.0 27 73.0 28 59.0 29 45.0 30 39.0 31 57.0 32 79.0 33 127.0 34 119.0 35 214.0 36 364.0 37 2583.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.33316620706944 20.30584106292304 13.762847831536726 26.598144898470792 2 25.984449460747427 25.106596438424884 32.731376975169304 16.17757712565839 3 19.81439678956609 27.514421871081012 32.731376975169304 19.939804364183598 4 24.354150990719837 34.963631803360926 22.573363431151243 18.108853774767997 5 24.228743416102333 38.324554803110104 21.8459994983697 15.600702282417858 6 19.01302605210421 37.97595190380761 24.09819639278557 18.912825651302605 7 19.36372745490982 19.338677354709418 40.5060120240481 20.791583166332668 8 20.96693386773547 24.123246492985974 28.38176352705411 26.528056112224448 9 22.163786626596544 25.244177310293015 29.151014274981218 23.441021788129227 10-14 23.75776397515528 28.476257263073535 26.552795031055897 21.213183730715286 15-19 23.066132264529056 28.026052104208414 28.35671342685371 20.551102204408817 20-24 22.294589178356713 28.782565130260522 28.597194388777552 20.32565130260521 25-29 22.979810630729926 28.270126747156954 28.290165823355544 20.459896798757576 30-34 22.70814547640517 28.103396453261198 28.709548141468787 20.478909928864844 35-39 23.123742454728372 28.12374245472837 28.143863179074447 20.60865191146881 40-44 23.035326224288674 28.210441198766866 28.336786779198462 20.417445797745994 45-49 22.96018031555222 27.848735286751815 29.000751314800898 20.190333082895066 50-54 23.06150067665781 27.717908876748034 28.264247406145053 20.9563430404491 55-59 22.94736842105263 28.12531328320802 28.501253132832083 20.426065162907268 60-64 22.70221509471785 28.665931642778393 28.480505161872305 20.151348100631452 65-69 23.105073190294767 28.34369360336876 28.243432925606577 20.3078002807299 70-74 23.543567632608042 27.659681139075502 28.236237842173868 20.560513386142585 75-79 23.040689516937263 27.405291641611544 28.75826819001804 20.795750651433153 80-84 23.596945312900417 27.758700220388498 28.532622623135666 20.11173184357542 85-89 23.33821836072438 28.122055898670574 28.169161519941376 20.370564220663667 90-94 24.045107311749728 27.859481369848776 27.80231772592631 20.293093592475188 95-99 23.367554328000416 27.95351503465527 28.20365834592735 20.475272291416957 100-104 23.640566891144836 28.073173183234495 27.776660970951855 20.50959895466881 105-109 23.764411027568922 27.413533834586467 28.165413533834588 20.656641604010026 110-114 23.458646616541355 27.94987468671679 28.516290726817044 20.075187969924812 115-119 24.108888554669875 27.67834762119617 28.224795708627866 19.987968115506092 120-124 23.086562077088868 28.24419828580021 28.40960352864518 20.25963610846574 125-129 23.623491060968778 28.401161310039218 27.942749452452503 20.0325981765395 130-134 23.759804960780155 28.656985372058514 27.437990248039007 20.145219419122324 135-139 23.652041039074437 28.509059157389217 28.388998035363457 19.44990176817289 140-144 23.597668573873054 27.795305063900326 28.137532752259236 20.469493609967383 145-149 24.215587044534413 27.85931174089069 27.85425101214575 20.07085020242915 150 24.367009275507645 26.67335171722236 29.155176736024067 19.804462271245924 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 4.0 1 2.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.5 7 1.0 8 0.5 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 1.0 22 2.0 23 2.0 24 2.5 25 5.5 26 9.5 27 12.5 28 15.5 29 21.5 30 25.0 31 28.0 32 37.0 33 47.5 34 59.5 35 75.0 36 97.5 37 123.5 38 146.5 39 171.0 40 199.0 41 231.0 42 262.0 43 263.5 44 283.0 45 295.0 46 265.5 47 234.0 48 210.0 49 186.0 50 157.5 51 130.5 52 97.5 53 77.0 54 57.0 55 40.5 56 32.0 57 24.0 58 20.5 59 13.5 60 8.0 61 7.5 62 3.5 63 0.5 64 0.5 65 2.5 66 2.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.27499999999999997 2 0.325 3 0.325 4 0.325 5 0.325 6 0.2 7 0.2 8 0.2 9 0.17500000000000002 10-14 0.18 15-19 0.2 20-24 0.2 25-29 0.19499999999999998 30-34 0.19 35-39 0.6 40-44 1.065 45-49 0.17500000000000002 50-54 0.245 55-59 0.25 60-64 0.22999999999999998 65-69 0.26 70-74 0.27 75-79 0.22 80-84 2.445 85-89 4.47 90-94 3.785 95-99 4.055000000000001 100-104 0.51 105-109 0.25 110-114 0.25 115-119 0.265 120-124 0.245 125-129 1.8350000000000002 130-134 5.66 135-139 8.38 140-144 6.494999999999999 145-149 1.2 150 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72403411941796 99.375 2 0.2508780732563974 0.5 3 0.0 0.0 4 0.0 0.0 5 0.025087807325639738 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3125 0.0 0.0 0.0 0.0 106-107 0.325 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.575 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.7124999999999999 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.2 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.4500000000000002 0.0 0.0 0.0 0.0 130-131 1.575 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 1.85 0.0 0.0 0.0 0.0 136-137 1.9874999999999998 0.0 0.0 0.0 0.0 138 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGTTAT 10 0.006973645 144.0 9 GCTTTGA 10 0.006973645 144.0 4 >>END_MODULE Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383268 spots for SRR6031382.sra Written 1383268 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra Read 1383252 spots for SRR6031382.sra Written 1383252 spots for SRR6031382.sra SRR ids: ['SRR6031382.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mwsclg_8 SRR6031382.sra spots: 27665056 blocks: [[1, 1383252], [1383253, 2766504], [2766505, 4149756], [4149757, 5533008], [5533009, 6916260], [6916261, 8299512], [8299513, 9682764], [9682765, 11066016], [11066017, 12449268], [12449269, 13832520], [13832521, 15215772], [15215773, 16599024], [16599025, 17982276], [17982277, 19365528], [19365529, 20748780], [20748781, 22132032], [22132033, 23515284], [23515285, 24898536], [24898537, 26281788], [26281789, 27665056]] SRR6031382 file size 9299046 SRR6031382 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031382 SRR6031382_1.fastq SRR6031382_2.fastq Input file: SRR6031382_1.fastq Paired file: SRR6031382_2.fastq trimmed: SRR6031382-trimmed-pair1.fastq, SRR6031382-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:03:44 2025 >> started Fri Feb 14 06:04:13 2025 >> done (29.479s) 27665056 read pairs processed; of these: 48280 ( 0.17%) short read pairs filtered out after trimming by size control 58763 ( 0.21%) empty read pairs filtered out after trimming by size control 27558013 (99.61%) read pairs available; of these: 10689540 (38.79%) trimmed read pairs available after processing 16868473 (61.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 7 0.00% 20 3 0.00% 21 16 0.00% 22 11 0.00% 23 10 0.00% 24 10 0.00% 25 12 0.00% 26 11 0.00% 27 20 0.00% 28 12 0.00% 29 14 0.00% 30 19 0.00% 31 22 0.00% 32 19 0.00% 33 15 0.00% 34 16 0.00% 35 26 0.00% 36 31 0.00% 37 25 0.00% 38 23 0.00% 39 34 0.00% 40 27 0.00% 41 46 0.00% 42 37 0.00% 43 42 0.00% 44 69 0.00% 45 41 0.00% 46 61 0.00% 47 65 0.00% 48 77 0.00% 49 74 0.00% 50 84 0.00% 51 95 0.00% 52 106 0.00% 53 120 0.00% 54 125 0.00% 55 108 0.00% 56 149 0.00% 57 148 0.00% 58 171 0.00% 59 156 0.00% 60 209 0.00% 61 209 0.00% 62 243 0.00% 63 296 0.00% 64 334 0.00% 65 383 0.00% 66 380 0.00% 67 543 0.00% 68 787 0.00% 69 2985 0.01% 70 3339 0.01% 71 1186 0.00% 72 952 0.00% 73 906 0.00% 74 1017 0.00% 75 978 0.00% 76 1119 0.00% 77 1233 0.00% 78 1380 0.01% 79 1528 0.01% 80 1732 0.01% 81 1976 0.01% 82 2277 0.01% 83 2962 0.01% 84 6133 0.02% 85 6456 0.02% 86 6432 0.02% 87 6866 0.02% 88 7007 0.03% 89 7205 0.03% 90 7668 0.03% 91 7817 0.03% 92 8383 0.03% 93 9023 0.03% 94 9519 0.03% 95 10605 0.04% 96 11033 0.04% 97 13329 0.05% 98 16383 0.06% 99 11942 0.04% 100 12277 0.04% 101 12974 0.05% 102 14110 0.05% 103 14895 0.05% 104 15871 0.06% 105 16932 0.06% 106 17540 0.06% 107 18657 0.07% 108 19608 0.07% 109 20294 0.07% 110 21068 0.08% 111 22140 0.08% 112 22872 0.08% 113 24376 0.09% 114 25208 0.09% 115 26733 0.10% 116 27710 0.10% 117 28623 0.10% 118 30074 0.11% 119 31109 0.11% 120 32456 0.12% 121 33768 0.12% 122 35320 0.13% 123 37319 0.14% 124 39475 0.14% 125 43054 0.16% 126 43806 0.16% 127 45495 0.17% 128 47727 0.17% 129 50467 0.18% 130 53476 0.19% 131 55814 0.20% 132 59338 0.22% 133 62826 0.23% 134 67260 0.24% 135 72915 0.26% 136 79844 0.29% 137 89805 0.33% 138 96847 0.35% 139 107305 0.39% 140 114760 0.42% 141 124726 0.45% 142 136421 0.50% 143 157424 0.57% 144 185609 0.67% 145 229578 0.83% 146 304259 1.10% 147 471243 1.71% 148 931810 3.38% 149 6279405 22.79% 150 16868473 61.21% 27558013 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.82 fanout-score-rank=30 prefix-density=0.18 prefix-fanout=2.5 sequence=TGACCAGCCTCTTGCACTGATTCCTTTGCAGATTGAGCAGCATT criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=111.07 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=12.6 sequence=ATCTTCCTCGTTAATTATTCAATACATCAACTTGAATGTTTATTCTAGTCCAGTAATTAGTAGCTCATAGCCATAACTTGGGAGTACGTTGATGTCACCACTTTCATGGAATGGTGAAGCTTCCACATTTGGTGCCATGTGCGAGTGGTATGCCACAATATTGAGCAACATGGGCCACTTTTGCCATATTAATGACAGCTTCAATGTCGTTAGTGACTTGCTTACACACACAAGGGACATCCAGAGTCTTGATTGTATTGCAACAGTCGGGAGATGGGTCTGTTTGTGGCCCTTGTATCTGAACATACTTGGAACATTGTGTAATTAAACCTTGGAAGTCACCATGGCATTCTTGGCCAAGGGCTACATTGTTGCTCGGAATCAGAATTCCGATCACTGCAAGAATGGCTAGGATCATAAAGTAGTGGACATTCGAGATAGCCATAATTCTCTTCT criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.77 fanout-score-rank=26 prefix-density=0.27 prefix-fanout=3.1 sequence=GGCCAAGCTCAGGAGAAGGCCAGTACCTTGATGGACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=41 fanout-score=169.24 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=11.2 sequence=AAGCTCAAATGCCCAAGATGGAAAGATTAATCAAGACAACGACACTAAC SRR6031382 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:04:59 Started mapping on | Feb 14 06:05:00 Finished on | Feb 14 06:08:13 Mapping speed, Million of reads per hour | 514.04 Number of input reads | 27558013 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 26109958 Uniquely mapped reads % | 94.75% Average mapped length | 294.66 Number of splices: Total | 25031120 Number of splices: Annotated (sjdb) | 24543236 Number of splices: GT/AG | 24625059 Number of splices: GC/AG | 320424 Number of splices: AT/AC | 15036 Number of splices: Non-canonical | 70601 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.85 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 767679 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 39915 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.29% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 733231 733231 733231 N_multimapping 767679 767679 767679 N_noFeature 702119 25777964 874126 N_ambiguous 368154 1860 207034 UnstrandedReadsAssigned:25039685 PositiveStrandReadsAssigned:330134 NegativeStrandReadsAssigned:25028798 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031382 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031382-trimmed-pair1.fastq SRR6031382-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,558,013 reads, 25,087,551 reads pseudoaligned [quant] estimated average fragment length: 261.191 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 990 rounds 52401 SRR6031382.ke.tsv 34699 SRR6031382.se.tsv 87100 total ==> SRR6031382.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1757.81 809 17.1874 Potri.005G024800.1.v4.1 1035 774.809 312 15.0381 Potri.004G059700.1.v4.1 961 700.847 26 1.38543 Potri.007G009000.2.v4.1 1416 1155.81 0 0 Potri.003G141000.2.v4.1 2943 2682.81 489 6.80694 Potri.016G087400.1.v4.1 270 69.4255 1940 1043.56 Potri.015G069301.1.v4.1 564 309.87 0 0 Potri.010G195200.1.v4.1 1773 1512.81 53.5013 1.32073 Potri.012G127500.1.v4.1 977 716.833 5164 269.03 ==> SRR6031382.se.tsv <== Potri.001G166300.v4.1 122 Potri.001G448400.v4.1 1787 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 507 Potri.001G212900.v4.1 327 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR6031382 completed mapping pipeline successfully