Starting /dee2/code/volunteer_pipeline.sh SRR6031388 current disk space = 3119802245120 free memory = 1582554964 SRR6031388 SRAfilesize 1d6f3ddd2b20f60e9241f654f6cfaee6 SRR6031388.sra SRR6031388.sra file validated SRR6031388 is paired end SRR6031388 is conventional basespace SRR6031388 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83 34.0 33.0 34.0 33.0 34.0 2 33.40775 34.0 34.0 34.0 33.0 34.0 3 33.466 34.0 34.0 34.0 33.0 34.0 4 33.4835 34.0 34.0 34.0 33.0 34.0 5 33.452 34.0 34.0 34.0 33.0 34.0 6 37.21775 38.0 38.0 38.0 36.0 38.0 7 37.47125 38.0 38.0 38.0 37.0 38.0 8 37.58 38.0 38.0 38.0 38.0 38.0 9 37.56225 38.0 38.0 38.0 38.0 38.0 10-14 37.57725000000001 38.0 38.0 38.0 38.0 38.0 15-19 37.600350000000006 38.0 38.0 38.0 38.0 38.0 20-24 37.5838 38.0 38.0 38.0 38.0 38.0 25-29 37.56125 38.0 38.0 38.0 38.0 38.0 30-34 37.57025 38.0 38.0 38.0 38.0 38.0 35-39 37.493 38.0 38.0 38.0 37.6 38.0 40-44 37.36315 38.0 38.0 38.0 37.0 38.0 45-49 37.32005 38.0 38.0 38.0 37.0 38.0 50-54 37.322950000000006 38.0 38.0 38.0 37.0 38.0 55-59 37.289699999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.286550000000005 38.0 38.0 38.0 37.0 38.0 65-69 37.244299999999996 38.0 38.0 38.0 37.0 38.0 70-74 37.1161 38.0 38.0 38.0 36.2 38.0 75-79 37.0998 38.0 38.0 38.0 36.0 38.0 80-84 37.0426 38.0 38.0 38.0 36.0 38.0 85-89 36.9338 38.0 38.0 38.0 36.0 38.0 90-94 36.859449999999995 38.0 38.0 38.0 35.6 38.0 95-99 36.7404 38.0 38.0 38.0 35.0 38.0 100-104 36.70100000000001 38.0 38.0 38.0 35.0 38.0 105-109 36.499900000000004 38.0 38.0 38.0 34.0 38.0 110-114 36.25665 38.0 37.8 38.0 34.0 38.0 115-119 36.11295 38.0 37.8 38.0 33.8 38.0 120-124 36.1372 38.0 37.8 38.0 33.8 38.0 125-129 35.8485 38.0 37.2 38.0 32.2 38.0 130-134 35.44575 38.0 36.6 38.0 31.0 38.0 135-139 35.27745 38.0 36.0 38.0 30.4 38.0 140-144 34.698249999999994 38.0 36.0 38.0 28.4 38.0 145-149 33.67745 38.0 35.2 38.0 20.2 38.0 150 24.937 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 2.0 14 2.0 15 2.0 16 0.0 17 3.0 18 2.0 19 5.0 20 4.0 21 4.0 22 4.0 23 9.0 24 13.0 25 13.0 26 8.0 27 16.0 28 27.0 29 33.0 30 28.0 31 45.0 32 53.0 33 77.0 34 113.0 35 215.0 36 569.0 37 2752.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.44098109351047 14.895247828308635 9.172202350536535 34.491568727644356 2 22.6 17.625 36.225 23.549999999999997 3 18.675 24.099999999999998 28.349999999999998 28.875 4 22.725 31.474999999999998 22.75 23.05 5 20.686200851490106 37.24017029802154 23.441021788129227 18.632607062359128 6 16.5 34.875 26.950000000000003 21.675 7 14.224999999999998 24.025 43.525000000000006 18.224999999999998 8 16.725 23.45 32.85 26.974999999999998 9 17.424999999999997 23.674999999999997 32.15 26.75 10-14 20.03 30.220000000000002 26.479999999999997 23.27 15-19 19.425 29.17 27.994999999999997 23.41 20-24 19.665 28.494999999999997 27.915 23.925 25-29 19.49 28.565 28.38 23.565 30-34 19.39 28.945 27.575 24.09 35-39 19.86 28.405 28.139999999999997 23.595 40-44 19.939999999999998 28.895 27.43 23.735 45-49 19.835 28.79 27.62 23.755000000000003 50-54 19.53 28.444999999999997 28.035 23.990000000000002 55-59 19.735 28.799999999999997 27.665 23.799999999999997 60-64 19.265 29.085 27.839999999999996 23.810000000000002 65-69 19.605 28.595 27.994999999999997 23.805 70-74 19.54 28.994999999999997 27.42 24.044999999999998 75-79 19.575 28.335 28.625 23.465 80-84 19.68 28.610000000000003 27.74 23.97 85-89 19.950000000000003 28.720000000000002 27.755000000000003 23.575 90-94 20.474999999999998 28.24 27.54 23.745 95-99 19.535 28.310000000000002 28.335 23.82 100-104 20.135 28.975 27.76 23.13 105-109 19.96 28.07 28.035 23.935000000000002 110-114 20.05 28.310000000000002 28.37 23.27 115-119 20.525 28.970000000000002 27.625 22.88 120-124 20.415 27.955000000000002 27.47 24.16 125-129 20.49 28.139999999999997 28.15 23.22 130-134 20.0 28.1 27.73 24.169999999999998 135-139 20.925 28.439999999999998 27.04 23.595 140-144 20.715 28.244999999999997 27.644999999999996 23.395 145-149 20.62 28.389999999999997 27.810000000000002 23.18 150 19.459053343350863 28.149261207112446 27.998998246932132 24.392687202604556 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.5 19 1.0 20 0.5 21 0.5 22 0.0 23 1.0 24 3.0 25 3.0 26 4.0 27 11.5 28 13.0 29 15.5 30 24.0 31 28.0 32 40.0 33 58.5 34 63.5 35 72.0 36 102.0 37 112.0 38 123.5 39 173.0 40 198.0 41 205.5 42 243.0 43 269.0 44 278.0 45 287.0 46 269.0 47 249.5 48 220.0 49 184.5 50 157.5 51 136.0 52 108.0 53 79.0 54 71.5 55 58.5 56 41.5 57 27.0 58 15.5 59 12.5 60 13.5 61 9.5 62 6.0 63 2.5 64 1.0 65 0.5 66 1.0 67 1.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.17500000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.0875 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.32499999999999996 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.5 0.0 0.0 0.0 0.0 104-105 0.525 0.0 0.0 0.0 0.0 106-107 0.7749999999999999 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.075 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.25 0.0 0.0 0.0 0.0 116-117 1.4125 0.0 0.0 0.0 0.0 118-119 1.5 0.0 0.0 0.0 0.0 120-121 1.6125 0.0 0.0 0.0 0.0 122-123 1.7875 0.0 0.0 0.0 0.0 124-125 1.9874999999999998 0.0 0.0 0.0 0.0 126-127 2.225 0.0 0.0 0.0 0.0 128-129 2.5 0.0 0.0 0.0 0.0 130-131 2.7249999999999996 0.0 0.0 0.0 0.0 132-133 2.9125 0.0 0.0 0.0 0.0 134-135 3.2 0.0 0.0 0.0 0.0 136-137 3.4625 0.0 0.0 0.0 0.0 138 3.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031388 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031388_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78325 33.0 33.0 34.0 32.0 34.0 2 32.9335 34.0 33.0 34.0 32.0 34.0 3 32.97475 34.0 33.0 34.0 32.0 34.0 4 32.9915 34.0 33.0 34.0 32.0 34.0 5 32.97275 34.0 33.0 34.0 33.0 34.0 6 37.0715 38.0 38.0 38.0 37.0 38.0 7 37.12325 38.0 38.0 38.0 37.0 38.0 8 37.08875 38.0 38.0 38.0 37.0 38.0 9 37.11575 38.0 38.0 38.0 37.0 38.0 10-14 37.0994 38.0 38.0 38.0 37.0 38.0 15-19 37.056200000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.0634 38.0 38.0 38.0 37.0 38.0 25-29 37.07515 38.0 38.0 38.0 37.0 38.0 30-34 37.028 38.0 38.0 38.0 37.0 38.0 35-39 36.6229 38.0 38.0 38.0 36.4 38.0 40-44 36.503099999999996 38.0 38.0 38.0 36.0 38.0 45-49 36.870850000000004 38.0 38.0 38.0 36.4 38.0 50-54 36.9573 38.0 38.0 38.0 36.8 38.0 55-59 36.8697 38.0 38.0 38.0 36.0 38.0 60-64 36.887299999999996 38.0 38.0 38.0 36.2 38.0 65-69 36.823299999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.7778 38.0 38.0 38.0 36.0 38.0 75-79 36.692249999999994 38.0 38.0 38.0 36.0 38.0 80-84 35.9604 38.0 38.0 38.0 34.6 38.0 85-89 35.20215 38.0 38.0 38.0 31.4 38.0 90-94 35.40505 38.0 38.0 38.0 32.8 38.0 95-99 35.33239999999999 38.0 38.0 38.0 32.8 38.0 100-104 35.871050000000004 38.0 38.0 38.0 33.2 38.0 105-109 36.07795 38.0 38.0 38.0 34.0 38.0 110-114 36.036199999999994 38.0 38.0 38.0 34.0 38.0 115-119 35.85530000000001 38.0 38.0 38.0 33.2 38.0 120-124 35.72095 38.0 38.0 38.0 32.2 38.0 125-129 34.91665 38.0 37.2 38.0 29.8 38.0 130-134 33.6197 38.0 36.2 38.0 18.0 38.0 135-139 32.3724 38.0 33.2 38.0 7.8 38.0 140-144 32.040049999999994 38.0 33.0 38.0 3.8 38.0 145-149 31.7637 38.0 33.0 38.0 2.0 38.0 150 23.36325 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 4.0 5 0.0 6 1.0 7 7.0 8 1.0 9 2.0 10 1.0 11 2.0 12 7.0 13 6.0 14 4.0 15 10.0 16 5.0 17 11.0 18 4.0 19 4.0 20 3.0 21 5.0 22 17.0 23 33.0 24 29.0 25 20.0 26 26.0 27 38.0 28 42.0 29 42.0 30 42.0 31 60.0 32 76.0 33 112.0 34 117.0 35 221.0 36 460.0 37 2576.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.87218045112782 22.105263157894736 12.380952380952381 26.64160401002506 2 25.675675675675674 25.775775775775777 32.607607607607605 15.94094094094094 3 19.424280350438046 27.909887359198997 33.2415519399249 19.424280350438046 4 24.20525657071339 34.51814768460576 23.754693366708384 17.521902377972467 5 24.380475594493117 37.27158948685857 21.827284105131415 16.520650813516895 6 19.025 38.675 24.474999999999998 17.825 7 19.925 17.75 43.075 19.25 8 20.75 23.400000000000002 28.825 27.025 9 20.775 24.575 30.675 23.974999999999998 10-14 23.465 27.98 26.700000000000003 21.855 15-19 22.365 27.845 28.29 21.5 20-24 22.134999999999998 28.384999999999998 28.310000000000002 21.17 25-29 23.395 27.96 28.335 20.31 30-34 22.41672501750525 28.07342202660798 28.513554066219864 20.9962988896669 35-39 22.776934749620636 28.290338897319174 28.082953970662622 20.84977238239757 40-44 23.46343196467543 27.79272192051972 28.117545551438866 20.626300563365984 45-49 22.3369075057621 28.279386712095402 28.114039482914123 21.26966629922838 50-54 23.07 28.044999999999998 28.315 20.57 55-59 23.695 27.99 27.91 20.405 60-64 22.835 28.044999999999998 28.544999999999998 20.575 65-69 22.869999999999997 28.055000000000003 28.125 20.95 70-74 23.595 27.925 27.834999999999997 20.645 75-79 23.2567452570456 28.302547930119637 28.412674575762125 20.028032237072637 80-84 23.28858032569299 27.95446424013477 28.179080095972232 20.57787533820001 85-89 23.88989872760322 28.070631004933784 27.759023630225915 20.28044663723708 90-94 23.944097777319374 27.64684647516889 28.193491826104893 20.215563921406837 95-99 23.72855155356315 27.969289431648374 27.7116504354099 20.590508579378575 100-104 24.058640425745555 27.69856411286274 27.738728788030926 20.50406667336078 105-109 23.775 28.705000000000002 27.529999999999998 19.99 110-114 23.544999999999998 28.205000000000002 28.139999999999997 20.11 115-119 23.375 27.99 28.13 20.505000000000003 120-124 24.125 27.315 28.035 20.525 125-129 23.700127064803052 28.035578144853872 28.259212198221096 20.00508259212198 130-134 23.464038582512057 28.22918850912141 28.538477668274272 19.76829524009226 135-139 23.828877005347593 28.647058823529413 27.540106951871657 19.983957219251337 140-144 24.353892500396384 27.98477881718725 27.842080228317744 19.81924845409862 145-149 24.27027572972427 28.19412180587819 27.572972427027576 19.962630037369962 150 25.275827482447344 27.607823470411237 27.00601805416249 20.110330992978938 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.0 21 3.0 22 5.5 23 5.0 24 5.5 25 6.0 26 5.5 27 8.5 28 12.5 29 15.5 30 21.0 31 27.0 32 34.0 33 49.0 34 66.5 35 74.0 36 81.5 37 113.5 38 154.0 39 167.5 40 192.0 41 235.0 42 259.5 43 279.0 44 270.0 45 255.0 46 264.5 47 240.0 48 217.5 49 201.0 50 159.5 51 131.0 52 107.5 53 82.0 54 60.0 55 48.0 56 38.0 57 28.5 58 21.0 59 15.0 60 10.0 61 8.5 62 7.5 63 3.0 64 3.0 65 1.5 66 0.5 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.25 2 0.1 3 0.125 4 0.125 5 0.125 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.03 35-39 1.15 40-44 1.485 45-49 0.21 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.11499999999999999 80-84 2.0549999999999997 85-89 3.7249999999999996 90-94 3.045 95-99 2.965 100-104 0.41000000000000003 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.625 130-134 4.62 135-139 6.5 140-144 5.395 145-149 0.9900000000000001 150 0.3 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92494370778083 99.85000000000001 2 0.07505629221916438 0.15 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.075 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.16249999999999998 0.0 0.0 0.0 0.0 96-97 0.21250000000000002 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.45 0.0 0.0 0.0 0.0 104-105 0.475 0.0 0.0 0.0 0.0 106-107 0.7 0.0 0.0 0.0 0.0 108-109 0.8374999999999999 0.0 0.0 0.0 0.0 110-111 0.975 0.0 0.0 0.0 0.0 112-113 1.0625 0.0 0.0 0.0 0.0 114-115 1.15 0.0 0.0 0.0 0.0 116-117 1.3125 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.7 0.0 0.0 0.0 0.0 124-125 1.9 0.0 0.0 0.0 0.0 126-127 2.125 0.0 0.0 0.0 0.0 128-129 2.375 0.0 0.0 0.0 0.0 130-131 2.55 0.0 0.0 0.0 0.0 132-133 2.7125 0.0 0.0 0.0 0.0 134-135 3.0125 0.0 0.0 0.0 0.0 136-137 3.2375 0.0 0.0 0.0 0.0 138 3.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGCAAA 10 0.007182238 142.58751 9 GCAATAA 10 0.007182238 142.58751 5 >>END_MODULE Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132777 spots for SRR6031388.sra Written 1132777 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra Read 1132765 spots for SRR6031388.sra Written 1132765 spots for SRR6031388.sra SRR ids: ['SRR6031388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_otplzhj3 SRR6031388.sra spots: 22655312 blocks: [[1, 1132765], [1132766, 2265530], [2265531, 3398295], [3398296, 4531060], [4531061, 5663825], [5663826, 6796590], [6796591, 7929355], [7929356, 9062120], [9062121, 10194885], [10194886, 11327650], [11327651, 12460415], [12460416, 13593180], [13593181, 14725945], [14725946, 15858710], [15858711, 16991475], [16991476, 18124240], [18124241, 19257005], [19257006, 20389770], [20389771, 21522535], [21522536, 22655312]] SRR6031388 file size 7611192 SRR6031388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031388 SRR6031388_1.fastq SRR6031388_2.fastq Input file: SRR6031388_1.fastq Paired file: SRR6031388_2.fastq trimmed: SRR6031388-trimmed-pair1.fastq, SRR6031388-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:29:32 2025 >> started Fri Feb 14 07:29:58 2025 >> done (25.444s) 22655312 read pairs processed; of these: 26516 ( 0.12%) short read pairs filtered out after trimming by size control 34304 ( 0.15%) empty read pairs filtered out after trimming by size control 22594492 (99.73%) read pairs available; of these: 9895545 (43.80%) trimmed read pairs available after processing 12698947 (56.20%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 8 0.00% 20 6 0.00% 21 3 0.00% 22 11 0.00% 23 15 0.00% 24 13 0.00% 25 10 0.00% 26 15 0.00% 27 12 0.00% 28 11 0.00% 29 17 0.00% 30 24 0.00% 31 14 0.00% 32 17 0.00% 33 20 0.00% 34 15 0.00% 35 21 0.00% 36 10 0.00% 37 24 0.00% 38 26 0.00% 39 21 0.00% 40 29 0.00% 41 36 0.00% 42 39 0.00% 43 46 0.00% 44 39 0.00% 45 46 0.00% 46 46 0.00% 47 74 0.00% 48 62 0.00% 49 63 0.00% 50 60 0.00% 51 81 0.00% 52 80 0.00% 53 88 0.00% 54 107 0.00% 55 100 0.00% 56 111 0.00% 57 133 0.00% 58 133 0.00% 59 127 0.00% 60 172 0.00% 61 181 0.00% 62 213 0.00% 63 262 0.00% 64 256 0.00% 65 304 0.00% 66 377 0.00% 67 507 0.00% 68 608 0.00% 69 1460 0.01% 70 1493 0.01% 71 794 0.00% 72 719 0.00% 73 782 0.00% 74 849 0.00% 75 939 0.00% 76 993 0.00% 77 1148 0.01% 78 1238 0.01% 79 1394 0.01% 80 1497 0.01% 81 1736 0.01% 82 2028 0.01% 83 2459 0.01% 84 4205 0.02% 85 4620 0.02% 86 4804 0.02% 87 5136 0.02% 88 5360 0.02% 89 5559 0.02% 90 5970 0.03% 91 6293 0.03% 92 6832 0.03% 93 7273 0.03% 94 7965 0.04% 95 8297 0.04% 96 8902 0.04% 97 9724 0.04% 98 11362 0.05% 99 10332 0.05% 100 11073 0.05% 101 11644 0.05% 102 12497 0.06% 103 13138 0.06% 104 14137 0.06% 105 15380 0.07% 106 15985 0.07% 107 16930 0.07% 108 17899 0.08% 109 18616 0.08% 110 19046 0.08% 111 20144 0.09% 112 21177 0.09% 113 22137 0.10% 114 23197 0.10% 115 24258 0.11% 116 25660 0.11% 117 26860 0.12% 118 28437 0.13% 119 29680 0.13% 120 30671 0.14% 121 32275 0.14% 122 33541 0.15% 123 35098 0.16% 124 37250 0.16% 125 40171 0.18% 126 42464 0.19% 127 43719 0.19% 128 45742 0.20% 129 48801 0.22% 130 50928 0.23% 131 53868 0.24% 132 56579 0.25% 133 60541 0.27% 134 64934 0.29% 135 70730 0.31% 136 76763 0.34% 137 85948 0.38% 138 93891 0.42% 139 101762 0.45% 140 111882 0.50% 141 120357 0.53% 142 132448 0.59% 143 149821 0.66% 144 177149 0.78% 145 217621 0.96% 146 291067 1.29% 147 430415 1.90% 148 881610 3.90% 149 5752744 25.46% 150 12698947 56.20% 22594492 reads passed initial QC criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=38 prefix-density=0.16 prefix-fanout=2.2 sequence=TCATTATGCGTAGGCCTGAGGATTTGCAACTACGTAGGTTTCCACAGCCTTGTAAACTGCTGCAGCCTTTTCCTTGCCTTCCTTAATTTCCTCTTCCTTTATTTCAGCACCTGGTTTTGGGAAATACTTGCACACCACTTTAGTTTTGCATCCTCCTTCAGGGGTGGCCTCAAACTTCATATCATAAGCAATTGATTCAAATTTGCCCAGCAAAGGAACACCCTCAATTGTTGTGTAGCTATGAGTCAGGTTGACTTTGTCCACTGCATCAATCCTGGTCTTCGCATACTTACCTTCGGCAAAGGTCAACTTCTTGATAGTCCCAGGGCCTCCATTTCCTTTGATTGTTTCAATACTCTTCACAGCCTGCGGCACGAGCTTGGGAATGAGGGTGTCAGCCTCAAGTACCATGGCCGTGAACAACCTTTTAGCCGCGGCGGGGCTGGAGAACTCCTCAGTGAATGTGAGAACTTCCATGATTTTTTCTAAAGCAAAC criterion=fanout-score sequence-density=0.07 sequence-density-rank=8 fanout-score=494.44 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=39.4 sequence=CTTCTTCTTCCT criterion=sequence-density sequence-density=0.10 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=40 prefix-density=0.10 prefix-fanout=2.0 sequence=TCCACAGATTGCAA criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=389.71 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=24.4 sequence=AGGAAGAAGCCGAGATGGTTTCCCTCAAACTCCAAAAGCGGCTTGCAGCTAGTGTCCTAAAGTGTGGCAAAGGAAAAGTTTGGCTTGACCCGAATGAAGGCAATGAGATCTCCATGGCTAATTCACGCCAGAACATAAGGAAGCTTGTGAA SRR6031388 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:30:41 Started mapping on | Feb 14 07:30:41 Finished on | Feb 14 07:32:34 Mapping speed, Million of reads per hour | 719.82 Number of input reads | 22594492 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 21668835 Uniquely mapped reads % | 95.90% Average mapped length | 294.45 Number of splices: Total | 20761280 Number of splices: Annotated (sjdb) | 20337093 Number of splices: GT/AG | 20342359 Number of splices: GC/AG | 359915 Number of splices: AT/AC | 18665 Number of splices: Non-canonical | 40341 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.02% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 1.70 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 548181 % of reads mapped to multiple loci | 2.43% Number of reads mapped to too many loci | 47950 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.41% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 407870 407870 407870 N_multimapping 548181 548181 548181 N_noFeature 817153 21409213 955360 N_ambiguous 230355 1136 108278 UnstrandedReadsAssigned:20621327 PositiveStrandReadsAssigned:258486 NegativeStrandReadsAssigned:20605197 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031388 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031388-trimmed-pair1.fastq SRR6031388-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,594,492 reads, 20,796,644 reads pseudoaligned [quant] estimated average fragment length: 256.226 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,098 rounds 52401 SRR6031388.ke.tsv 34699 SRR6031388.se.tsv 87100 total ==> SRR6031388.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.77 833 20.9107 Potri.005G024800.1.v4.1 1035 779.774 394 22.3587 Potri.004G059700.1.v4.1 961 705.794 41 2.57055 Potri.007G009000.2.v4.1 1416 1160.77 2 0.0762433 Potri.003G141000.2.v4.1 2943 2687.77 842 13.8624 Potri.016G087400.1.v4.1 270 73.0469 2187 1324.85 Potri.015G069301.1.v4.1 564 314.742 0 0 Potri.010G195200.1.v4.1 1773 1517.77 202 5.8893 Potri.012G127500.1.v4.1 977 721.774 1435 87.9772 ==> SRR6031388.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 67 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 440 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 19 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 154 SRR6031388 completed mapping pipeline successfully