Starting /dee2/code/volunteer_pipeline.sh SRR6031387 current disk space = 3084954755072 free memory = 1582387596 SRR6031387 SRAfilesize 20d36808a1acf8f203ace063c034d6cc SRR6031387.sra SRR6031387.sra file validated SRR6031387 is paired end SRR6031387 is conventional basespace SRR6031387 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031387_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0035 34.0 33.0 34.0 33.0 34.0 2 33.43825 34.0 34.0 34.0 33.0 34.0 3 33.48475 34.0 34.0 34.0 33.0 34.0 4 33.51425 34.0 34.0 34.0 33.0 34.0 5 33.359 34.0 34.0 34.0 33.0 34.0 6 37.16075 38.0 38.0 38.0 36.0 38.0 7 37.37575 38.0 38.0 38.0 37.0 38.0 8 37.47275 38.0 38.0 38.0 37.0 38.0 9 37.52225 38.0 38.0 38.0 38.0 38.0 10-14 37.4829 38.0 38.0 38.0 37.4 38.0 15-19 37.50785 38.0 38.0 38.0 38.0 38.0 20-24 37.498599999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.4694 38.0 38.0 38.0 37.8 38.0 30-34 37.45785 38.0 38.0 38.0 37.4 38.0 35-39 37.39935 38.0 38.0 38.0 37.4 38.0 40-44 37.2716 38.0 38.0 38.0 37.0 38.0 45-49 37.229299999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.12445 38.0 38.0 38.0 36.0 38.0 55-59 37.10865 38.0 38.0 38.0 36.0 38.0 60-64 37.061350000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.02295 38.0 38.0 38.0 36.0 38.0 70-74 36.930400000000006 38.0 38.0 38.0 36.0 38.0 75-79 36.932100000000005 38.0 38.0 38.0 35.8 38.0 80-84 36.85685 38.0 38.0 38.0 35.4 38.0 85-89 36.82469999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.65925 38.0 38.0 38.0 34.6 38.0 95-99 36.64955 38.0 38.0 38.0 34.8 38.0 100-104 36.4705 38.0 38.0 38.0 34.0 38.0 105-109 36.40125 38.0 38.0 38.0 34.0 38.0 110-114 36.220650000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.0635 38.0 37.4 38.0 33.2 38.0 120-124 36.029849999999996 38.0 37.2 38.0 33.0 38.0 125-129 35.87115 38.0 37.0 38.0 32.2 38.0 130-134 35.644349999999996 38.0 36.6 38.0 31.6 38.0 135-139 35.4384 38.0 36.0 38.0 31.0 38.0 140-144 34.90525 38.0 36.0 38.0 28.4 38.0 145-149 34.248599999999996 38.0 35.2 38.0 26.4 38.0 150 28.41025 35.0 27.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.0 18 2.0 19 3.0 20 5.0 21 5.0 22 2.0 23 7.0 24 12.0 25 16.0 26 25.0 27 22.0 28 18.0 29 32.0 30 41.0 31 44.0 32 58.0 33 101.0 34 136.0 35 219.0 36 493.0 37 2754.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.781947261663284 13.23529411764706 10.294117647058822 36.68864097363083 2 21.025 18.375 34.5 26.1 3 18.125 24.825 27.250000000000004 29.799999999999997 4 22.45 31.900000000000002 22.95 22.7 5 20.742412841735643 36.593930273388516 24.329069475796338 18.334587409079507 6 16.75 36.7 24.8 21.75 7 14.35 22.175 44.5 18.975 8 16.5 23.575 32.65 27.275 9 17.925 23.075000000000003 33.225 25.775 10-14 19.41 29.65 27.375 23.565 15-19 19.235 28.34 28.395 24.03 20-24 18.98 28.945 28.249999999999996 23.825 25-29 19.095000000000002 28.785 27.99 24.13 30-34 18.84 28.435 28.345 24.38 35-39 19.45 28.785 28.4 23.365 40-44 19.275000000000002 29.310000000000002 27.800000000000004 23.615 45-49 19.345000000000002 28.24 28.360000000000003 24.055 50-54 19.08 28.71 27.950000000000003 24.26 55-59 19.6 28.205000000000002 28.57 23.625 60-64 19.945 28.655 27.779999999999998 23.62 65-69 19.54 28.51 27.744999999999997 24.205 70-74 19.35 29.035 28.050000000000004 23.565 75-79 19.97 28.799999999999997 27.779999999999998 23.45 80-84 19.495 28.465 28.299999999999997 23.74 85-89 20.200000000000003 28.26 27.775 23.765 90-94 19.475 27.92 28.325 24.279999999999998 95-99 19.564999999999998 28.48 28.675 23.28 100-104 19.580000000000002 28.48 28.110000000000003 23.830000000000002 105-109 19.43 28.544999999999998 28.470000000000002 23.555 110-114 19.345000000000002 28.33 28.175 24.15 115-119 19.535 28.610000000000003 27.775 24.08 120-124 19.535 28.7 28.435 23.330000000000002 125-129 19.869999999999997 28.439999999999998 27.625 24.065 130-134 19.814999999999998 28.78 27.565 23.84 135-139 20.36 28.95 27.555000000000003 23.135 140-144 19.71 28.535 27.689999999999998 24.065 145-149 20.27 28.01 28.189999999999998 23.53 150 18.756268806419257 29.914744232698094 28.309929789368105 23.019057171514543 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 2.0 24 2.0 25 1.0 26 3.0 27 5.5 28 10.0 29 14.5 30 22.0 31 30.0 32 36.5 33 42.0 34 56.5 35 82.0 36 111.5 37 134.0 38 145.0 39 168.0 40 207.5 41 234.0 42 260.5 43 285.5 44 284.0 45 263.0 46 247.0 47 239.5 48 209.0 49 190.0 50 167.0 51 124.5 52 100.5 53 87.5 54 72.0 55 48.0 56 27.0 57 18.5 58 14.5 59 14.5 60 12.0 61 6.5 62 5.5 63 4.0 64 2.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4000000000000001 2 0.0 3 0.0 4 0.0 5 0.325 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.21250000000000002 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.2375 0.0 0.0 0.0 0.0 108-109 0.25 0.0 0.0 0.0 0.0 110-111 0.25 0.0 0.0 0.0 0.0 112-113 0.25 0.0 0.0 0.0 0.0 114-115 0.25 0.0 0.0 0.0 0.0 116-117 0.2875 0.0 0.0 0.0 0.0 118-119 0.32499999999999996 0.0 0.0 0.0 0.0 120-121 0.375 0.0 0.0 0.0 0.0 122-123 0.425 0.0 0.0 0.0 0.0 124-125 0.5125 0.0 0.0 0.0 0.0 126-127 0.5625 0.0 0.0 0.0 0.0 128-129 0.6125 0.0 0.0 0.0 0.0 130-131 0.75 0.0 0.0 0.0 0.0 132-133 0.925 0.0 0.0 0.0 0.0 134-135 1.1124999999999998 0.0 0.0 0.0 0.0 136-137 1.1875 0.0 0.0 0.0 0.0 138 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0036832115 20.569643 90-94 >>END_MODULE SRR6031387 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031387_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.59425 33.0 33.0 34.0 32.0 34.0 2 32.6465 33.0 33.0 34.0 32.0 34.0 3 32.73725 34.0 33.0 34.0 32.0 34.0 4 32.61775 34.0 33.0 34.0 32.0 34.0 5 32.598 34.0 33.0 34.0 32.0 34.0 6 36.8935 38.0 38.0 38.0 36.0 38.0 7 36.84625 38.0 38.0 38.0 36.0 38.0 8 36.96275 38.0 38.0 38.0 37.0 38.0 9 36.97175 38.0 38.0 38.0 36.0 38.0 10-14 36.95155000000001 38.0 38.0 38.0 36.2 38.0 15-19 36.9293 38.0 38.0 38.0 36.2 38.0 20-24 36.92695 38.0 38.0 38.0 36.4 38.0 25-29 36.910849999999996 38.0 38.0 38.0 36.8 38.0 30-34 36.92285 38.0 38.0 38.0 36.8 38.0 35-39 36.7875 38.0 38.0 38.0 36.4 38.0 40-44 36.54615 38.0 38.0 38.0 36.0 38.0 45-49 36.74555 38.0 38.0 38.0 36.0 38.0 50-54 36.837599999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.7441 38.0 38.0 38.0 36.0 38.0 60-64 36.72645 38.0 38.0 38.0 36.0 38.0 65-69 36.670049999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.5698 38.0 38.0 38.0 35.2 38.0 75-79 36.573899999999995 38.0 38.0 38.0 35.4 38.0 80-84 36.217200000000005 38.0 38.0 38.0 34.6 38.0 85-89 35.58115 38.0 38.0 38.0 33.6 38.0 90-94 35.55275 38.0 38.0 38.0 33.0 38.0 95-99 35.5382 38.0 38.0 38.0 33.0 38.0 100-104 36.0066 38.0 38.0 38.0 33.4 38.0 105-109 36.0893 38.0 38.0 38.0 33.8 38.0 110-114 35.9311 38.0 38.0 38.0 33.6 38.0 115-119 35.8822 38.0 38.0 38.0 33.4 38.0 120-124 35.6082 38.0 38.0 38.0 31.8 38.0 125-129 35.188550000000006 38.0 37.4 38.0 30.0 38.0 130-134 34.1459 38.0 36.2 38.0 21.8 38.0 135-139 33.24929999999999 38.0 35.6 38.0 14.0 38.0 140-144 33.075750000000006 38.0 35.0 38.0 13.8 38.0 145-149 32.8374 38.0 34.8 38.0 8.8 38.0 150 27.1925 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 5.0 5 4.0 6 3.0 7 1.0 8 2.0 9 2.0 10 3.0 11 2.0 12 5.0 13 2.0 14 4.0 15 4.0 16 10.0 17 4.0 18 9.0 19 10.0 20 4.0 21 4.0 22 8.0 23 15.0 24 25.0 25 28.0 26 30.0 27 44.0 28 55.0 29 39.0 30 46.0 31 66.0 32 75.0 33 112.0 34 105.0 35 195.0 36 345.0 37 2723.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.56823322442825 18.99974868057301 13.420457401357124 26.011560693641616 2 26.5393314903242 24.805227444081428 33.375219904498614 15.280221161095753 3 20.13068610203569 27.770796682583565 31.51545614475999 20.583061070620758 4 22.945463684342798 35.3606433777331 23.598894194521236 18.094998743402865 5 24.54111139049535 37.13854664319839 21.47347246668343 16.846869499622834 6 19.225 38.525 23.3 18.95 7 17.838378784088064 19.514635976982735 42.48186139604703 20.165123842882164 8 21.6 23.7 29.525000000000002 25.174999999999997 9 22.275 24.75 30.0 22.975 10-14 23.33783580969533 28.945920256140877 26.91480314172795 20.80144079243584 15-19 23.112311231123112 28.562856285628563 28.052805280528055 20.27202720272027 20-24 22.579515903180635 28.085617123424683 28.995799159831964 20.33906781356271 25-29 22.966076253377366 28.46492544781347 28.775142599819876 19.793855698989294 30-34 22.51287950782774 28.59500825288851 28.444955734507076 20.44715650477667 35-39 22.8472501003613 28.758530710558013 28.311922922521077 20.082296266559617 40-44 22.988274369684465 28.539077046952844 28.24719440390519 20.2254541794575 45-49 23.14583124812331 28.615754178760884 28.300470423381043 19.93794414973476 50-54 23.305826456614152 28.10202550637659 28.602150537634408 19.98999749937484 55-59 23.230099564717065 28.343423225096316 28.433481763146045 19.992995447040578 60-64 22.73750562809545 28.490669868427638 28.60073040172095 20.171094101755966 65-69 23.144257703081234 28.416366546618647 28.241296518607445 20.198079231692677 70-74 23.479087452471482 28.522113267960776 28.271963177906745 19.726836101660997 75-79 23.445 28.4 28.265 19.89 80-84 22.819063004846527 28.56421647819063 28.432956381260098 20.18376413570275 85-89 23.072970195272354 28.026721479958887 28.895169578622813 20.00513874614594 90-94 23.347657049314506 28.03867403314917 28.330263965623082 20.28340495191324 95-99 23.757922715191167 28.11797178491106 28.06685749335514 20.05724800654263 100-104 23.153992585913237 28.609357779781586 28.514176936178742 19.722472698126438 105-109 23.76713013904171 28.54856456937081 27.273181954586377 20.4111233370011 110-114 23.281984595378614 28.218465539661896 28.628588576572973 19.870961288386514 115-119 23.710153630586 27.713556523044584 28.759445528699395 19.816844317670018 120-124 23.36635644951466 28.089662763934754 28.93525467827479 19.608726108275793 125-129 23.74723284363051 27.565908633527876 28.994767558864964 19.692090963976653 130-134 23.614058698690407 28.319271183808688 28.32444743516745 19.742222682333455 135-139 23.726484886916086 28.725428027901078 27.927499471570492 19.620587613612344 140-144 23.596972069955623 28.744453145392846 27.70555990602976 19.95301487862177 145-149 23.97105382180009 28.77028996431982 27.674757525503797 19.5838986883763 150 23.900477506911283 28.675546619753707 27.519477255591855 19.90449861774315 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 2.0 21 3.5 22 4.0 23 4.5 24 5.5 25 8.5 26 7.0 27 9.0 28 16.0 29 17.5 30 25.0 31 34.0 32 32.0 33 37.0 34 65.5 35 85.0 36 110.0 37 139.5 38 157.5 39 168.0 40 203.0 41 249.5 42 265.5 43 278.5 44 291.5 45 278.0 46 245.5 47 231.5 48 206.0 49 175.0 50 149.5 51 110.5 52 95.0 53 77.5 54 56.5 55 43.5 56 25.5 57 20.5 58 16.5 59 14.0 60 7.0 61 5.0 62 7.0 63 4.0 64 3.0 65 2.5 66 1.0 67 0.5 68 1.5 69 1.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.525 2 0.525 3 0.525 4 0.525 5 0.575 6 0.0 7 0.075 8 0.0 9 0.0 10-14 0.055 15-19 0.01 20-24 0.02 25-29 0.06999999999999999 30-34 0.034999999999999996 35-39 0.36 40-44 0.645 45-49 0.09 50-54 0.025 55-59 0.065 60-64 0.055 65-69 0.04 70-74 0.06 75-79 0.0 80-84 0.96 85-89 2.7 90-94 2.26 95-99 2.18 100-104 0.19 105-109 0.03 110-114 0.03 115-119 0.08499999999999999 120-124 0.06999999999999999 125-129 0.62 130-134 3.405 135-139 5.38 140-144 4.2250000000000005 145-149 0.505 150 0.525 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8998998998999 99.8 2 0.10010010010010009 0.2 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0625 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.0875 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.16249999999999998 0.0 0.0 0.0 0.0 98-99 0.21250000000000002 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.275 0.0 0.0 0.0 0.0 110-111 0.275 0.0 0.0 0.0 0.0 112-113 0.275 0.0 0.0 0.0 0.0 114-115 0.275 0.0 0.0 0.0 0.0 116-117 0.3125 0.0 0.0 0.0 0.0 118-119 0.375 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.475 0.0 0.0 0.0 0.0 124-125 0.5625 0.0 0.0 0.0 0.0 126-127 0.6125 0.0 0.0 0.0 0.0 128-129 0.6875 0.0 0.0 0.0 0.0 130-131 0.8 0.0 0.0 0.0 0.0 132-133 0.9750000000000001 0.0 0.0 0.0 0.0 134-135 1.1375000000000002 0.0 0.0 0.0 0.0 136-137 1.2 0.0 0.0 0.0 0.0 138 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAGCC 10 0.0072029857 142.45 9 >>END_MODULE Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128064 spots for SRR6031387.sra Written 1128064 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra Read 1128057 spots for SRR6031387.sra Written 1128057 spots for SRR6031387.sra SRR ids: ['SRR6031387.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_h_80qx2w SRR6031387.sra spots: 22561147 blocks: [[1, 1128057], [1128058, 2256114], [2256115, 3384171], [3384172, 4512228], [4512229, 5640285], [5640286, 6768342], [6768343, 7896399], [7896400, 9024456], [9024457, 10152513], [10152514, 11280570], [11280571, 12408627], [12408628, 13536684], [13536685, 14664741], [14664742, 15792798], [15792799, 16920855], [16920856, 18048912], [18048913, 19176969], [19176970, 20305026], [20305027, 21433083], [21433084, 22561147]] SRR6031387 file size 7579467 SRR6031387 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031387 SRR6031387_1.fastq SRR6031387_2.fastq Input file: SRR6031387_1.fastq Paired file: SRR6031387_2.fastq trimmed: SRR6031387-trimmed-pair1.fastq, SRR6031387-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:09:22 2025 >> started Fri Feb 14 07:09:45 2025 >> done (23.162s) 22561147 read pairs processed; of these: 33813 ( 0.15%) short read pairs filtered out after trimming by size control 46602 ( 0.21%) empty read pairs filtered out after trimming by size control 22480732 (99.64%) read pairs available; of these: 8398244 (37.36%) trimmed read pairs available after processing 14082488 (62.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 7 0.00% 21 5 0.00% 22 4 0.00% 23 8 0.00% 24 14 0.00% 25 7 0.00% 26 7 0.00% 27 15 0.00% 28 11 0.00% 29 8 0.00% 30 29 0.00% 31 12 0.00% 32 9 0.00% 33 16 0.00% 34 10 0.00% 35 17 0.00% 36 19 0.00% 37 12 0.00% 38 19 0.00% 39 20 0.00% 40 32 0.00% 41 30 0.00% 42 33 0.00% 43 24 0.00% 44 35 0.00% 45 37 0.00% 46 44 0.00% 47 57 0.00% 48 51 0.00% 49 43 0.00% 50 61 0.00% 51 65 0.00% 52 75 0.00% 53 86 0.00% 54 74 0.00% 55 70 0.00% 56 109 0.00% 57 95 0.00% 58 115 0.00% 59 130 0.00% 60 134 0.00% 61 132 0.00% 62 162 0.00% 63 167 0.00% 64 190 0.00% 65 220 0.00% 66 276 0.00% 67 441 0.00% 68 468 0.00% 69 781 0.00% 70 859 0.00% 71 587 0.00% 72 472 0.00% 73 483 0.00% 74 480 0.00% 75 562 0.00% 76 631 0.00% 77 617 0.00% 78 720 0.00% 79 766 0.00% 80 905 0.00% 81 1041 0.00% 82 1192 0.01% 83 1474 0.01% 84 3516 0.02% 85 3576 0.02% 86 3691 0.02% 87 3745 0.02% 88 3985 0.02% 89 4092 0.02% 90 4239 0.02% 91 4335 0.02% 92 4737 0.02% 93 4845 0.02% 94 5104 0.02% 95 5547 0.02% 96 5843 0.03% 97 6311 0.03% 98 8483 0.04% 99 6533 0.03% 100 6746 0.03% 101 7120 0.03% 102 7503 0.03% 103 8045 0.04% 104 8500 0.04% 105 9217 0.04% 106 9633 0.04% 107 10152 0.05% 108 10591 0.05% 109 11080 0.05% 110 11734 0.05% 111 12461 0.06% 112 13070 0.06% 113 13828 0.06% 114 14547 0.06% 115 15125 0.07% 116 15806 0.07% 117 16574 0.07% 118 17329 0.08% 119 18304 0.08% 120 19040 0.08% 121 19984 0.09% 122 21082 0.09% 123 22285 0.10% 124 24192 0.11% 125 26616 0.12% 126 27139 0.12% 127 28443 0.13% 128 29661 0.13% 129 30972 0.14% 130 33369 0.15% 131 35606 0.16% 132 38190 0.17% 133 41458 0.18% 134 44486 0.20% 135 48386 0.22% 136 53458 0.24% 137 60199 0.27% 138 67962 0.30% 139 74118 0.33% 140 82288 0.37% 141 91394 0.41% 142 102573 0.46% 143 117594 0.52% 144 142144 0.63% 145 177607 0.79% 146 245596 1.09% 147 380067 1.69% 148 771452 3.43% 149 5209647 23.17% 150 14082488 62.64% 22480732 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=9.60 fanout-score-rank=25 prefix-density=0.16 prefix-fanout=5.3 sequence=CATTGCAGCAGTTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=19 fanout-score=584.10 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=37.0 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=357.42 fanout-score-rank=5 prefix-density=0.93 prefix-fanout=34.6 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=14 fanout-score=550.00 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=34.6 sequence=AAGAAGAAGAAG SRR6031387 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:10:29 Started mapping on | Feb 14 07:10:29 Finished on | Feb 14 07:12:17 Mapping speed, Million of reads per hour | 749.36 Number of input reads | 22480732 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 21530543 Uniquely mapped reads % | 95.77% Average mapped length | 295.92 Number of splices: Total | 20401594 Number of splices: Annotated (sjdb) | 19936126 Number of splices: GT/AG | 20048692 Number of splices: GC/AG | 295820 Number of splices: AT/AC | 17681 Number of splices: Non-canonical | 39401 Mismatch rate per base, % | 0.21% Deletion rate per base | 0.02% Deletion average length | 2.48 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 514311 % of reads mapped to multiple loci | 2.29% Number of reads mapped to too many loci | 31030 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.76% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 468801 468801 468801 N_multimapping 514311 514311 514311 N_noFeature 883172 21288863 1019490 N_ambiguous 219486 1320 113377 UnstrandedReadsAssigned:20427885 PositiveStrandReadsAssigned:240360 NegativeStrandReadsAssigned:20397676 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031387 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031387-trimmed-pair1.fastq SRR6031387-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,480,732 reads, 20,531,141 reads pseudoaligned [quant] estimated average fragment length: 294.246 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR6031387.ke.tsv 34699 SRR6031387.se.tsv 87100 total ==> SRR6031387.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1724.75 1254 37.1221 Potri.005G024800.1.v4.1 1035 741.754 464 31.9389 Potri.004G059700.1.v4.1 961 667.934 122 9.32585 Potri.007G009000.2.v4.1 1416 1122.75 4 0.181902 Potri.003G141000.2.v4.1 2943 2649.75 1075.56 20.7248 Potri.016G087400.1.v4.1 270 60.7563 1662 1396.7 Potri.015G069301.1.v4.1 564 285.252 0 0 Potri.010G195200.1.v4.1 1773 1479.75 131.489 4.53692 Potri.012G127500.1.v4.1 977 683.86 1708 127.521 ==> SRR6031387.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 16 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 295 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR6031387 completed mapping pipeline successfully