Starting /dee2/code/volunteer_pipeline.sh SRR6031386 current disk space = 3085440126976 free memory = 1468378524 SRR6031386 SRAfilesize 7611628c75cff50022664ba01e26e71c SRR6031386.sra SRR6031386.sra file validated SRR6031386 is paired end SRR6031386 is conventional basespace SRR6031386 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031386_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.39375 34.0 34.0 34.0 33.0 34.0 2 33.50425 34.0 34.0 34.0 33.0 34.0 3 33.48925 34.0 34.0 34.0 33.0 34.0 4 33.51875 34.0 34.0 34.0 33.0 34.0 5 33.51125 34.0 34.0 34.0 33.0 34.0 6 37.25525 38.0 38.0 38.0 36.0 38.0 7 37.49725 38.0 38.0 38.0 37.0 38.0 8 37.48975 38.0 38.0 38.0 37.0 38.0 9 37.55825 38.0 38.0 38.0 38.0 38.0 10-14 37.528150000000004 38.0 38.0 38.0 38.0 38.0 15-19 37.520399999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.56320000000001 38.0 38.0 38.0 38.0 38.0 25-29 37.533249999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.515 38.0 38.0 38.0 38.0 38.0 35-39 37.464999999999996 38.0 38.0 38.0 37.8 38.0 40-44 37.381 38.0 38.0 38.0 37.0 38.0 45-49 37.338100000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.28535000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.25915 38.0 38.0 38.0 37.0 38.0 60-64 37.20915 38.0 38.0 38.0 36.6 38.0 65-69 37.204049999999995 38.0 38.0 38.0 36.6 38.0 70-74 37.13825 38.0 38.0 38.0 36.6 38.0 75-79 37.11305 38.0 38.0 38.0 36.0 38.0 80-84 37.027300000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.9766 38.0 38.0 38.0 36.0 38.0 90-94 36.895450000000004 38.0 38.0 38.0 35.6 38.0 95-99 36.8945 38.0 38.0 38.0 35.8 38.0 100-104 36.76605000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.6372 38.0 38.0 38.0 34.8 38.0 110-114 36.4474 38.0 38.0 38.0 34.0 38.0 115-119 36.3875 38.0 38.0 38.0 34.0 38.0 120-124 36.20025 38.0 37.8 38.0 33.8 38.0 125-129 36.071400000000004 38.0 37.8 38.0 33.4 38.0 130-134 35.7938 38.0 37.2 38.0 32.4 38.0 135-139 35.5429 38.0 36.6 38.0 31.8 38.0 140-144 35.193349999999995 38.0 36.0 38.0 30.6 38.0 145-149 34.34885 38.0 35.8 38.0 27.6 38.0 150 28.1965 33.0 25.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 0.0 16 1.0 17 2.0 18 2.0 19 3.0 20 2.0 21 8.0 22 2.0 23 9.0 24 13.0 25 8.0 26 8.0 27 12.0 28 23.0 29 29.0 30 35.0 31 62.0 32 68.0 33 64.0 34 97.0 35 184.0 36 459.0 37 2906.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.32290362953692 12.065081351689612 11.11389236545682 38.49812265331665 2 21.9 16.075 34.625 27.400000000000002 3 19.950000000000003 22.55 25.7 31.8 4 21.8 32.025 22.625 23.549999999999997 5 22.05551387846962 34.18354588647162 22.655663915978995 21.10527631907977 6 16.225 37.375 25.8 20.599999999999998 7 13.450000000000001 24.125 43.875 18.55 8 17.125 25.45 30.725 26.700000000000003 9 16.625 24.375 33.575 25.424999999999997 10-14 19.515 29.709999999999997 27.405 23.369999999999997 15-19 19.16 28.7 28.285 23.855 20-24 19.67 28.549999999999997 28.199999999999996 23.580000000000002 25-29 18.94 29.049999999999997 28.42 23.59 30-34 19.345000000000002 28.694999999999997 28.299999999999997 23.66 35-39 19.34 28.355000000000004 28.315 23.990000000000002 40-44 18.86 28.915000000000003 28.645 23.580000000000002 45-49 19.259999999999998 29.005 28.310000000000002 23.425 50-54 19.415 28.48 28.075 24.03 55-59 19.62 28.335 27.965 24.08 60-64 19.41 29.14 27.755000000000003 23.695 65-69 19.3 28.985 28.235 23.48 70-74 20.005 28.105000000000004 28.275 23.615 75-79 19.595000000000002 28.449999999999996 28.1 23.855 80-84 19.759999999999998 28.925 27.715 23.599999999999998 85-89 19.755 28.24 28.33 23.674999999999997 90-94 20.044999999999998 28.71 28.025 23.22 95-99 19.435 29.14 27.650000000000002 23.775 100-104 19.84 28.1 28.345 23.715 105-109 20.04 28.444999999999997 27.72 23.794999999999998 110-114 20.02 28.37 28.04 23.57 115-119 19.61 28.525 27.939999999999998 23.925 120-124 19.900000000000002 28.325 27.975 23.799999999999997 125-129 19.73 28.410000000000004 27.845 24.015 130-134 20.23 28.23 28.26 23.28 135-139 20.025000000000002 28.375 27.805000000000003 23.794999999999998 140-144 19.634999999999998 28.1 28.439999999999998 23.825 145-149 19.61 28.275 28.384999999999998 23.73 150 19.554888722180543 28.582145536384097 28.35708927231808 23.50587646911728 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.5 22 1.5 23 1.0 24 2.5 25 8.0 26 10.5 27 9.0 28 11.5 29 19.5 30 23.0 31 29.5 32 37.0 33 48.0 34 70.5 35 84.0 36 91.5 37 117.0 38 141.5 39 157.5 40 199.0 41 236.5 42 262.5 43 273.5 44 278.0 45 287.5 46 263.5 47 238.0 48 210.5 49 175.0 50 148.0 51 129.0 52 109.0 53 83.0 54 65.0 55 46.0 56 29.0 57 19.0 58 16.5 59 17.5 60 13.0 61 9.0 62 8.5 63 6.5 64 3.0 65 1.0 66 1.5 67 2.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.0 3 0.0 4 0.0 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.16249999999999998 0.0 0.0 0.0 0.0 104-105 0.2625 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3875 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.5874999999999999 0.0 0.0 0.0 0.0 116-117 0.6499999999999999 0.0 0.0 0.0 0.0 118-119 0.7375 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 0.875 0.0 0.0 0.0 0.0 124-125 0.975 0.0 0.0 0.0 0.0 126-127 1.075 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.6625 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 1.9 0.0 0.0 0.0 0.0 138 1.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATACTCC 10 0.006973645 144.0 8 >>END_MODULE SRR6031386 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031386_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.71675 33.0 33.0 34.0 32.0 34.0 2 32.821 34.0 33.0 34.0 32.0 34.0 3 32.78975 34.0 33.0 34.0 32.0 34.0 4 32.81875 34.0 33.0 34.0 32.0 34.0 5 32.847 34.0 33.0 34.0 32.0 34.0 6 37.0075 38.0 38.0 38.0 36.0 38.0 7 37.087 38.0 38.0 38.0 37.0 38.0 8 37.03225 38.0 38.0 38.0 37.0 38.0 9 37.05175 38.0 38.0 38.0 36.0 38.0 10-14 37.04765 38.0 38.0 38.0 37.0 38.0 15-19 36.993050000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.999399999999994 38.0 38.0 38.0 37.0 38.0 25-29 36.9721 38.0 38.0 38.0 37.0 38.0 30-34 36.95119999999999 38.0 38.0 38.0 36.8 38.0 35-39 36.797399999999996 38.0 38.0 38.0 36.6 38.0 40-44 36.596199999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.8351 38.0 38.0 38.0 36.2 38.0 50-54 36.8482 38.0 38.0 38.0 36.2 38.0 55-59 36.85015 38.0 38.0 38.0 36.2 38.0 60-64 36.8198 38.0 38.0 38.0 36.2 38.0 65-69 36.75225 38.0 38.0 38.0 36.0 38.0 70-74 36.709 38.0 38.0 38.0 36.0 38.0 75-79 36.623599999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.165099999999995 38.0 38.0 38.0 35.0 38.0 85-89 35.396300000000004 38.0 38.0 38.0 33.2 38.0 90-94 35.511300000000006 38.0 38.0 38.0 32.2 38.0 95-99 35.4413 38.0 38.0 38.0 32.6 38.0 100-104 36.041399999999996 38.0 38.0 38.0 33.6 38.0 105-109 36.12235 38.0 38.0 38.0 34.0 38.0 110-114 36.074 38.0 38.0 38.0 34.0 38.0 115-119 35.91065 38.0 38.0 38.0 33.6 38.0 120-124 35.673950000000005 38.0 38.0 38.0 32.6 38.0 125-129 35.274649999999994 38.0 37.6 38.0 31.0 38.0 130-134 34.050799999999995 38.0 36.2 38.0 21.0 38.0 135-139 32.87875 38.0 35.8 38.0 13.0 38.0 140-144 32.661449999999995 38.0 34.0 38.0 10.8 38.0 145-149 32.39135 38.0 33.2 38.0 4.2 38.0 150 26.0005 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 5.0 4 3.0 5 1.0 6 2.0 7 1.0 8 4.0 9 5.0 10 5.0 11 2.0 12 2.0 13 3.0 14 5.0 15 3.0 16 6.0 17 5.0 18 6.0 19 7.0 20 8.0 21 10.0 22 20.0 23 7.0 24 15.0 25 32.0 26 26.0 27 29.0 28 52.0 29 52.0 30 51.0 31 56.0 32 52.0 33 135.0 34 92.0 35 179.0 36 393.0 37 2713.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.5250501002004 20.19038076152305 14.954909819639278 27.329659318637272 2 27.461789025306942 24.555249310949637 33.425206715109 14.557754948634427 3 21.102756892230577 27.89473684210526 32.08020050125313 18.922305764411025 4 23.277374091706342 34.55274367326485 24.004009020295666 18.16587321473315 5 24.260651629072683 36.16541353383458 23.884711779448622 15.689223057644112 6 20.795795795795797 37.687687687687685 24.474474474474476 17.04204204204204 7 20.27027027027027 18.86886886886887 41.366366366366364 19.494494494494493 8 21.52152152152152 24.84984984984985 27.677677677677675 25.95095095095095 9 21.396396396396398 25.2002002002002 30.98098098098098 22.42242242242242 10-14 23.52705611453171 29.298693497522148 26.510487060119136 20.663763327827 15-19 22.877748284669703 27.996193719637404 28.652276255822105 20.473781739870788 20-24 22.922822657384685 28.582160564932135 27.875995392397456 20.61902138528572 25-29 22.6496368645129 28.029050838968196 28.70022539444027 20.621086902078638 30-34 23.311132254995243 28.103560518804144 28.634383294105863 19.950923932094746 35-39 23.434597037408988 27.80316344463972 28.50615114235501 20.256088375596285 40-44 22.93990008578493 27.804410354745922 28.697582883382957 20.558106676086187 45-49 22.69858759891816 27.907442652509268 29.139537213262546 20.254432535310027 50-54 22.87116810258465 28.245842516529752 28.932077739931877 19.950911640953716 55-59 23.707673812863153 28.155680224403927 28.110599078341014 20.026046884391903 60-64 23.826696719258702 27.81367392937641 28.67518156774355 19.684447783621337 65-69 22.943592826370104 28.604348261697226 27.92806332030859 20.523995591624086 70-74 22.68423425680076 28.335253744802362 28.61079104253294 20.369720955863933 75-79 23.355872777360382 27.56824442774856 28.424743300776356 20.6511394941147 80-84 23.66848926690968 28.341433778857837 27.926285945727013 20.06379100850547 85-89 22.845939531524095 28.753482612733468 28.175626870292025 20.22495098545042 90-94 23.350957343052205 28.935886248139216 28.165905241004058 19.54725116780453 95-99 23.522470757233737 27.811409809152472 28.791298994459265 19.874820439154526 100-104 23.339353802929963 27.975115392333937 28.25105358217941 20.434477222556694 105-109 23.42951608055305 28.914938382927563 28.31880573088869 19.3367398056307 110-114 23.11660989781607 28.125626127028653 28.831897415347623 19.925866559807652 115-119 23.731275988176943 27.824257301738392 28.525624968688945 19.91884174139572 120-124 23.316633266533067 28.406813627254508 28.15130260521042 20.125250501002004 125-129 24.064737319753956 27.99737823938691 28.17888474336997 19.75899969748916 130-134 23.8881961762261 28.40814630091438 27.982128013300084 19.721529509559435 135-139 24.007480630510287 28.501202244189155 27.913438418380977 19.577878706919584 140-144 23.75158696572154 28.24798984341938 27.803639441388068 20.196783749471013 145-149 24.328960645812312 28.43592330978809 27.845610494450053 19.389505549949547 150 24.123246492985974 27.70541082164329 28.507014028056112 19.664328657314627 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 1.0 4 1.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.5 15 1.0 16 0.5 17 0.0 18 1.5 19 2.5 20 2.5 21 2.0 22 3.0 23 6.0 24 5.0 25 6.0 26 10.0 27 10.0 28 15.5 29 21.5 30 21.0 31 27.5 32 43.0 33 57.5 34 71.0 35 88.0 36 106.0 37 121.0 38 132.0 39 162.5 40 207.0 41 238.0 42 247.0 43 255.5 44 286.5 45 276.5 46 263.0 47 253.5 48 198.5 49 162.0 50 154.5 51 130.0 52 98.5 53 76.5 54 56.0 55 44.0 56 33.0 57 22.0 58 15.5 59 18.0 60 14.0 61 7.0 62 6.0 63 5.0 64 4.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.2 2 0.22499999999999998 3 0.25 4 0.22499999999999998 5 0.25 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.11499999999999999 15-19 0.165 20-24 0.165 25-29 0.17500000000000002 30-34 0.155 35-39 0.42500000000000004 40-44 0.915 45-49 0.16999999999999998 50-54 0.18 55-59 0.18 60-64 0.17500000000000002 65-69 0.19 70-74 0.19499999999999998 75-79 0.17500000000000002 80-84 1.24 85-89 3.09 90-94 2.595 95-99 2.54 100-104 0.33999999999999997 105-109 0.19 110-114 0.18 115-119 0.19499999999999998 120-124 0.2 125-129 0.83 130-134 3.7600000000000002 135-139 6.425 140-144 5.48 145-149 0.8999999999999999 150 0.2 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.037500000000000006 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1375 0.0 0.0 0.0 0.0 100-101 0.15 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.23750000000000002 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5375000000000001 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.025 0.0 0.0 0.0 0.0 128-129 1.1875 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.5625 0.0 0.0 0.0 0.0 134-135 1.6749999999999998 0.0 0.0 0.0 0.0 136-137 1.8 0.0 0.0 0.0 0.0 138 1.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044051 spots for SRR6031386.sra Written 1044051 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra Read 1044045 spots for SRR6031386.sra Written 1044045 spots for SRR6031386.sra SRR ids: ['SRR6031386.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ybdxil33 SRR6031386.sra spots: 20880906 blocks: [[1, 1044045], [1044046, 2088090], [2088091, 3132135], [3132136, 4176180], [4176181, 5220225], [5220226, 6264270], [6264271, 7308315], [7308316, 8352360], [8352361, 9396405], [9396406, 10440450], [10440451, 11484495], [11484496, 12528540], [12528541, 13572585], [13572586, 14616630], [14616631, 15660675], [15660676, 16704720], [16704721, 17748765], [17748766, 18792810], [18792811, 19836855], [19836856, 20880906]] SRR6031386 file size 7013370 SRR6031386 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031386 SRR6031386_1.fastq SRR6031386_2.fastq Input file: SRR6031386_1.fastq Paired file: SRR6031386_2.fastq trimmed: SRR6031386-trimmed-pair1.fastq, SRR6031386-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:14:00 2025 >> started Fri Feb 14 06:14:24 2025 >> done (24.002s) 20880906 read pairs processed; of these: 30217 ( 0.14%) short read pairs filtered out after trimming by size control 51410 ( 0.25%) empty read pairs filtered out after trimming by size control 20799279 (99.61%) read pairs available; of these: 8319923 (40.00%) trimmed read pairs available after processing 12479356 (60.00%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 7 0.00% 21 8 0.00% 22 3 0.00% 23 7 0.00% 24 6 0.00% 25 6 0.00% 26 7 0.00% 27 12 0.00% 28 10 0.00% 29 15 0.00% 30 12 0.00% 31 7 0.00% 32 17 0.00% 33 15 0.00% 34 6 0.00% 35 18 0.00% 36 13 0.00% 37 11 0.00% 38 16 0.00% 39 23 0.00% 40 22 0.00% 41 29 0.00% 42 33 0.00% 43 31 0.00% 44 36 0.00% 45 32 0.00% 46 50 0.00% 47 35 0.00% 48 58 0.00% 49 59 0.00% 50 62 0.00% 51 64 0.00% 52 70 0.00% 53 72 0.00% 54 85 0.00% 55 85 0.00% 56 84 0.00% 57 97 0.00% 58 128 0.00% 59 111 0.00% 60 126 0.00% 61 169 0.00% 62 182 0.00% 63 171 0.00% 64 180 0.00% 65 240 0.00% 66 315 0.00% 67 474 0.00% 68 526 0.00% 69 937 0.00% 70 1111 0.01% 71 766 0.00% 72 560 0.00% 73 533 0.00% 74 566 0.00% 75 624 0.00% 76 706 0.00% 77 691 0.00% 78 758 0.00% 79 885 0.00% 80 930 0.00% 81 1142 0.01% 82 1231 0.01% 83 1659 0.01% 84 3295 0.02% 85 3383 0.02% 86 3545 0.02% 87 3773 0.02% 88 4014 0.02% 89 4168 0.02% 90 4237 0.02% 91 4469 0.02% 92 4722 0.02% 93 5190 0.02% 94 5599 0.03% 95 5763 0.03% 96 6366 0.03% 97 7415 0.04% 98 9175 0.04% 99 6702 0.03% 100 7107 0.03% 101 7382 0.04% 102 8001 0.04% 103 8445 0.04% 104 9004 0.04% 105 9542 0.05% 106 10274 0.05% 107 10518 0.05% 108 11418 0.05% 109 11913 0.06% 110 12274 0.06% 111 12899 0.06% 112 13540 0.07% 113 14388 0.07% 114 15067 0.07% 115 15915 0.08% 116 16300 0.08% 117 17327 0.08% 118 18126 0.09% 119 18964 0.09% 120 19761 0.10% 121 20433 0.10% 122 21914 0.11% 123 22858 0.11% 124 24587 0.12% 125 27560 0.13% 126 28416 0.14% 127 29005 0.14% 128 30555 0.15% 129 32594 0.16% 130 34918 0.17% 131 37136 0.18% 132 39647 0.19% 133 42984 0.21% 134 46064 0.22% 135 50355 0.24% 136 54940 0.26% 137 61822 0.30% 138 67179 0.32% 139 74625 0.36% 140 80279 0.39% 141 88150 0.42% 142 96098 0.46% 143 108841 0.52% 144 130977 0.63% 145 165367 0.80% 146 225999 1.09% 147 360853 1.73% 148 761180 3.66% 149 5187656 24.94% 150 12479356 60.00% 20799279 reads passed initial QC criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=3.18 fanout-score-rank=32 prefix-density=0.10 prefix-fanout=3.0 sequence=GTGGACTCCTTCTGGAT criterion=fanout-score sequence-density=0.06 sequence-density-rank=30 fanout-score=446.18 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=32.6 sequence=TCATCATCATCA criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=21 prefix-density=0.14 prefix-fanout=3.0 sequence=CACAGCAGTCCATGCA criterion=fanout-score sequence-density=0.06 sequence-density-rank=24 fanout-score=527.04 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=34.7 sequence=AAGAAGAAGAATGA SRR6031386 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:15:10 Started mapping on | Feb 14 06:15:10 Finished on | Feb 14 06:17:38 Mapping speed, Million of reads per hour | 505.93 Number of input reads | 20799279 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 19984034 Uniquely mapped reads % | 96.08% Average mapped length | 295.63 Number of splices: Total | 19464031 Number of splices: Annotated (sjdb) | 18791500 Number of splices: GT/AG | 19119102 Number of splices: GC/AG | 287095 Number of splices: AT/AC | 15728 Number of splices: Non-canonical | 42106 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 3.10 Insertion rate per base | 0.02% Insertion average length | 1.66 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 384115 % of reads mapped to multiple loci | 1.85% Number of reads mapped to too many loci | 62510 % of reads mapped to too many loci | 0.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 456937 456937 456937 N_multimapping 384115 384115 384115 N_noFeature 1022098 19717045 1167144 N_ambiguous 220119 1433 97611 UnstrandedReadsAssigned:18741817 PositiveStrandReadsAssigned:265556 NegativeStrandReadsAssigned:18719279 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031386 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031386-trimmed-pair1.fastq SRR6031386-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 20,799,279 reads, 18,765,581 reads pseudoaligned [quant] estimated average fragment length: 279.803 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,188 rounds 52401 SRR6031386.ke.tsv 34699 SRR6031386.se.tsv 87100 total ==> SRR6031386.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1739.2 1028 29.8833 Potri.005G024800.1.v4.1 1035 756.197 1921 128.433 Potri.004G059700.1.v4.1 961 682.307 19 1.40785 Potri.007G009000.2.v4.1 1416 1137.2 0 0 Potri.003G141000.2.v4.1 2943 2664.2 1000.29 18.9821 Potri.016G087400.1.v4.1 270 63.4325 1464 1166.84 Potri.015G069301.1.v4.1 564 295.028 0 0 Potri.010G195200.1.v4.1 1773 1494.2 2125.86 71.93 Potri.012G127500.1.v4.1 977 698.256 8170 591.55 ==> SRR6031386.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 232 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 74 SRR6031386 completed mapping pipeline successfully