Starting /dee2/code/volunteer_pipeline.sh SRR6031384 current disk space = 3085500313600 free memory = 1017247880 SRR6031384 SRAfilesize 5f62bd0c747bb894a2ce4d66f5107132 SRR6031384.sra SRR6031384.sra file validated SRR6031384 is paired end SRR6031384 is conventional basespace SRR6031384 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031384_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8445 34.0 33.0 34.0 33.0 34.0 2 33.32625 34.0 33.0 34.0 33.0 34.0 3 33.3165 34.0 33.0 34.0 33.0 34.0 4 33.44325 34.0 33.0 34.0 33.0 34.0 5 33.42675 34.0 34.0 34.0 33.0 34.0 6 37.1955 38.0 38.0 38.0 36.0 38.0 7 37.46825 38.0 38.0 38.0 37.0 38.0 8 37.5105 38.0 38.0 38.0 37.0 38.0 9 37.4855 38.0 38.0 38.0 38.0 38.0 10-14 37.530649999999994 38.0 38.0 38.0 37.6 38.0 15-19 37.538650000000004 38.0 38.0 38.0 38.0 38.0 20-24 37.5334 38.0 38.0 38.0 38.0 38.0 25-29 37.51375 38.0 38.0 38.0 37.8 38.0 30-34 37.4711 38.0 38.0 38.0 37.4 38.0 35-39 37.4422 38.0 38.0 38.0 37.2 38.0 40-44 37.333800000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2442 38.0 38.0 38.0 36.4 38.0 50-54 37.13265 38.0 38.0 38.0 36.0 38.0 55-59 37.15595 38.0 38.0 38.0 36.2 38.0 60-64 37.1511 38.0 38.0 38.0 36.2 38.0 65-69 37.1594 38.0 38.0 38.0 36.0 38.0 70-74 37.07665 38.0 38.0 38.0 36.0 38.0 75-79 36.946600000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.91575 38.0 38.0 38.0 36.0 38.0 85-89 36.83 38.0 38.0 38.0 35.2 38.0 90-94 36.860699999999994 38.0 38.0 38.0 35.4 38.0 95-99 36.7635 38.0 38.0 38.0 35.0 38.0 100-104 36.706100000000006 38.0 38.0 38.0 34.8 38.0 105-109 36.567899999999995 38.0 38.0 38.0 34.2 38.0 110-114 36.424850000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.23555 38.0 37.8 38.0 33.6 38.0 120-124 36.115199999999994 38.0 37.4 38.0 33.4 38.0 125-129 35.83815 38.0 37.0 38.0 31.6 38.0 130-134 35.7743 38.0 37.0 38.0 31.4 38.0 135-139 35.519549999999995 38.0 36.0 38.0 31.0 38.0 140-144 35.0141 38.0 35.8 38.0 30.6 38.0 145-149 34.391999999999996 38.0 36.0 38.0 28.0 38.0 150 26.35575 33.0 20.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 1.0 17 1.0 18 5.0 19 2.0 20 3.0 21 4.0 22 1.0 23 2.0 24 15.0 25 10.0 26 6.0 27 17.0 28 16.0 29 35.0 30 40.0 31 50.0 32 60.0 33 101.0 34 124.0 35 207.0 36 538.0 37 2757.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.043721403152006 11.921708185053381 8.998474834773768 37.036095577020845 2 22.650000000000002 15.225 35.9 26.224999999999998 3 19.900000000000002 20.5 26.900000000000002 32.7 4 23.375 29.375 23.275000000000002 23.974999999999998 5 23.575 33.175 24.05 19.2 6 19.025 34.599999999999994 24.55 21.825 7 13.725000000000001 24.375 42.975 18.925 8 17.299999999999997 25.05 31.6 26.05 9 18.075 23.150000000000002 35.8 22.975 10-14 19.38 30.245 27.32 23.055 15-19 20.200000000000003 28.71 28.134999999999998 22.955000000000002 20-24 20.03 29.060000000000002 27.925 22.985 25-29 19.777966695004253 28.8593288993349 28.074211131669752 23.288493273991097 30-34 19.705000000000002 28.875 28.42 23.0 35-39 20.125 28.78 28.005000000000003 23.09 40-44 19.675 28.785 27.98 23.56 45-49 20.025000000000002 29.270000000000003 27.715 22.99 50-54 20.18 28.975 27.584999999999997 23.26 55-59 20.495 28.975 27.29 23.24 60-64 19.72 29.465000000000003 27.375 23.44 65-69 20.0 28.599999999999998 28.345 23.055 70-74 19.994999999999997 29.12 27.74 23.145 75-79 19.735 28.849999999999998 28.17 23.244999999999997 80-84 20.349999999999998 28.49 28.18 22.98 85-89 20.19 29.18 27.334999999999997 23.294999999999998 90-94 19.88 28.555000000000003 28.134999999999998 23.43 95-99 20.26 28.599999999999998 27.525 23.615 100-104 20.155 28.915000000000003 27.694999999999997 23.235 105-109 20.695 28.565 27.250000000000004 23.49 110-114 20.405 27.944999999999997 28.294999999999998 23.355 115-119 20.055 28.599999999999998 27.950000000000003 23.395 120-124 19.625 28.560000000000002 27.61 24.205 125-129 19.975 28.725 27.63 23.669999999999998 130-134 20.455000000000002 28.720000000000002 27.85 22.975 135-139 20.62 28.125 27.700000000000003 23.555 140-144 20.68 28.23 27.435 23.655 145-149 20.419999999999998 28.59 27.565 23.425 150 20.424999999999997 27.85 28.575 23.150000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 2.0 17 2.0 18 1.5 19 2.0 20 2.0 21 2.0 22 2.0 23 5.5 24 6.0 25 6.0 26 7.5 27 8.5 28 14.0 29 19.5 30 24.5 31 29.5 32 38.0 33 47.0 34 60.5 35 81.5 36 99.5 37 119.0 38 134.0 39 157.0 40 189.5 41 213.0 42 234.5 43 259.5 44 258.5 45 259.5 46 264.0 47 249.5 48 234.0 49 203.5 50 167.5 51 136.0 52 120.0 53 101.5 54 65.5 55 42.5 56 35.0 57 25.0 58 20.5 59 15.0 60 8.5 61 7.0 62 3.5 63 3.0 64 5.5 65 3.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.015 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5475113122172 99.0 2 0.3770739064856712 0.75 3 0.050276520864756154 0.15 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.825 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.2374999999999998 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.3625 0.0 0.0 0.0 0.0 132-133 1.4875 0.0 0.0 0.0 0.0 134-135 1.725 0.0 0.0 0.0 0.0 136-137 1.8875 0.0 0.0 0.0 0.0 138 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031384 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031384_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.638 33.0 33.0 34.0 32.0 34.0 2 32.8285 34.0 33.0 34.0 32.0 34.0 3 32.83925 34.0 33.0 34.0 32.0 34.0 4 32.80675 34.0 33.0 34.0 32.0 34.0 5 32.854 34.0 33.0 34.0 32.0 34.0 6 37.06375 38.0 38.0 38.0 37.0 38.0 7 37.019 38.0 38.0 38.0 37.0 38.0 8 37.02325 38.0 38.0 38.0 37.0 38.0 9 37.044 38.0 38.0 38.0 37.0 38.0 10-14 36.9319 38.0 38.0 38.0 36.4 38.0 15-19 36.84675 38.0 38.0 38.0 36.0 38.0 20-24 36.91785 38.0 38.0 38.0 36.2 38.0 25-29 36.88805000000001 38.0 38.0 38.0 36.2 38.0 30-34 36.87175 38.0 38.0 38.0 36.2 38.0 35-39 36.7226 38.0 38.0 38.0 36.2 38.0 40-44 36.40265000000001 38.0 38.0 38.0 35.4 38.0 45-49 36.7265 38.0 38.0 38.0 36.0 38.0 50-54 36.75145 38.0 38.0 38.0 36.0 38.0 55-59 36.711299999999994 38.0 38.0 38.0 36.0 38.0 60-64 36.72165 38.0 38.0 38.0 35.8 38.0 65-69 36.65925 38.0 38.0 38.0 35.6 38.0 70-74 36.65715 38.0 38.0 38.0 36.0 38.0 75-79 36.62225 38.0 38.0 38.0 35.4 38.0 80-84 35.83545 38.0 38.0 38.0 33.8 38.0 85-89 35.027049999999996 38.0 38.0 38.0 30.6 38.0 90-94 34.9781 38.0 38.0 38.0 29.8 38.0 95-99 34.8682 38.0 38.0 38.0 29.0 38.0 100-104 35.66555 38.0 38.0 38.0 30.4 38.0 105-109 36.11065000000001 38.0 38.0 38.0 33.8 38.0 110-114 36.0933 38.0 38.0 38.0 34.0 38.0 115-119 35.97905 38.0 38.0 38.0 34.0 38.0 120-124 35.75545 38.0 38.0 38.0 32.6 38.0 125-129 34.9987 38.0 37.4 38.0 29.0 38.0 130-134 33.4203 38.0 36.0 38.0 15.4 38.0 135-139 32.716750000000005 38.0 35.6 38.0 4.2 38.0 140-144 32.31335 38.0 34.0 38.0 2.0 38.0 145-149 31.911749999999994 38.0 33.6 38.0 2.0 38.0 150 24.209 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 2.0 4 1.0 5 5.0 6 0.0 7 2.0 8 0.0 9 3.0 10 2.0 11 3.0 12 3.0 13 3.0 14 4.0 15 4.0 16 6.0 17 7.0 18 10.0 19 6.0 20 9.0 21 5.0 22 9.0 23 22.0 24 35.0 25 27.0 26 41.0 27 77.0 28 51.0 29 38.0 30 42.0 31 62.0 32 74.0 33 119.0 34 124.0 35 193.0 36 351.0 37 2645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.884221055263815 21.255313828457115 13.50337584396099 28.35708927231808 2 25.35 26.75 32.35 15.55 3 20.4 28.4 32.4 18.8 4 23.549999999999997 34.449999999999996 23.325000000000003 18.675 5 23.200000000000003 37.35 22.575 16.875 6 18.75 39.775 23.150000000000002 18.325 7 19.775000000000002 18.725 40.875 20.625 8 21.7 24.625 28.4 25.275 9 21.975 24.95 30.25 22.825 10-14 24.175 29.015 26.215 20.595 15-19 22.845 28.305000000000003 28.535 20.315 20-24 23.169999999999998 28.804999999999996 27.839999999999996 20.185 25-29 22.985 28.325 28.185 20.505000000000003 30-34 22.915 28.494999999999997 28.310000000000002 20.28 35-39 22.585341365461847 28.403614457831328 28.072289156626507 20.938755020080322 40-44 22.5042985738849 28.33518762010721 28.05198745827855 21.10852634772934 45-49 22.4801160522235 27.51238057125707 29.358211195037764 20.649292181481666 50-54 22.884999999999998 28.475 27.915 20.724999999999998 55-59 23.294999999999998 27.29 28.79 20.625 60-64 23.18 27.96 28.83 20.03 65-69 22.905 28.515 28.04 20.54 70-74 23.265 28.050000000000004 27.96 20.724999999999998 75-79 23.03 28.62 27.595 20.755000000000003 80-84 23.482876537538917 28.596947889552393 27.269943347113767 20.650232225794927 85-89 23.675686971058404 28.622923414481242 27.416152962072925 20.28523665238742 90-94 23.325840347116944 28.16143028908986 27.77981075853416 20.73291860525903 95-99 23.61961584759512 28.455539854503588 27.471607264353377 20.453237033547914 100-104 23.12547336531179 27.891946478162083 28.40696793738955 20.575612219136584 105-109 23.285 27.689999999999998 28.525 20.5 110-114 23.175 28.205000000000002 28.050000000000004 20.57 115-119 23.785 28.294999999999998 27.51 20.41 120-124 23.375 28.194999999999997 28.055000000000003 20.375 125-129 23.829117139083614 27.826882048156047 28.517728334857257 19.82627247790308 130-134 23.728545022445207 27.800369685767095 28.259836282017424 20.211249009770267 135-139 23.873338376742677 28.369177564033286 27.872041500054035 19.88544255917 140-144 23.31759149940968 28.421165611248256 27.932810990662233 20.32843189867983 145-149 23.955573670266965 27.369064601589564 28.917872427144896 19.757489300998575 150 23.974999999999998 27.650000000000002 27.625 20.75 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 0.5 17 1.5 18 2.5 19 1.5 20 1.0 21 3.0 22 3.0 23 2.5 24 5.5 25 7.5 26 8.0 27 11.5 28 14.0 29 21.5 30 28.5 31 28.5 32 34.5 33 47.5 34 57.0 35 78.5 36 97.5 37 119.5 38 141.5 39 163.5 40 204.5 41 227.0 42 258.0 43 260.0 44 255.0 45 286.0 46 263.5 47 243.0 48 229.5 49 188.0 50 161.0 51 129.5 52 102.0 53 80.5 54 62.5 55 47.5 56 35.0 57 26.0 58 18.0 59 11.0 60 7.0 61 6.0 62 3.0 63 3.0 64 2.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.4 40-44 1.13 45-49 0.045 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 2.035 85-89 4.29 90-94 4.3549999999999995 95-99 4.465 100-104 0.975 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.5699999999999998 130-134 5.325 135-139 7.470000000000001 140-144 6.83 145-149 1.8599999999999999 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.175 #Duplication Level Percentage of deduplicated Percentage of total 1 99.395008822788 98.575 2 0.4285354171918326 0.8500000000000001 3 0.12603982858583312 0.375 4 0.050415931434333254 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.16249999999999998 0.0 0.0 0.0 0.0 100-101 0.23750000000000002 0.0 0.0 0.0 0.0 102-103 0.30000000000000004 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.4875 0.0 0.0 0.0 0.0 110-111 0.5125 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.7375 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.975 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.2374999999999998 0.0 0.0 0.0 0.0 128-129 1.2875 0.0 0.0 0.0 0.0 130-131 1.3625 0.0 0.0 0.0 0.0 132-133 1.475 0.0 0.0 0.0 0.0 134-135 1.7 0.0 0.0 0.0 0.0 136-137 1.8625 0.0 0.0 0.0 0.0 138 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTCCAC 10 0.007596589 139.9375 7 TTCCACT 10 0.007596589 139.9375 8 >>END_MODULE Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150202 spots for SRR6031384.sra Written 1150202 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra Read 1150193 spots for SRR6031384.sra Written 1150193 spots for SRR6031384.sra SRR ids: ['SRR6031384.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_wijnf09p SRR6031384.sra spots: 23003869 blocks: [[1, 1150193], [1150194, 2300386], [2300387, 3450579], [3450580, 4600772], [4600773, 5750965], [5750966, 6901158], [6901159, 8051351], [8051352, 9201544], [9201545, 10351737], [10351738, 11501930], [11501931, 12652123], [12652124, 13802316], [13802317, 14952509], [14952510, 16102702], [16102703, 17252895], [17252896, 18403088], [18403089, 19553281], [19553282, 20703474], [20703475, 21853667], [21853668, 23003869]] SRR6031384 file size 7728626 SRR6031384 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031384 SRR6031384_1.fastq SRR6031384_2.fastq Input file: SRR6031384_1.fastq Paired file: SRR6031384_2.fastq trimmed: SRR6031384-trimmed-pair1.fastq, SRR6031384-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:04:24 2025 >> started Fri Feb 14 06:05:03 2025 >> done (38.930s) 23003869 read pairs processed; of these: 28079 ( 0.12%) short read pairs filtered out after trimming by size control 50923 ( 0.22%) empty read pairs filtered out after trimming by size control 22924867 (99.66%) read pairs available; of these: 8391678 (36.61%) trimmed read pairs available after processing 14533189 (63.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 6 0.00% 20 6 0.00% 21 5 0.00% 22 4 0.00% 23 9 0.00% 24 4 0.00% 25 9 0.00% 26 8 0.00% 27 12 0.00% 28 10 0.00% 29 12 0.00% 30 18 0.00% 31 9 0.00% 32 12 0.00% 33 17 0.00% 34 17 0.00% 35 11 0.00% 36 19 0.00% 37 24 0.00% 38 16 0.00% 39 32 0.00% 40 22 0.00% 41 23 0.00% 42 33 0.00% 43 29 0.00% 44 34 0.00% 45 36 0.00% 46 40 0.00% 47 41 0.00% 48 50 0.00% 49 57 0.00% 50 69 0.00% 51 75 0.00% 52 71 0.00% 53 90 0.00% 54 68 0.00% 55 98 0.00% 56 103 0.00% 57 122 0.00% 58 103 0.00% 59 123 0.00% 60 160 0.00% 61 170 0.00% 62 168 0.00% 63 198 0.00% 64 200 0.00% 65 233 0.00% 66 273 0.00% 67 344 0.00% 68 401 0.00% 69 655 0.00% 70 687 0.00% 71 417 0.00% 72 488 0.00% 73 527 0.00% 74 579 0.00% 75 645 0.00% 76 655 0.00% 77 748 0.00% 78 855 0.00% 79 965 0.00% 80 1036 0.00% 81 1217 0.01% 82 1498 0.01% 83 1934 0.01% 84 3796 0.02% 85 3777 0.02% 86 4044 0.02% 87 4248 0.02% 88 4360 0.02% 89 4336 0.02% 90 4607 0.02% 91 4860 0.02% 92 5208 0.02% 93 5422 0.02% 94 5729 0.02% 95 6210 0.03% 96 6618 0.03% 97 6888 0.03% 98 7352 0.03% 99 7662 0.03% 100 8125 0.04% 101 8429 0.04% 102 8904 0.04% 103 9530 0.04% 104 10071 0.04% 105 10963 0.05% 106 11348 0.05% 107 11962 0.05% 108 12646 0.06% 109 12917 0.06% 110 13573 0.06% 111 14416 0.06% 112 14899 0.06% 113 15789 0.07% 114 16772 0.07% 115 17202 0.08% 116 18201 0.08% 117 18906 0.08% 118 19644 0.09% 119 20355 0.09% 120 21099 0.09% 121 21828 0.10% 122 22847 0.10% 123 24183 0.11% 124 25566 0.11% 125 27142 0.12% 126 28727 0.13% 127 30202 0.13% 128 31918 0.14% 129 33641 0.15% 130 35740 0.16% 131 37748 0.16% 132 40243 0.18% 133 42914 0.19% 134 45796 0.20% 135 50166 0.22% 136 55352 0.24% 137 62634 0.27% 138 69653 0.30% 139 75884 0.33% 140 82092 0.36% 141 89235 0.39% 142 98344 0.43% 143 112701 0.49% 144 135858 0.59% 145 171075 0.75% 146 231960 1.01% 147 356697 1.56% 148 735023 3.21% 149 5219039 22.77% 150 14533189 63.39% 22924867 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.88 fanout-score-rank=29 prefix-density=0.27 prefix-fanout=2.6 sequence=TGCAACAGTCGGGAGATGGGTCTGTTTGTGGCCCTTGTATCTGAACATACTTGGAACATTGTGTAATTAAACCTTGGAAGTCACCATGGCATTCTTGGCCAAGGGCTACATTGTTGCTCGGAATCAGAATTCCGATCACTGCAAGAATGGCTAGGATCATAAAGTAGTGGACATTCGAGATAGCCATAATTCTCTTCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=105.27 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=12.2 sequence=ATCCTTGAATGAAATTTGAGATGGAATTATTCGAAACATTCAGCTACTTATTCGGGGGAAAGCACAAACTGTTTTCCTCACTTAATGGTTCTGCGCTGTGGTTGATCATATTTTTAGTAGCGCCTTGCTCATGGACTGTATGGCTCCGTGGTTGCAACGTTGGATTCAAGAGTCTCATGTGGACTCCACGGCTCCATGGCCACATCGATGGACTCATGAGCCTCGTCTCTAGAAACCTCATTCTGAGCTCCACTGTTGTGCTCATCATTTGCCTTTGATGCTGATCCTCCCTTCATCGTCGAAACTTGATTATAACATTCTGGGCTGCAGGTACATCCATTGCCTATTTGACCATACCCCGGAATGAAATGCGGTGGAGGGATACCAATTCCTGCTATCGTGCCACCACTGCTGCCACCTTGCCCTATTCCAATCCCATAACTAGGAGATCGATTACCCGCAGCTCCACCG criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=27 prefix-density=0.19 prefix-fanout=3.0 sequence=ACCCAGAAGATGAGCT criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=730.84 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=20.9 sequence=AAAGAAAATTCACAGAGATGGAGTTAATTACAGGGTTCAACAAGGTGATCGTTCTGATGTTGATGCTGATGCTCTTGAGGAAAACAACAGCATACTCGGAAGAGTACGATAAGAAGTGCTATGATAAATGTTTTAGAAGCTGTGTTGATCAAGGTAATATACCGTGGCAGTGTTCGTCTCACTGCATGGACGCGTGCAGCAACAATTTAGATGTAATTCGCTACTGCAATGTTGGTTGTTCGCTTCAAAATTGCAACAAAATCATGGACGATGAGGTGAAAAGGCATATTTGCTTGAAGGAGTGCTCGAACACTCACTGCAACCCCAAACACTTCAAGAAGTCTCCGTAGCATCTGCTCTTTCATATTTGGAGCAATATATCTACAAGTAATGTCATGATAAATAATCAAATGATTAAGGGATGAATCATCCTTAATTATCGAGTAATTAAACC SRR6031384 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:06:34 Started mapping on | Feb 14 06:06:35 Finished on | Feb 14 06:11:04 Mapping speed, Million of reads per hour | 306.80 Number of input reads | 22924867 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 20458620 Uniquely mapped reads % | 89.24% Average mapped length | 291.59 Number of splices: Total | 19629057 Number of splices: Annotated (sjdb) | 19230491 Number of splices: GT/AG | 19305612 Number of splices: GC/AG | 256484 Number of splices: AT/AC | 13354 Number of splices: Non-canonical | 53607 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.95 Insertion rate per base | 0.03% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 521179 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 31912 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.31% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1971189 1971189 1971189 N_multimapping 521179 521179 521179 N_noFeature 580136 20199567 710282 N_ambiguous 312908 1796 182698 UnstrandedReadsAssigned:19565576 PositiveStrandReadsAssigned:257257 NegativeStrandReadsAssigned:19565640 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031384 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031384-trimmed-pair1.fastq SRR6031384-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,924,867 reads, 20,060,890 reads pseudoaligned [quant] estimated average fragment length: 271.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,064 rounds 52401 SRR6031384.ke.tsv 34699 SRR6031384.se.tsv 87100 total ==> SRR6031384.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.26 602 14.7321 Potri.005G024800.1.v4.1 1035 764.26 141 7.88867 Potri.004G059700.1.v4.1 961 690.306 30 1.85826 Potri.007G009000.2.v4.1 1416 1145.26 0 0 Potri.003G141000.2.v4.1 2943 2672.26 372 5.95237 Potri.016G087400.1.v4.1 270 65.8007 1800 1169.68 Potri.015G069301.1.v4.1 564 300.447 0 0 Potri.010G195200.1.v4.1 1773 1502.26 9 0.256167 Potri.012G127500.1.v4.1 977 706.288 2683 162.429 ==> SRR6031384.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 2800 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 475 Potri.001G212900.v4.1 348 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 5 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR6031384 completed mapping pipeline successfully