Starting /dee2/code/volunteer_pipeline.sh SRR6031385 current disk space = 3085473603584 free memory = 1016949436 SRR6031385 SRAfilesize d23d5d5882784012d50f981ec0d8d74e SRR6031385.sra SRR6031385.sra file validated SRR6031385 is paired end SRR6031385 is conventional basespace SRR6031385 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031385_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.148 34.0 33.0 34.0 33.0 34.0 2 33.36625 34.0 33.0 34.0 33.0 34.0 3 33.45675 34.0 33.0 34.0 33.0 34.0 4 33.4315 34.0 34.0 34.0 33.0 34.0 5 33.3675 34.0 33.0 34.0 33.0 34.0 6 37.08325 38.0 38.0 38.0 36.0 38.0 7 37.33775 38.0 38.0 38.0 37.0 38.0 8 37.43025 38.0 38.0 38.0 37.0 38.0 9 37.5395 38.0 38.0 38.0 37.0 38.0 10-14 37.4825 38.0 38.0 38.0 37.0 38.0 15-19 37.459999999999994 38.0 38.0 38.0 37.2 38.0 20-24 37.48295 38.0 38.0 38.0 37.4 38.0 25-29 37.45399999999999 38.0 38.0 38.0 37.2 38.0 30-34 37.43945 38.0 38.0 38.0 37.0 38.0 35-39 37.364799999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.32195 38.0 38.0 38.0 37.0 38.0 45-49 37.28425 38.0 38.0 38.0 37.0 38.0 50-54 37.24575 38.0 38.0 38.0 36.8 38.0 55-59 37.1808 38.0 38.0 38.0 36.4 38.0 60-64 37.1485 38.0 38.0 38.0 36.2 38.0 65-69 37.129149999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.09230000000001 38.0 38.0 38.0 36.0 38.0 75-79 36.9825 38.0 38.0 38.0 36.0 38.0 80-84 36.9912 38.0 38.0 38.0 36.0 38.0 85-89 36.898999999999994 38.0 38.0 38.0 35.6 38.0 90-94 36.8517 38.0 38.0 38.0 35.4 38.0 95-99 36.80029999999999 38.0 38.0 38.0 35.0 38.0 100-104 36.7012 38.0 38.0 38.0 34.8 38.0 105-109 36.602149999999995 38.0 38.0 38.0 34.4 38.0 110-114 36.579449999999994 38.0 38.0 38.0 34.4 38.0 115-119 36.36794999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.2167 38.0 38.0 38.0 34.0 38.0 125-129 36.092200000000005 38.0 37.6 38.0 33.4 38.0 130-134 35.90435 38.0 37.2 38.0 33.0 38.0 135-139 35.595600000000005 38.0 36.6 38.0 31.4 38.0 140-144 35.13289999999999 38.0 36.0 38.0 31.0 38.0 145-149 34.7115 38.0 36.0 38.0 30.6 38.0 150 27.6685 33.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 0.0 12 0.0 13 3.0 14 0.0 15 1.0 16 1.0 17 2.0 18 1.0 19 2.0 20 4.0 21 2.0 22 6.0 23 7.0 24 9.0 25 13.0 26 9.0 27 14.0 28 25.0 29 24.0 30 40.0 31 37.0 32 49.0 33 98.0 34 132.0 35 201.0 36 461.0 37 2857.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.81067472306143 13.947633434038268 9.84390735146022 35.397784491440085 2 22.875 17.549999999999997 35.4 24.175 3 18.975 24.625 27.075 29.325000000000003 4 23.925 31.95 21.325 22.8 5 21.407110665999 37.0555833750626 23.73560340510766 17.801702553830744 6 16.725 36.5 25.8 20.974999999999998 7 14.575 24.9 42.15 18.375 8 16.5 24.9 30.875000000000004 27.725 9 18.975 22.650000000000002 32.550000000000004 25.825 10-14 19.81 30.395 26.43 23.365 15-19 19.98 29.345 26.87 23.805 20-24 19.545 29.365000000000002 27.525 23.565 25-29 19.88 28.815 27.48 23.825 30-34 19.64 29.565 27.41 23.385 35-39 19.965 28.82 27.615000000000002 23.599999999999998 40-44 20.195 28.835 27.474999999999998 23.494999999999997 45-49 19.7 28.555000000000003 28.189999999999998 23.555 50-54 19.634999999999998 28.365000000000002 28.23 23.77 55-59 19.905 28.810000000000002 27.955000000000002 23.330000000000002 60-64 19.97 29.085 27.1 23.845 65-69 19.99 28.965000000000003 27.735 23.31 70-74 20.625 28.79 27.334999999999997 23.25 75-79 20.605 29.455 26.900000000000002 23.04 80-84 20.04 29.15 26.985 23.825 85-89 20.26 28.945 27.325 23.47 90-94 20.02 28.79 27.465 23.724999999999998 95-99 20.27 28.32 27.744999999999997 23.665 100-104 20.53 28.63 26.985 23.855 105-109 20.415 28.449999999999996 27.67 23.465 110-114 20.445 28.7 27.275 23.580000000000002 115-119 20.265 28.83 27.415 23.49 120-124 20.46 28.515 27.435 23.59 125-129 20.68 28.050000000000004 27.415 23.855 130-134 20.575 28.544999999999998 27.49 23.39 135-139 20.46 28.77 27.605 23.165 140-144 20.72 28.455000000000002 26.865 23.96 145-149 20.150000000000002 28.68 27.529999999999998 23.64 150 21.871871871871875 27.57757757757758 27.077077077077078 23.473473473473476 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 2.0 23 2.5 24 4.0 25 7.5 26 7.0 27 5.5 28 10.5 29 17.5 30 20.5 31 29.5 32 39.0 33 43.5 34 54.5 35 59.0 36 69.0 37 100.5 38 149.0 39 179.5 40 195.0 41 227.0 42 256.5 43 280.5 44 271.0 45 260.0 46 274.0 47 252.5 48 208.5 49 190.0 50 170.0 51 139.0 52 124.5 53 105.5 54 72.0 55 47.5 56 35.5 57 23.5 58 17.0 59 14.0 60 10.5 61 9.0 62 5.0 63 1.5 64 0.5 65 0.5 66 1.5 67 1.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.7000000000000001 2 0.0 3 0.0 4 0.0 5 0.15 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52261306532664 99.02499999999999 2 0.4522613065326633 0.8999999999999999 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.1875 0.0 0.0 0.0 0.0 104-105 0.21250000000000002 0.0 0.0 0.0 0.0 106-107 0.275 0.0 0.0 0.0 0.0 108-109 0.36250000000000004 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.6375 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.95 0.0 0.0 0.0 0.0 122-123 1.0625 0.0 0.0 0.0 0.0 124-125 1.225 0.0 0.0 0.0 0.0 126-127 1.3375 0.0 0.0 0.0 0.0 128-129 1.55 0.0 0.0 0.0 0.0 130-131 1.8 0.0 0.0 0.0 0.0 132-133 2.0 0.0 0.0 0.0 0.0 134-135 2.125 0.0 0.0 0.0 0.0 136-137 2.3625 0.0 0.0 0.0 0.0 138 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACAAA 10 0.0069754543 143.9875 4 >>END_MODULE SRR6031385 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031385_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6215 33.0 33.0 34.0 32.0 34.0 2 32.7695 33.0 33.0 34.0 32.0 34.0 3 32.78675 34.0 33.0 34.0 32.0 34.0 4 32.7125 34.0 33.0 34.0 32.0 34.0 5 32.76125 34.0 33.0 34.0 32.0 34.0 6 36.887 38.0 38.0 38.0 36.0 38.0 7 36.93375 38.0 38.0 38.0 36.0 38.0 8 36.92475 38.0 38.0 38.0 36.0 38.0 9 36.94575 38.0 38.0 38.0 36.0 38.0 10-14 36.99225 38.0 38.0 38.0 36.4 38.0 15-19 36.92545 38.0 38.0 38.0 36.0 38.0 20-24 36.914899999999996 38.0 38.0 38.0 36.4 38.0 25-29 36.887249999999995 38.0 38.0 38.0 36.2 38.0 30-34 36.954 38.0 38.0 38.0 36.6 38.0 35-39 36.80030000000001 38.0 38.0 38.0 36.2 38.0 40-44 36.594800000000006 38.0 38.0 38.0 36.0 38.0 45-49 36.8076 38.0 38.0 38.0 36.0 38.0 50-54 36.74 38.0 38.0 38.0 36.0 38.0 55-59 36.72255 38.0 38.0 38.0 36.0 38.0 60-64 36.679649999999995 38.0 38.0 38.0 35.8 38.0 65-69 36.65454999999999 38.0 38.0 38.0 35.8 38.0 70-74 36.668000000000006 38.0 38.0 38.0 35.8 38.0 75-79 36.63244999999999 38.0 38.0 38.0 35.8 38.0 80-84 35.947199999999995 38.0 38.0 38.0 34.4 38.0 85-89 35.24395 38.0 38.0 38.0 31.8 38.0 90-94 35.3144 38.0 38.0 38.0 32.2 38.0 95-99 35.2046 38.0 38.0 38.0 30.6 38.0 100-104 36.04665000000001 38.0 38.0 38.0 33.6 38.0 105-109 36.236599999999996 38.0 38.0 38.0 34.0 38.0 110-114 36.040800000000004 38.0 38.0 38.0 33.6 38.0 115-119 36.011100000000006 38.0 38.0 38.0 34.0 38.0 120-124 35.99555 38.0 38.0 38.0 33.8 38.0 125-129 35.22155 38.0 37.4 38.0 30.4 38.0 130-134 33.92555 38.0 36.2 38.0 20.2 38.0 135-139 32.95029999999999 38.0 35.2 38.0 13.4 38.0 140-144 32.8328 38.0 33.8 38.0 13.0 38.0 145-149 32.602 38.0 34.0 38.0 6.0 38.0 150 26.359 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 5.0 4 3.0 5 3.0 6 1.0 7 1.0 8 1.0 9 1.0 10 2.0 11 3.0 12 2.0 13 1.0 14 10.0 15 4.0 16 2.0 17 6.0 18 2.0 19 3.0 20 8.0 21 9.0 22 7.0 23 16.0 24 30.0 25 25.0 26 28.0 27 53.0 28 54.0 29 31.0 30 44.0 31 73.0 32 85.0 33 92.0 34 125.0 35 225.0 36 384.0 37 2646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.079719227876666 21.484081223364253 14.565053898220107 25.871145650538985 2 26.04767879548306 25.872020075282308 32.47176913425346 15.608531994981178 3 20.30112923462986 28.38143036386449 32.346298619824346 18.971141781681304 4 23.06148055207026 35.30740276035132 22.710163111668756 18.92095357590966 5 24.146586345381525 37.424698795180724 21.937751004016064 16.490963855421686 6 18.662324649298597 37.3496993987976 24.173346693386772 19.814629258517034 7 19.08817635270541 19.98997995991984 40.95691382765531 19.964929859719437 8 20.86673346693387 23.897795591182362 28.932865731462925 26.302605210420843 9 22.26953907815631 24.9749498997996 28.2314629258517 24.524048096192384 10-14 23.567421358445202 28.245842516529752 26.307353235824483 21.87938288920056 15-19 23.09118236472946 27.895791583166336 28.36673346693387 20.64629258517034 20-24 22.610220440881765 27.720440881763526 28.391783567134272 21.27755511022044 25-29 22.980961923847694 28.181362725450903 27.560120240480963 21.27755511022044 30-34 22.520536966539773 28.36104988980164 27.875175315568022 21.243237828090564 35-39 22.925259028266773 27.944874761090432 28.04043858766724 21.089427622975556 40-44 22.930964876867176 28.113645538958416 28.259991925716594 20.69539765845781 45-49 23.244515676650305 27.667033957728137 27.98257036962837 21.105879995993188 50-54 22.455524931094963 27.572037083437735 28.884991230268103 21.0874467551992 55-59 23.199518869342956 27.665012780033077 28.336590988823733 20.79887736180023 60-64 22.669873722188814 27.76608538785328 28.427540589296452 21.136500300661456 65-69 22.926169114330108 28.369505287955494 27.607638714851383 21.096686882863015 70-74 23.142484708713525 27.89030382031485 28.321467963501455 20.64574350747017 75-79 22.95706197705296 27.1256074953655 29.01447968335087 20.902850844230674 80-84 23.48558305690227 27.7877009441184 28.017351365144172 20.70936463383516 85-89 23.392755054311106 28.314536666493424 27.919546801101813 20.373161478093653 90-94 23.53305785123967 27.861570247933887 27.83574380165289 20.769628099173552 95-99 22.977798478497128 27.77001500802153 28.05982507892149 21.19236143455985 100-104 23.27975891511803 27.59919638372677 27.805123053741838 21.31592164741336 105-109 22.886494612878977 28.013029315960914 28.313705838135807 20.786770233024303 110-114 22.89265310213491 27.954294878219905 28.270021048411348 20.883030971233836 115-119 23.64146781632244 27.621816723481054 27.782233807900543 20.95448165229597 120-124 23.227261338010525 28.243547982961665 27.942871460786773 20.58631921824104 125-129 23.55898633893657 28.200700827789344 27.657305367934587 20.583007465339495 130-134 23.698874986857323 27.9360740195563 28.078014930080958 20.287036063505415 135-139 23.890416868899315 27.724747883298278 28.07528447392547 20.309550773876936 140-144 23.853405359601737 27.90488295731384 27.79896197436712 20.442749708717297 145-149 24.417723437578942 27.54003940787147 28.08568685899055 19.956550295559037 150 23.721163490471415 26.629889669007024 28.91173520561685 20.737211634904714 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 7.0 1 3.5 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.5 15 0.5 16 1.0 17 2.0 18 1.5 19 0.5 20 2.0 21 2.0 22 1.0 23 4.0 24 5.5 25 6.5 26 7.5 27 6.0 28 8.5 29 11.0 30 15.0 31 24.0 32 35.0 33 43.5 34 48.5 35 71.5 36 90.5 37 106.0 38 127.5 39 167.0 40 209.5 41 235.0 42 268.5 43 273.0 44 266.0 45 276.5 46 267.0 47 250.0 48 227.5 49 189.5 50 156.5 51 130.5 52 111.5 53 91.0 54 64.0 55 47.0 56 39.0 57 27.0 58 22.5 59 16.0 60 8.5 61 5.5 62 3.0 63 4.5 64 4.5 65 2.5 66 1.0 67 1.5 68 1.0 69 0.5 70 1.5 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.27499999999999997 2 0.375 3 0.375 4 0.375 5 0.4 6 0.2 7 0.2 8 0.2 9 0.2 10-14 0.18 15-19 0.2 20-24 0.2 25-29 0.2 30-34 0.18 35-39 0.59 40-44 0.9199999999999999 45-49 0.16999999999999998 50-54 0.22499999999999998 55-59 0.23500000000000001 60-64 0.22 65-69 0.245 70-74 0.27 75-79 0.20500000000000002 80-84 2.025 85-89 3.795 90-94 3.2 95-99 3.385 100-104 0.44999999999999996 105-109 0.22499999999999998 110-114 0.22999999999999998 115-119 0.26 120-124 0.22499999999999998 125-129 1.545 130-134 4.89 135-139 7.285 140-144 5.59 145-149 1.035 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.4021110831867303 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0125 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.025 0.0 0.0 0.0 0.0 92-93 0.025 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.07500000000000001 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.1875 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.625 0.0 0.0 0.0 0.0 116-117 0.6875 0.0 0.0 0.0 0.0 118-119 0.85 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0375 0.0 0.0 0.0 0.0 124-125 1.1749999999999998 0.0 0.0 0.0 0.0 126-127 1.2875 0.0 0.0 0.0 0.0 128-129 1.475 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.9125 0.0 0.0 0.0 0.0 134-135 2.0375 0.0 0.0 0.0 0.0 136-137 2.3125 0.0 0.0 0.0 0.0 138 2.45 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGGAT 10 0.007409038 141.11249 1 >>END_MODULE Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra Read 1159258 spots for SRR6031385.sra Written 1159258 spots for SRR6031385.sra SRR ids: ['SRR6031385.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5bqe6rle SRR6031385.sra spots: 23185160 blocks: [[1, 1159258], [1159259, 2318516], [2318517, 3477774], [3477775, 4637032], [4637033, 5796290], [5796291, 6955548], [6955549, 8114806], [8114807, 9274064], [9274065, 10433322], [10433323, 11592580], [11592581, 12751838], [12751839, 13911096], [13911097, 15070354], [15070355, 16229612], [16229613, 17388870], [17388871, 18548128], [18548129, 19707386], [19707387, 20866644], [20866645, 22025902], [22025903, 23185160]] SRR6031385 file size 7789706 SRR6031385 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031385 SRR6031385_1.fastq SRR6031385_2.fastq Input file: SRR6031385_1.fastq Paired file: SRR6031385_2.fastq trimmed: SRR6031385-trimmed-pair1.fastq, SRR6031385-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:06:36 2025 >> started Fri Feb 14 06:07:05 2025 >> done (28.562s) 23185160 read pairs processed; of these: 32554 ( 0.14%) short read pairs filtered out after trimming by size control 42824 ( 0.18%) empty read pairs filtered out after trimming by size control 23109782 (99.67%) read pairs available; of these: 8882715 (38.44%) trimmed read pairs available after processing 14227067 (61.56%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 6 0.00% 20 5 0.00% 21 4 0.00% 22 9 0.00% 23 6 0.00% 24 7 0.00% 25 11 0.00% 26 13 0.00% 27 7 0.00% 28 12 0.00% 29 10 0.00% 30 19 0.00% 31 6 0.00% 32 11 0.00% 33 13 0.00% 34 8 0.00% 35 19 0.00% 36 16 0.00% 37 16 0.00% 38 25 0.00% 39 22 0.00% 40 15 0.00% 41 31 0.00% 42 27 0.00% 43 25 0.00% 44 44 0.00% 45 43 0.00% 46 37 0.00% 47 46 0.00% 48 48 0.00% 49 58 0.00% 50 70 0.00% 51 58 0.00% 52 67 0.00% 53 69 0.00% 54 87 0.00% 55 92 0.00% 56 76 0.00% 57 96 0.00% 58 101 0.00% 59 117 0.00% 60 116 0.00% 61 136 0.00% 62 161 0.00% 63 185 0.00% 64 222 0.00% 65 251 0.00% 66 272 0.00% 67 353 0.00% 68 681 0.00% 69 1372 0.01% 70 927 0.00% 71 513 0.00% 72 462 0.00% 73 549 0.00% 74 619 0.00% 75 697 0.00% 76 795 0.00% 77 837 0.00% 78 956 0.00% 79 1072 0.00% 80 1120 0.00% 81 1380 0.01% 82 1552 0.01% 83 1899 0.01% 84 3953 0.02% 85 4044 0.02% 86 4411 0.02% 87 4602 0.02% 88 4686 0.02% 89 4954 0.02% 90 5198 0.02% 91 5306 0.02% 92 5820 0.03% 93 6294 0.03% 94 6667 0.03% 95 7292 0.03% 96 7924 0.03% 97 9726 0.04% 98 11982 0.05% 99 8755 0.04% 100 9002 0.04% 101 9418 0.04% 102 10261 0.04% 103 10876 0.05% 104 11740 0.05% 105 12251 0.05% 106 13088 0.06% 107 14047 0.06% 108 14284 0.06% 109 15346 0.07% 110 15674 0.07% 111 16506 0.07% 112 17503 0.08% 113 18409 0.08% 114 19386 0.08% 115 20056 0.09% 116 21472 0.09% 117 22435 0.10% 118 23364 0.10% 119 24406 0.11% 120 25212 0.11% 121 26218 0.11% 122 27441 0.12% 123 28980 0.13% 124 30565 0.13% 125 33448 0.14% 126 34506 0.15% 127 35744 0.15% 128 37316 0.16% 129 39220 0.17% 130 41522 0.18% 131 44031 0.19% 132 46466 0.20% 133 49659 0.21% 134 53202 0.23% 135 57181 0.25% 136 62327 0.27% 137 71821 0.31% 138 76944 0.33% 139 84954 0.37% 140 91363 0.40% 141 99222 0.43% 142 110255 0.48% 143 126865 0.55% 144 151624 0.66% 145 186608 0.81% 146 253905 1.10% 147 395012 1.71% 148 795891 3.44% 149 5325491 23.04% 150 14227067 61.56% 23109782 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=4.08 fanout-score-rank=32 prefix-density=0.23 prefix-fanout=3.5 sequence=AACATCTGAATTGCATATGATACGGCTGGAAGTGA criterion=fanout-score sequence-density=0.09 sequence-density-rank=7 fanout-score=397.68 fanout-score-rank=1 prefix-density=0.88 prefix-fanout=39.0 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.49 fanout-score-rank=30 prefix-density=0.51 prefix-fanout=2.9 sequence=TCTCCTTTCTTCTCTT criterion=fanout-score sequence-density=0.08 sequence-density-rank=11 fanout-score=387.84 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=32.1 sequence=AAGAAGAAGAAA SRR6031385 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:07:54 Started mapping on | Feb 14 06:07:54 Finished on | Feb 14 06:10:36 Mapping speed, Million of reads per hour | 513.55 Number of input reads | 23109782 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21948958 Uniquely mapped reads % | 94.98% Average mapped length | 295.11 Number of splices: Total | 21334864 Number of splices: Annotated (sjdb) | 20981974 Number of splices: GT/AG | 20990373 Number of splices: GC/AG | 271521 Number of splices: AT/AC | 12193 Number of splices: Non-canonical | 60777 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 780597 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 32683 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.47% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 413787 413787 413787 N_multimapping 780597 780597 780597 N_noFeature 531142 21695439 657609 N_ambiguous 270199 912 142608 UnstrandedReadsAssigned:21147617 PositiveStrandReadsAssigned:252607 NegativeStrandReadsAssigned:21148741 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031385 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031385-trimmed-pair1.fastq SRR6031385-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,109,782 reads, 21,108,108 reads pseudoaligned [quant] estimated average fragment length: 269.355 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,151 rounds 52401 SRR6031385.ke.tsv 34699 SRR6031385.se.tsv 87100 total ==> SRR6031385.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1749.64 402 10.4152 Potri.005G024800.1.v4.1 1035 766.645 172 10.1701 Potri.004G059700.1.v4.1 961 692.706 5 0.327198 Potri.007G009000.2.v4.1 1416 1147.64 0 0 Potri.003G141000.2.v4.1 2943 2674.64 583.12 9.88285 Potri.016G087400.1.v4.1 270 68.7607 1834.59 1209.45 Potri.015G069301.1.v4.1 564 303.325 0 0 Potri.010G195200.1.v4.1 1773 1504.64 58.4505 1.76094 Potri.012G127500.1.v4.1 977 708.686 2181 139.506 ==> SRR6031385.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 499 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 269 Potri.001G212900.v4.1 577 Potri.001G182400.v4.1 10 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 19 SRR6031385 completed mapping pipeline successfully