Starting /dee2/code/volunteer_pipeline.sh SRR6031383 current disk space = 3085670273024 free memory = 1469363764 SRR6031383 SRAfilesize d2f2e6dce5f106bc7af627dc0b6e6d68 SRR6031383.sra SRR6031383.sra file validated SRR6031383 is paired end SRR6031383 is conventional basespace SRR6031383 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031383_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 42 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.377 34.0 33.0 34.0 33.0 34.0 2 33.50025 34.0 34.0 34.0 33.0 34.0 3 33.50525 34.0 34.0 34.0 33.0 34.0 4 33.48925 34.0 34.0 34.0 33.0 34.0 5 33.5175 34.0 34.0 34.0 33.0 34.0 6 37.3215 38.0 38.0 38.0 36.0 38.0 7 37.391 38.0 38.0 38.0 37.0 38.0 8 37.48875 38.0 38.0 38.0 37.0 38.0 9 37.425 38.0 38.0 38.0 37.0 38.0 10-14 37.084300000000006 38.0 38.0 38.0 36.2 38.0 15-19 37.10275 38.0 38.0 38.0 36.4 38.0 20-24 36.97685 38.0 38.0 38.0 36.4 38.0 25-29 36.902 38.0 38.0 38.0 36.2 38.0 30-34 36.799350000000004 38.0 38.0 38.0 36.0 38.0 35-39 36.5168 38.0 38.0 38.0 34.8 38.0 40-44 35.763749999999995 38.0 38.0 38.0 29.6 38.0 45-49 35.928749999999994 38.0 38.0 38.0 30.6 38.0 50-54 36.201699999999995 38.0 38.0 38.0 33.4 38.0 55-59 36.107400000000005 38.0 38.0 38.0 33.0 38.0 60-64 36.08755 38.0 38.0 38.0 33.0 38.0 65-69 35.9408 38.0 37.8 38.0 32.6 38.0 70-74 35.55825 38.0 37.0 38.0 30.0 38.0 75-79 35.1348 38.0 37.0 38.0 28.8 38.0 80-84 34.86445 38.0 37.0 38.0 27.2 38.0 85-89 34.77725 38.0 37.0 38.0 26.6 38.0 90-94 34.8165 38.0 37.0 38.0 27.0 38.0 95-99 34.69895 38.0 36.8 38.0 26.6 38.0 100-104 34.42235 38.0 36.2 38.0 24.2 38.0 105-109 34.1837 38.0 36.0 38.0 22.6 38.0 110-114 34.0353 38.0 36.0 38.0 20.6 38.0 115-119 33.69245 38.0 35.2 38.0 15.0 38.0 120-124 33.407900000000005 38.0 35.0 38.0 15.0 38.0 125-129 33.15435 38.0 35.0 38.0 14.8 38.0 130-134 32.75035 38.0 34.0 38.0 14.0 38.0 135-139 32.369150000000005 38.0 34.0 38.0 13.4 38.0 140-144 31.958000000000006 38.0 34.0 38.0 6.4 38.0 145-149 31.240550000000002 38.0 33.6 38.0 2.0 38.0 150 24.8615 34.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 2.0 5 1.0 6 2.0 7 3.0 8 1.0 9 2.0 10 1.0 11 10.0 12 13.0 13 14.0 14 14.0 15 15.0 16 8.0 17 10.0 18 19.0 19 47.0 20 13.0 21 22.0 22 22.0 23 22.0 24 30.0 25 31.0 26 40.0 27 49.0 28 56.0 29 68.0 30 67.0 31 73.0 32 83.0 33 107.0 34 163.0 35 227.0 36 476.0 37 2288.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.892704938581105 3.584858360491351 18.70142892955628 25.821007771371267 2 29.025000000000002 6.8500000000000005 38.275 25.85 3 25.85 15.075 34.5 24.575 4 31.75 17.875 31.175000000000004 19.2 5 27.375 21.075 35.025 16.525000000000002 6 25.825 22.775000000000002 32.4 19.0 7 17.375 22.875 49.325 10.424999999999999 8 20.4 20.825 39.525 19.25 9 24.075 19.15 39.925 16.85 10-14 22.275 30.36 30.9 16.465 15-19 23.064999999999998 28.560000000000002 30.5 17.875 20-24 22.1 27.944999999999997 30.36 19.595000000000002 25-29 22.040000000000003 27.51 30.630000000000003 19.82 30-34 22.29 26.875 30.605 20.23 35-39 22.27 27.639999999999997 29.89 20.200000000000003 40-44 21.68 27.07 31.31 19.939999999999998 45-49 23.41 27.235 30.3 19.055 50-54 22.38 27.405 30.520000000000003 19.695 55-59 21.62 27.24 30.959999999999997 20.18 60-64 21.985 27.855 30.055 20.105 65-69 20.78207820782078 29.127912791279126 30.073007300730076 20.017001700170017 70-74 21.26318947842176 29.30939640946142 29.81947292093814 19.607941191178675 75-79 21.972197219721973 28.657865786578657 29.65796579657966 19.711971197119713 80-84 21.623243486522977 28.58428764314647 30.30454568185228 19.48792318847827 85-89 22.245 28.335 29.09 20.330000000000002 90-94 22.415 28.375 30.14 19.07 95-99 22.25 28.215 29.26 20.275000000000002 100-104 22.152215221522155 29.287928792879285 28.82788278827883 19.731973197319732 105-109 20.617061706170617 29.532953295329534 29.042904290429046 20.807080708070806 110-114 21.468220233034955 28.74431164674701 29.409411411711755 20.378056708506275 115-119 21.725862931465734 29.03951975987994 28.65432716358179 20.580290145072535 120-124 20.239107598419288 29.568305737581912 29.443249462258013 20.749337201740783 125-129 22.08773070574701 28.60501175411394 28.54999249737408 20.75726504276497 130-134 22.314462892578515 28.980796159231847 28.130626125225046 20.574114822964592 135-139 21.755 29.45 27.355 21.44 140-144 22.005 28.999999999999996 27.6 21.395 145-149 21.995 29.335 27.169999999999998 21.5 150 21.3 29.099999999999998 28.599999999999998 21.0 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 3.5 3 5.5 4 4.0 5 4.5 6 6.5 7 7.0 8 4.5 9 2.0 10 2.0 11 2.0 12 1.5 13 3.0 14 4.5 15 3.5 16 3.5 17 4.0 18 5.0 19 5.5 20 7.5 21 7.0 22 6.5 23 12.0 24 17.5 25 18.5 26 20.5 27 30.0 28 40.5 29 46.5 30 55.5 31 66.5 32 74.5 33 73.5 34 81.0 35 94.0 36 100.5 37 116.5 38 124.0 39 139.0 40 163.0 41 191.0 42 205.0 43 209.0 44 225.0 45 219.5 46 213.5 47 199.5 48 169.0 49 164.0 50 140.0 51 121.0 52 130.0 53 116.5 54 81.5 55 52.5 56 42.5 57 30.0 58 17.0 59 17.0 60 22.5 61 21.0 62 16.5 63 10.0 64 6.0 65 5.0 66 4.0 67 2.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.01 70-74 0.015 75-79 0.01 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.01 105-109 0.01 110-114 0.015 115-119 0.05 120-124 0.045 125-129 0.034999999999999996 130-134 0.02 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.05 #Duplication Level Percentage of deduplicated Percentage of total 1 97.31525784157363 91.525 2 2.046783625730994 3.85 3 0.3189792663476874 0.8999999999999999 4 0.053163211057947905 0.2 5 0.053163211057947905 0.25 6 0.0 0.0 7 0.026581605528973953 0.17500000000000002 8 0.053163211057947905 0.4 9 0.0 0.0 >10 0.10632642211589581 1.4000000000000001 >50 0.026581605528973953 1.3 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCACGCATCTCGTATGC 52 1.3 TruSeq Adapter, Index 23 (97% over 39bp) GTGGCTTGTAGACTGGTGGCTTCTCAATTGGTGGCTTGTAGACTGGTGGT 18 0.44999999999999996 No Hit GGCTTGTAGACTGGTGGCTTCTCAATTGGTGGCTTGTAGACTGGTGGTGG 15 0.375 No Hit GTGGCTTCTCAATCTTTGGAGGCTTGTAGACTGGTGGCTTCTCAATCTTT 12 0.3 No Hit CTTGTAGACTGGTGGCTTCTCAATTGGTGGCTTGTAGACTGGTGGTGGCT 11 0.27499999999999997 No Hit GGTGGCTTCTCAATCTTTGGAGGCTTGTAGACTGGTGGCTTCTCAATCTT 8 0.2 No Hit GTAGACTGGTGGCTTCTCAATTGGTGGCTTGTAGACTGGTGGTGGCTTGT 8 0.2 No Hit GCTTGTAGACTGGTGGCTTCTCAATTGGTGGCTTGTAGACTGGTGGTGGC 7 0.17500000000000002 No Hit GGTGGCTTGTAGACTGGTGGCTTCTCAATTGGTGGCTTGTAGACTGGTGG 5 0.125 No Hit GGCTTCTCAATCTTTGGAGGCTTGTAGACTGGTGGCTTCTCAATCTTTGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.16249999999999998 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.35 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.44999999999999996 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.875 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.175 0.0 0.0 0.0 0.0 96-97 1.3875000000000002 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.7625 0.0 0.0 0.0 0.0 102-103 1.9500000000000002 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 2.825 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.325 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 4.0 0.0 0.0 0.0 0.0 120-121 4.5 0.0 0.0 0.0 0.0 122-123 4.9 0.0 0.0 0.0 0.0 124-125 5.574999999999999 0.0 0.0 0.0 0.0 126-127 6.25 0.0 0.0 0.0 0.0 128-129 6.7625 0.0 0.0 0.0 0.0 130-131 7.0875 0.0 0.0 0.0 0.0 132-133 7.612500000000001 0.0 0.0 0.0 0.0 134-135 8.425 0.0 0.0 0.0 0.0 136-137 9.125 0.0 0.0 0.0 0.0 138 9.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCACTCA 10 0.006973645 144.0 1 TTTTTTT 95 8.925976E-5 37.894737 1 >>END_MODULE SRR6031383 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031383_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.757 33.0 33.0 34.0 32.0 34.0 2 32.80875 34.0 33.0 34.0 32.0 34.0 3 32.7785 34.0 33.0 34.0 32.0 34.0 4 32.596 34.0 33.0 34.0 32.0 34.0 5 32.64775 34.0 33.0 34.0 32.0 34.0 6 36.6865 38.0 38.0 38.0 36.0 38.0 7 36.57575 38.0 38.0 38.0 36.0 38.0 8 36.7195 38.0 38.0 38.0 36.0 38.0 9 36.60625 38.0 38.0 38.0 36.0 38.0 10-14 36.6158 38.0 38.0 38.0 36.0 38.0 15-19 36.588350000000005 38.0 38.0 38.0 36.0 38.0 20-24 36.6002 38.0 38.0 38.0 36.0 38.0 25-29 36.57615 38.0 38.0 38.0 36.0 38.0 30-34 36.480149999999995 38.0 38.0 38.0 35.8 38.0 35-39 36.33845 38.0 38.0 38.0 35.2 38.0 40-44 36.13705 38.0 38.0 38.0 34.6 38.0 45-49 36.22175 38.0 38.0 38.0 34.2 38.0 50-54 36.271249999999995 38.0 38.0 38.0 34.4 38.0 55-59 36.25090000000001 38.0 38.0 38.0 34.6 38.0 60-64 36.3691 38.0 38.0 38.0 35.0 38.0 65-69 36.1981 38.0 38.0 38.0 34.6 38.0 70-74 35.88205000000001 38.0 38.0 38.0 34.0 38.0 75-79 35.830799999999996 38.0 38.0 38.0 34.0 38.0 80-84 35.38495 38.0 38.0 38.0 32.0 38.0 85-89 35.03660000000001 38.0 38.0 38.0 30.2 38.0 90-94 34.9428 38.0 38.0 38.0 29.8 38.0 95-99 34.8057 38.0 38.0 38.0 28.6 38.0 100-104 35.166650000000004 38.0 38.0 38.0 29.6 38.0 105-109 35.3535 38.0 38.0 38.0 31.8 38.0 110-114 35.256150000000005 38.0 38.0 38.0 31.4 38.0 115-119 35.1306 38.0 38.0 38.0 30.6 38.0 120-124 35.0285 38.0 37.8 38.0 30.2 38.0 125-129 34.50915 38.0 37.2 38.0 26.0 38.0 130-134 33.684 38.0 36.2 38.0 15.6 38.0 135-139 32.93205 38.0 35.4 38.0 8.6 38.0 140-144 32.605000000000004 38.0 35.0 38.0 2.0 38.0 145-149 31.875149999999998 38.0 33.0 38.0 2.0 38.0 150 25.22525 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 16.0 3 5.0 4 7.0 5 9.0 6 8.0 7 4.0 8 4.0 9 4.0 10 9.0 11 12.0 12 10.0 13 17.0 14 7.0 15 11.0 16 19.0 17 9.0 18 13.0 19 6.0 20 6.0 21 3.0 22 11.0 23 15.0 24 27.0 25 25.0 26 24.0 27 43.0 28 53.0 29 38.0 30 43.0 31 47.0 32 60.0 33 103.0 34 105.0 35 202.0 36 361.0 37 2664.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.85 2.6 21.05 29.5 2 31.474999999999998 9.725 30.55 28.249999999999996 3 16.375 20.45 42.699999999999996 20.474999999999998 4 21.9 31.75 22.675 23.674999999999997 5 23.674999999999997 36.75 20.150000000000002 19.425 6 19.075 34.849999999999994 24.725 21.349999999999998 7 19.15 21.825 39.725 19.3 8 19.5 25.2 27.525 27.775 9 21.025 25.4 27.150000000000002 26.424999999999997 10-14 21.0 29.56 26.96 22.48 15-19 21.17 29.080000000000002 27.875 21.875 20-24 21.115000000000002 29.909999999999997 27.029999999999998 21.945 25-29 21.11 30.585 26.779999999999998 21.525 30-34 20.625 29.599999999999998 28.27 21.505 35-39 20.373063230206085 29.830015544301258 27.568570425713286 22.22835079977937 40-44 21.127683160334577 29.58278746346871 27.874634687090598 21.414894689106116 45-49 20.94709470947095 28.422842284228423 28.01780178017802 22.612261226122612 50-54 20.895 29.375 27.860000000000003 21.87 55-59 20.455000000000002 29.049999999999997 28.485 22.009999999999998 60-64 20.265 29.709999999999997 28.050000000000004 21.975 65-69 20.03 29.695 27.865000000000002 22.41 70-74 20.435 29.725 28.000000000000004 21.84 75-79 20.615 30.035 27.715 21.634999999999998 80-84 20.521106847101596 29.605130276711776 27.9135528176126 21.960210058574027 85-89 20.926068048094145 29.25556408288565 27.93553338449731 21.882834484522895 90-94 20.320335687237744 29.695015863268857 27.965407839525124 22.019240609968275 95-99 20.85038886614818 29.860826852230865 27.21039705280393 22.07838722881703 100-104 20.539617143144252 29.90001507310456 27.161734411897704 22.398633371853492 105-109 20.64 29.65 28.185 21.525 110-114 20.880000000000003 29.385 27.855 21.88 115-119 21.709999999999997 29.720000000000002 27.055 21.515 120-124 20.925 30.375000000000004 27.42 21.279999999999998 125-129 21.663891831895466 30.31633116391706 26.52742041269361 21.49235659149387 130-134 22.097513257478248 30.113782628842095 25.789013025794162 21.9996910878855 135-139 21.419247036708267 29.737350529998434 27.434598715471775 21.408803717821524 140-144 22.183007214408054 29.765921004826907 26.849016453002545 21.202055327762494 145-149 22.89837521445151 30.553032596629325 26.400242204056916 20.148349984862246 150 23.7 29.625 26.700000000000003 19.975 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.5 15 0.5 16 0.0 17 1.0 18 1.5 19 1.5 20 2.5 21 3.5 22 3.0 23 4.0 24 7.5 25 9.0 26 10.0 27 10.0 28 13.0 29 21.0 30 31.0 31 44.5 32 52.0 33 61.0 34 85.5 35 106.0 36 112.0 37 126.5 38 149.5 39 182.5 40 213.5 41 245.5 42 248.5 43 242.5 44 253.5 45 239.5 46 232.0 47 208.5 48 177.0 49 163.5 50 145.5 51 121.0 52 106.5 53 92.0 54 65.0 55 43.5 56 35.0 57 30.5 58 21.5 59 17.5 60 13.0 61 11.0 62 13.0 63 9.0 64 3.5 65 2.0 66 1.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.28500000000000003 40-44 0.77 45-49 0.01 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.98 85-89 2.275 90-94 2.29 95-99 2.2800000000000002 100-104 0.485 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.895 130-134 2.8850000000000002 135-139 4.245 140-144 3.665 145-149 0.91 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.55 #Duplication Level Percentage of deduplicated Percentage of total 1 98.47229414810978 95.075 2 0.9580528223718281 1.8499999999999999 3 0.20714655618850336 0.6 4 0.12946659761781462 0.5 5 0.07767995857068877 0.375 6 0.07767995857068877 0.44999999999999996 7 0.0 0.0 8 0.0 0.0 9 0.05178663904712584 0.44999999999999996 >10 0.02589331952356292 0.7000000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 28 0.7000000000000001 Illumina Single End PCR Primer 1 (100% over 50bp) GCCACTCCCTCTTTCGCAGATTACTACAAACCGCCTAAGTATGAGCCTAA 9 0.22499999999999998 No Hit GTTGTTTTAGCCACTCCCTCTTTCGCAGATTACTACAAACCGCCTAAGTA 9 0.22499999999999998 No Hit CTACAAACCGCCTAAGTATGAGCCTAAGCCACCTTATTTCAAGCCTCCTA 6 0.15 No Hit CTACAAGCCACCAATTGAGAAGCCACCAGTCTACAAGCCACCAATTGAGA 6 0.15 No Hit GCCTAAGCCACCTTATTTCAAGCCTCCTAAGGTAGAGAAGCCATTCCCAG 6 0.15 No Hit TGAGAAGCCACCAGTCTACAAGCCACCAATTGAGAAGCCACCAGTCTACA 5 0.125 No Hit GCAAATCACATCCTTGTTAGTGTTGTTCGTGGGAGTAGTTGTTTTAGCCA 5 0.125 No Hit GGTAGAGAAGCCATTCCCAGAACACAAGCCTCCAGTCTACAAGCCACCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3125 0.0 0.0 0.0 0.0 80-81 0.3625 0.0 0.0 0.0 0.0 82-83 0.42500000000000004 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 0.9375 0.0 0.0 0.0 0.0 94-95 1.15 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.525 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 1.9874999999999998 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.425 0.0 0.0 0.0 0.0 108-109 2.65 0.0 0.0 0.0 0.0 110-111 2.8499999999999996 0.0 0.0 0.0 0.0 112-113 3.1125 0.0 0.0 0.0 0.0 114-115 3.375 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 4.025 0.0 0.0 0.0 0.0 120-121 4.5375 0.0 0.0 0.0 0.0 122-123 4.9375 0.0 0.0 0.0 0.0 124-125 5.5375 0.0 0.0 0.0 0.0 126-127 6.15 0.0 0.0 0.0 0.0 128-129 6.7 0.0 0.0 0.0 0.0 130-131 7.050000000000001 0.0 0.0 0.0 0.0 132-133 7.6 0.0 0.0 0.0 0.0 134-135 8.325 0.0 0.0 0.0 0.0 136-137 9.0125 0.0 0.0 0.0 0.0 138 9.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741380 spots for SRR6031383.sra Written 741380 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra Read 741366 spots for SRR6031383.sra Written 741366 spots for SRR6031383.sra SRR ids: ['SRR6031383.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1n2mzb_m SRR6031383.sra spots: 14827334 blocks: [[1, 741366], [741367, 1482732], [1482733, 2224098], [2224099, 2965464], [2965465, 3706830], [3706831, 4448196], [4448197, 5189562], [5189563, 5930928], [5930929, 6672294], [6672295, 7413660], [7413661, 8155026], [8155027, 8896392], [8896393, 9637758], [9637759, 10379124], [10379125, 11120490], [11120491, 11861856], [11861857, 12603222], [12603223, 13344588], [13344589, 14085954], [14085955, 14827334]] SRR6031383 file size 4973836 SRR6031383 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031383 SRR6031383_1.fastq SRR6031383_2.fastq Input file: SRR6031383_1.fastq Paired file: SRR6031383_2.fastq trimmed: SRR6031383-trimmed-pair1.fastq, SRR6031383-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 05:55:57 2025 >> started Fri Feb 14 05:56:15 2025 >> done (17.678s) 14827334 read pairs processed; of these: 44636 ( 0.30%) short read pairs filtered out after trimming by size control 236958 ( 1.60%) empty read pairs filtered out after trimming by size control 14545740 (98.10%) read pairs available; of these: 7112268 (48.90%) trimmed read pairs available after processing 7433472 (51.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 35 0.00% 20 40 0.00% 21 59 0.00% 22 104 0.00% 23 89 0.00% 24 141 0.00% 25 138 0.00% 26 117 0.00% 27 113 0.00% 28 111 0.00% 29 103 0.00% 30 94 0.00% 31 174 0.00% 32 123 0.00% 33 148 0.00% 34 160 0.00% 35 217 0.00% 36 217 0.00% 37 214 0.00% 38 282 0.00% 39 330 0.00% 40 379 0.00% 41 463 0.00% 42 499 0.00% 43 499 0.00% 44 501 0.00% 45 580 0.00% 46 657 0.00% 47 701 0.00% 48 772 0.01% 49 817 0.01% 50 933 0.01% 51 991 0.01% 52 941 0.01% 53 888 0.01% 54 885 0.01% 55 864 0.01% 56 862 0.01% 57 1058 0.01% 58 1105 0.01% 59 1156 0.01% 60 1266 0.01% 61 1438 0.01% 62 1658 0.01% 63 1983 0.01% 64 2035 0.01% 65 2421 0.02% 66 4307 0.03% 67 7525 0.05% 68 8340 0.06% 69 13139 0.09% 70 12614 0.09% 71 5918 0.04% 72 4676 0.03% 73 4403 0.03% 74 4607 0.03% 75 4451 0.03% 76 4581 0.03% 77 4893 0.03% 78 5413 0.04% 79 6001 0.04% 80 6913 0.05% 81 7925 0.05% 82 8898 0.06% 83 9765 0.07% 84 12905 0.09% 85 13673 0.09% 86 15317 0.11% 87 16910 0.12% 88 17254 0.12% 89 17637 0.12% 90 17285 0.12% 91 18037 0.12% 92 19565 0.13% 93 19669 0.14% 94 20553 0.14% 95 20617 0.14% 96 21228 0.15% 97 22475 0.15% 98 23662 0.16% 99 25966 0.18% 100 28673 0.20% 101 31835 0.22% 102 35183 0.24% 103 37725 0.26% 104 40431 0.28% 105 42544 0.29% 106 43861 0.30% 107 43100 0.30% 108 42323 0.29% 109 40472 0.28% 110 40822 0.28% 111 42021 0.29% 112 43226 0.30% 113 45325 0.31% 114 46167 0.32% 115 45095 0.31% 116 43967 0.30% 117 42773 0.29% 118 42471 0.29% 119 42878 0.29% 120 44925 0.31% 121 48167 0.33% 122 51835 0.36% 123 55325 0.38% 124 58149 0.40% 125 59656 0.41% 126 59838 0.41% 127 59232 0.41% 128 59664 0.41% 129 61274 0.42% 130 63390 0.44% 131 70258 0.48% 132 74922 0.52% 133 79992 0.55% 134 84392 0.58% 135 88180 0.61% 136 91310 0.63% 137 95182 0.65% 138 97709 0.67% 139 100632 0.69% 140 106331 0.73% 141 110236 0.76% 142 115701 0.80% 143 126165 0.87% 144 141194 0.97% 145 163781 1.13% 146 195895 1.35% 147 263254 1.81% 148 451460 3.10% 149 2756832 18.95% 150 7433472 51.10% 14545740 reads passed initial QC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=8.47 fanout-score-rank=9 prefix-density=0.03 prefix-fanout=8.5 sequence=TTTTTTTTTAAA criterion=fanout-score sequence-density=0.08 sequence-density-rank=26 fanout-score=225.67 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=22.7 sequence=TCTTCTTCTTCTC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=236.26 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=28.4 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.13 sequence-density-rank=1 fanout-score=236.26 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=28.4 sequence=AAGAAGAAGAAA SRR6031383 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 05:57:14 Started mapping on | Feb 14 05:57:14 Finished on | Feb 14 05:58:35 Mapping speed, Million of reads per hour | 646.48 Number of input reads | 14545721 Average input read length | 271 UNIQUE READS: Uniquely mapped reads number | 11274806 Uniquely mapped reads % | 77.51% Average mapped length | 277.98 Number of splices: Total | 6976779 Number of splices: Annotated (sjdb) | 6788489 Number of splices: GT/AG | 6833211 Number of splices: GC/AG | 106042 Number of splices: AT/AC | 6433 Number of splices: Non-canonical | 31093 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.02% Deletion average length | 2.79 Insertion rate per base | 0.02% Insertion average length | 2.94 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 445647 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 8442 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 19.30% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2847209 2847209 2847209 N_multimapping 445647 445647 445647 N_noFeature 532208 11124708 604124 N_ambiguous 217739 8877 131272 UnstrandedReadsAssigned:10524859 PositiveStrandReadsAssigned:141221 NegativeStrandReadsAssigned:10539410 Dataset is classified negative stranded MeadianReadLen=138 20thPercentileLength=130 echo kmer=125 SRR6031383 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031383-trimmed-pair1.fastq SRR6031383-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,545,721 reads, 13,052,054 reads pseudoaligned [quant] estimated average fragment length: 182.896 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR6031383.ke.tsv 34699 SRR6031383.se.tsv 87100 total ==> SRR6031383.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1836.1 238 12.2465 Potri.005G024800.1.v4.1 1035 853.104 28 3.1009 Potri.004G059700.1.v4.1 961 779.104 27 3.27416 Potri.007G009000.2.v4.1 1416 1234.1 0 0 Potri.003G141000.2.v4.1 2943 2761.1 680.31 23.2785 Potri.016G087400.1.v4.1 270 99.6915 87 82.4503 Potri.015G069301.1.v4.1 564 382.199 0 0 Potri.010G195200.1.v4.1 1773 1591.1 22 1.30634 Potri.012G127500.1.v4.1 977 795.104 7118 845.795 ==> SRR6031383.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 107 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 108 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR6031383 completed mapping pipeline successfully