Starting /dee2/code/volunteer_pipeline.sh SRR6031389 current disk space = 3085272657920 free memory = 1470386500 SRR6031389 SRAfilesize 40f7463df0251e3ee32d9bab4bdede1a SRR6031389.sra SRR6031389.sra file validated SRR6031389 is paired end SRR6031389 is conventional basespace SRR6031389 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9415 34.0 34.0 34.0 33.0 34.0 2 33.46875 34.0 34.0 34.0 33.0 34.0 3 33.5005 34.0 34.0 34.0 33.0 34.0 4 33.52525 34.0 34.0 34.0 33.0 34.0 5 33.45775 34.0 34.0 34.0 33.0 34.0 6 37.2595 38.0 38.0 38.0 36.0 38.0 7 37.5325 38.0 38.0 38.0 37.0 38.0 8 37.62475 38.0 38.0 38.0 38.0 38.0 9 37.6285 38.0 38.0 38.0 38.0 38.0 10-14 37.53495 38.0 38.0 38.0 38.0 38.0 15-19 37.57715 38.0 38.0 38.0 38.0 38.0 20-24 37.576049999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.54785 38.0 38.0 38.0 38.0 38.0 30-34 37.51025 38.0 38.0 38.0 38.0 38.0 35-39 37.44005 38.0 38.0 38.0 37.6 38.0 40-44 37.28215 38.0 38.0 38.0 37.0 38.0 45-49 37.24605 38.0 38.0 38.0 37.0 38.0 50-54 37.24625 38.0 38.0 38.0 36.8 38.0 55-59 37.194449999999996 38.0 38.0 38.0 36.2 38.0 60-64 37.2431 38.0 38.0 38.0 36.6 38.0 65-69 37.12755 38.0 38.0 38.0 36.0 38.0 70-74 37.003949999999996 38.0 38.0 38.0 35.8 38.0 75-79 36.959700000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.874449999999996 38.0 38.0 38.0 35.8 38.0 85-89 36.7358 38.0 38.0 38.0 35.0 38.0 90-94 36.65665 38.0 38.0 38.0 35.0 38.0 95-99 36.5135 38.0 38.0 38.0 34.0 38.0 100-104 36.4567 38.0 38.0 38.0 34.0 38.0 105-109 36.272949999999994 38.0 37.8 38.0 33.8 38.0 110-114 35.94735 38.0 37.0 38.0 32.6 38.0 115-119 35.583 38.0 36.4 38.0 31.0 38.0 120-124 35.55285 38.0 36.6 38.0 30.2 38.0 125-129 35.1237 38.0 35.8 38.0 29.2 38.0 130-134 34.487750000000005 38.0 34.2 38.0 25.6 38.0 135-139 34.169 38.0 33.6 38.0 24.8 38.0 140-144 33.2162 38.0 33.0 38.0 19.8 38.0 145-149 31.5474 37.6 32.4 38.0 8.8 38.0 150 21.204 28.0 2.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 2.0 15 3.0 16 1.0 17 4.0 18 3.0 19 3.0 20 1.0 21 6.0 22 9.0 23 8.0 24 8.0 25 16.0 26 16.0 27 18.0 28 33.0 29 36.0 30 42.0 31 55.0 32 84.0 33 103.0 34 142.0 35 286.0 36 867.0 37 2251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.18695873662761 12.862964849719816 10.901681100356598 35.04839531329598 2 22.900000000000002 16.175 34.125 26.8 3 19.45 22.075 27.875 30.599999999999998 4 22.425 30.15 23.225 24.2 5 21.2531328320802 35.21303258145363 24.786967418546364 18.746867167919802 6 17.125 35.325 25.825 21.725 7 13.450000000000001 25.474999999999998 44.324999999999996 16.75 8 16.1 23.825 32.975 27.1 9 16.6 24.349999999999998 33.975 25.074999999999996 10-14 19.185 30.520000000000003 27.544999999999998 22.75 15-19 19.634999999999998 29.26 28.28 22.825 20-24 19.220000000000002 29.044999999999998 28.494999999999997 23.24 25-29 19.245 29.37 28.07 23.315 30-34 18.93 28.884999999999998 28.17 24.015 35-39 19.595000000000002 29.2 27.54 23.665 40-44 19.195 29.409999999999997 28.03 23.365 45-49 19.265 29.32 27.73 23.685000000000002 50-54 18.925 29.94 27.665 23.47 55-59 19.55 29.195 27.6 23.655 60-64 19.415 29.285 27.49 23.810000000000002 65-69 19.259999999999998 28.815 27.93 23.995 70-74 19.35 29.020000000000003 28.355000000000004 23.275000000000002 75-79 19.28 29.235 27.860000000000003 23.625 80-84 19.02 28.895 27.715 24.37 85-89 19.125 29.28 27.905 23.69 90-94 19.02 28.68 28.535 23.765 95-99 19.11 28.37 28.499999999999996 24.02 100-104 19.905 28.68 28.27 23.145 105-109 19.66 29.5 27.58 23.26 110-114 19.205 29.17 28.335 23.29 115-119 19.1 28.970000000000002 28.544999999999998 23.385 120-124 19.509999999999998 28.605000000000004 28.515 23.369999999999997 125-129 19.82 28.299999999999997 27.834999999999997 24.044999999999998 130-134 19.84 28.765 27.779999999999998 23.615 135-139 19.634999999999998 29.509999999999998 27.650000000000002 23.205000000000002 140-144 19.525000000000002 28.765 28.08 23.630000000000003 145-149 20.135 28.689999999999998 27.435 23.74 150 18.546365914786968 27.89473684210526 28.270676691729324 25.288220551378448 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 1.0 6 1.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 3.5 23 4.0 24 4.0 25 7.5 26 8.0 27 8.0 28 15.5 29 21.0 30 24.5 31 35.5 32 47.5 33 58.5 34 79.0 35 96.5 36 106.5 37 123.0 38 145.5 39 182.0 40 204.0 41 228.0 42 269.0 43 258.0 44 247.5 45 249.5 46 248.0 47 245.5 48 217.0 49 178.5 50 150.5 51 119.0 52 84.5 53 75.0 54 61.0 55 46.0 56 37.0 57 27.0 58 19.0 59 14.5 60 12.5 61 8.5 62 6.0 63 4.5 64 2.5 65 1.5 66 1.5 67 1.5 68 1.5 69 1.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.8499999999999999 2 0.0 3 0.0 4 0.0 5 0.25 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.037500000000000006 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.0625 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.1125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4375 0.0 0.0 0.0 0.0 112-113 0.5375 0.0 0.0 0.0 0.0 114-115 0.7 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.8625 0.0 0.0 0.0 0.0 120-121 0.925 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.0750000000000002 0.0 0.0 0.0 0.0 126-127 1.1625 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.4125 0.0 0.0 0.0 0.0 132-133 1.525 0.0 0.0 0.0 0.0 134-135 1.6875 0.0 0.0 0.0 0.0 136-137 1.85 0.0 0.0 0.0 0.0 138 1.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCACTG 10 0.006973645 144.0 2 >>END_MODULE SRR6031389 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031389_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.62325 33.0 33.0 34.0 32.0 34.0 2 32.845 34.0 33.0 34.0 32.0 34.0 3 32.84175 34.0 33.0 34.0 32.0 34.0 4 32.826 34.0 33.0 34.0 32.0 34.0 5 32.75875 34.0 33.0 34.0 32.0 34.0 6 36.93825 38.0 38.0 38.0 36.0 38.0 7 37.04825 38.0 38.0 38.0 37.0 38.0 8 37.0285 38.0 38.0 38.0 37.0 38.0 9 36.96125 38.0 38.0 38.0 37.0 38.0 10-14 36.93535 38.0 38.0 38.0 36.8 38.0 15-19 36.892900000000004 38.0 38.0 38.0 37.0 38.0 20-24 36.955200000000005 38.0 38.0 38.0 37.0 38.0 25-29 36.9056 38.0 38.0 38.0 37.0 38.0 30-34 36.9398 38.0 38.0 38.0 37.0 38.0 35-39 36.564 38.0 38.0 38.0 36.4 38.0 40-44 36.39105 38.0 38.0 38.0 36.0 38.0 45-49 36.727050000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.83145 38.0 38.0 38.0 36.0 38.0 55-59 36.77565 38.0 38.0 38.0 36.2 38.0 60-64 36.75285 38.0 38.0 38.0 36.0 38.0 65-69 36.66844999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.588849999999994 38.0 38.0 38.0 35.8 38.0 75-79 36.544399999999996 38.0 38.0 38.0 35.8 38.0 80-84 35.92545 38.0 38.0 38.0 34.4 38.0 85-89 35.2436 38.0 38.0 38.0 32.0 38.0 90-94 35.3487 38.0 38.0 38.0 32.2 38.0 95-99 35.331599999999995 38.0 38.0 38.0 32.8 38.0 100-104 35.8591 38.0 38.0 38.0 33.4 38.0 105-109 35.90875 38.0 38.0 38.0 33.4 38.0 110-114 35.8891 38.0 38.0 38.0 33.6 38.0 115-119 35.7152 38.0 38.0 38.0 33.2 38.0 120-124 35.45175 38.0 37.4 38.0 31.4 38.0 125-129 34.705799999999996 38.0 37.0 38.0 28.6 38.0 130-134 33.376999999999995 38.0 35.6 38.0 16.4 38.0 135-139 32.346000000000004 38.0 33.4 38.0 5.6 38.0 140-144 31.879650000000005 38.0 33.0 38.0 2.0 38.0 145-149 31.49235 38.0 33.0 38.0 2.0 38.0 150 22.9635 30.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 15.0 3 8.0 4 2.0 5 1.0 6 4.0 7 4.0 8 1.0 9 3.0 10 1.0 11 3.0 12 5.0 13 3.0 14 3.0 15 6.0 16 9.0 17 8.0 18 4.0 19 6.0 20 9.0 21 15.0 22 19.0 23 30.0 24 27.0 25 27.0 26 20.0 27 50.0 28 32.0 29 43.0 30 37.0 31 63.0 32 90.0 33 110.0 34 106.0 35 214.0 36 455.0 37 2567.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.43803311590567 21.77621675865529 13.973908680381333 24.811841445057702 2 26.926926926926924 25.325325325325327 32.05705705705706 15.69069069069069 3 20.090180360721444 26.65330661322645 33.967935871743485 19.288577154308616 4 24.080100125156445 34.267834793491865 23.9549436795995 17.69712140175219 5 24.567993989481593 37.51565239168545 22.739794640621085 15.17655897821187 6 20.424999999999997 35.75 25.55 18.275 7 19.05 20.025000000000002 41.525 19.400000000000002 8 21.45 24.325 29.275000000000002 24.95 9 21.175 25.074999999999996 32.25 21.5 10-14 23.01 29.49 26.784999999999997 20.715 15-19 23.294999999999998 28.065 28.77 19.869999999999997 20-24 23.28 29.354999999999997 27.889999999999997 19.475 25-29 23.79 28.33 28.095 19.785 30-34 23.408192867503626 27.794728154854198 28.98514480068024 19.811934176961937 35-39 23.292442829017112 28.214447978191732 28.436569236205766 20.05653995658539 40-44 23.060181201599434 29.012501898061448 27.893911018879386 20.033405881459736 45-49 23.86318108974359 27.428886217948715 28.585737179487182 20.12219551282051 50-54 23.085 28.725 28.505000000000003 19.685 55-59 22.925 28.410000000000004 28.51 20.155 60-64 23.625 28.050000000000004 28.605000000000004 19.72 65-69 23.22 27.965 28.854999999999997 19.96 70-74 22.79 28.435 28.705000000000002 20.07 75-79 23.876263890279308 27.890679747722498 28.276103714085494 19.956952647912704 80-84 23.55006105006105 27.966015466015463 28.088115588115585 20.395807895807895 85-89 23.66092221704704 27.80106608704653 28.184029395021476 20.353982300884958 90-94 23.497071215702395 28.527386702291647 28.316719761586683 19.65882232041928 95-99 23.268954181220465 28.010067803575094 29.145264023012125 19.575713992192316 100-104 23.65132734480855 28.41371004165203 28.16781251568224 19.76715009785718 105-109 23.575 27.61 29.175 19.64 110-114 23.94 28.48 28.299999999999997 19.28 115-119 23.635 28.044999999999998 28.465 19.855 120-124 23.25 28.375 28.67 19.705000000000002 125-129 24.131460161282142 27.757772480600494 28.711264391134556 19.39950296698281 130-134 23.769721032285027 28.25201128408735 28.382614146902103 19.595653536725525 135-139 23.457774941501807 28.541799617102743 28.12699425654116 19.873431184854287 140-144 24.007362608467 28.39863265842756 27.87273205364186 19.72127267946358 145-149 23.715135925757806 27.71977606294447 28.56710546224845 19.997982549049276 150 24.792557203922556 27.60875031430727 28.438521498617046 19.16017098315313 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.5 18 3.0 19 3.5 20 2.5 21 2.5 22 5.5 23 6.0 24 5.0 25 9.5 26 10.5 27 11.5 28 16.5 29 17.5 30 26.0 31 34.0 32 42.0 33 54.5 34 66.0 35 82.0 36 99.0 37 127.5 38 152.5 39 185.0 40 217.5 41 234.0 42 245.5 43 272.5 44 275.0 45 259.0 46 275.5 47 253.0 48 190.5 49 154.5 50 139.0 51 107.0 52 84.5 53 73.5 54 62.0 55 42.5 56 28.5 57 29.0 58 21.0 59 19.0 60 17.0 61 7.5 62 5.0 63 6.0 64 3.5 65 2.0 66 2.0 67 2.5 68 1.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.35000000000000003 2 0.1 3 0.2 4 0.125 5 0.17500000000000002 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.034999999999999996 35-39 0.955 40-44 1.2149999999999999 45-49 0.16 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.11 80-84 1.72 85-89 3.385 90-94 2.69 95-99 2.6599999999999997 100-104 0.365 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.415 130-134 4.29 135-139 5.9799999999999995 140-144 4.925 145-149 0.865 150 0.575 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64850615114236 99.225 2 0.2761737383881496 0.5499999999999999 3 0.07532011046949535 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.0875 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.16249999999999998 0.0 0.0 0.0 0.0 102-103 0.175 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2625 0.0 0.0 0.0 0.0 108-109 0.3 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.6625000000000001 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.8625 0.0 0.0 0.0 0.0 124-125 0.9375 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.2875 0.0 0.0 0.0 0.0 132-133 1.4 0.0 0.0 0.0 0.0 134-135 1.575 0.0 0.0 0.0 0.0 136-137 1.7375 0.0 0.0 0.0 0.0 138 1.8 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATC 10 0.0072371103 142.22499 2 AAAACAT 10 0.0072371103 142.22499 1 >>END_MODULE Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058602 spots for SRR6031389.sra Written 1058602 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra Read 1058595 spots for SRR6031389.sra Written 1058595 spots for SRR6031389.sra SRR ids: ['SRR6031389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_03t1vrfy SRR6031389.sra spots: 21171907 blocks: [[1, 1058595], [1058596, 2117190], [2117191, 3175785], [3175786, 4234380], [4234381, 5292975], [5292976, 6351570], [6351571, 7410165], [7410166, 8468760], [8468761, 9527355], [9527356, 10585950], [10585951, 11644545], [11644546, 12703140], [12703141, 13761735], [13761736, 14820330], [14820331, 15878925], [15878926, 16937520], [16937521, 17996115], [17996116, 19054710], [19054711, 20113305], [20113306, 21171907]] SRR6031389 file size 7111412 SRR6031389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031389 SRR6031389_1.fastq SRR6031389_2.fastq Input file: SRR6031389_1.fastq Paired file: SRR6031389_2.fastq trimmed: SRR6031389-trimmed-pair1.fastq, SRR6031389-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:37:25 2025 >> started Fri Feb 14 06:37:50 2025 >> done (25.063s) 21171907 read pairs processed; of these: 28866 ( 0.14%) short read pairs filtered out after trimming by size control 40551 ( 0.19%) empty read pairs filtered out after trimming by size control 21102490 (99.67%) read pairs available; of these: 11549917 (54.73%) trimmed read pairs available after processing 9552573 (45.27%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 10 0.00% 20 4 0.00% 21 10 0.00% 22 13 0.00% 23 16 0.00% 24 14 0.00% 25 18 0.00% 26 12 0.00% 27 12 0.00% 28 15 0.00% 29 17 0.00% 30 20 0.00% 31 18 0.00% 32 22 0.00% 33 37 0.00% 34 23 0.00% 35 27 0.00% 36 34 0.00% 37 33 0.00% 38 45 0.00% 39 47 0.00% 40 47 0.00% 41 61 0.00% 42 64 0.00% 43 65 0.00% 44 90 0.00% 45 96 0.00% 46 87 0.00% 47 112 0.00% 48 103 0.00% 49 132 0.00% 50 143 0.00% 51 123 0.00% 52 147 0.00% 53 140 0.00% 54 149 0.00% 55 165 0.00% 56 176 0.00% 57 172 0.00% 58 201 0.00% 59 214 0.00% 60 256 0.00% 61 239 0.00% 62 285 0.00% 63 315 0.00% 64 329 0.00% 65 358 0.00% 66 473 0.00% 67 621 0.00% 68 745 0.00% 69 1487 0.01% 70 1515 0.01% 71 955 0.00% 72 857 0.00% 73 784 0.00% 74 846 0.00% 75 930 0.00% 76 924 0.00% 77 1019 0.00% 78 1100 0.01% 79 1176 0.01% 80 1331 0.01% 81 1580 0.01% 82 1761 0.01% 83 2321 0.01% 84 3879 0.02% 85 4130 0.02% 86 4393 0.02% 87 4767 0.02% 88 4801 0.02% 89 5155 0.02% 90 5184 0.02% 91 5435 0.03% 92 5735 0.03% 93 6036 0.03% 94 6354 0.03% 95 6833 0.03% 96 7290 0.03% 97 7817 0.04% 98 8537 0.04% 99 8395 0.04% 100 8685 0.04% 101 9256 0.04% 102 9845 0.05% 103 10566 0.05% 104 11304 0.05% 105 11901 0.06% 106 12639 0.06% 107 13200 0.06% 108 13943 0.07% 109 14436 0.07% 110 14817 0.07% 111 15569 0.07% 112 16527 0.08% 113 17322 0.08% 114 18248 0.09% 115 19127 0.09% 116 20080 0.10% 117 21170 0.10% 118 22106 0.10% 119 23519 0.11% 120 24343 0.12% 121 26039 0.12% 122 27402 0.13% 123 29669 0.14% 124 32137 0.15% 125 34320 0.16% 126 37176 0.18% 127 39109 0.19% 128 41821 0.20% 129 45464 0.22% 130 48935 0.23% 131 53497 0.25% 132 58317 0.28% 133 64775 0.31% 134 71412 0.34% 135 80283 0.38% 136 91852 0.44% 137 105029 0.50% 138 117998 0.56% 139 131572 0.62% 140 148889 0.71% 141 163998 0.78% 142 185835 0.88% 143 218037 1.03% 144 265802 1.26% 145 342248 1.62% 146 463941 2.20% 147 679019 3.22% 148 1333987 6.32% 149 6162864 29.20% 150 9552573 45.27% 21102490 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.63 fanout-score-rank=21 prefix-density=0.31 prefix-fanout=2.2 sequence=CCGCACTTGCAGCC criterion=fanout-score sequence-density=0.06 sequence-density-rank=28 fanout-score=450.40 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=30.4 sequence=TCATCATCACCACCATCACCATCCCTGATTGATCTTTGATTCACAACAAGACCAACCAACCGTACAATGTTTACATAACTTGGGATAATCTCACAAGAAAGAAAGATCAATACAAAACTAGTCAGCTCAGGATGTTCCAGGCACGGTAGAACCGTAGAACCATAACAACAAGAGACATATTGCAGATGAGTACTGAAAAACAAAACACAGTACGTATTTACATGGGCAACCTTGGTTGAAGGCAACCTCATCAACGATGCTCGCTCTTCGTCTCTCCACTGTACATCCAGTCATAGACAGTGGGTGTGTTAGGCTGTGGCTTGTCAAAAACATGAGCACCAATATTCTTAGTAGCAAGGTTGCTACCAGGGTGGAACACGCTCCTCCAAACATTGCTACGCGCCGACACTGGGGTTGTAGGGGTCACTGGTGTCGTCGGTGTCCCTGGAGTTCCTGGCATAGTCATGGACCTCTGAAACTTATTAACAGGACTGCTCCCCTCTCCGACGTC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=7.71 fanout-score-rank=15 prefix-density=0.61 prefix-fanout=2.1 sequence=GGCTGCAAGTGTGGAGCCAACTGTACCTGCGATCCTTGCACTTGTAAATGAGAGCGATCCGCTGGCTGCGTTGATTCAAGAAATGATCATCGCATCGACGGATTGACAAGAAATAATATTTCATCTACTAGGCGTTTATAAGGGTTGTCTCTTGTCTTCAACAAGTTTCAATAAAGTAGCTAGTATATATTCATGGCTTGTTTTCTGCAAATCTTCTTGGATTTGCAGCTCTGGGGCTTCCTCTCTAGTATCAAGTATCAAGTCTCAAGTCGTGTTAGCTGCTTGTCGTCCTGTTTATCTT criterion=fanout-score sequence-density=0.07 sequence-density-rank=15 fanout-score=484.96 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=33.6 sequence=AAGAAGAAGAATGA SRR6031389 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:38:34 Started mapping on | Feb 14 06:38:35 Finished on | Feb 14 06:40:40 Mapping speed, Million of reads per hour | 607.75 Number of input reads | 21102490 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 20258389 Uniquely mapped reads % | 96.00% Average mapped length | 294.02 Number of splices: Total | 19468007 Number of splices: Annotated (sjdb) | 18807437 Number of splices: GT/AG | 19118662 Number of splices: GC/AG | 290202 Number of splices: AT/AC | 16916 Number of splices: Non-canonical | 42227 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 3.20 Insertion rate per base | 0.02% Insertion average length | 1.69 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 378645 % of reads mapped to multiple loci | 1.79% Number of reads mapped to too many loci | 44089 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.94% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 497893 497893 497893 N_multimapping 378645 378645 378645 N_noFeature 1071963 19989224 1210330 N_ambiguous 228003 1327 96625 UnstrandedReadsAssigned:18958423 PositiveStrandReadsAssigned:267838 NegativeStrandReadsAssigned:18951434 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=148 echo kmer=143 SRR6031389 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031389-trimmed-pair1.fastq SRR6031389-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,102,490 reads, 18,991,158 reads pseudoaligned [quant] estimated average fragment length: 276.58 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR6031389.ke.tsv 34699 SRR6031389.se.tsv 87100 total ==> SRR6031389.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.42 636 17.2468 Potri.005G024800.1.v4.1 1035 759.42 457 28.434 Potri.004G059700.1.v4.1 961 685.517 20 1.37853 Potri.007G009000.2.v4.1 1416 1140.42 0 0 Potri.003G141000.2.v4.1 2943 2667.42 968.707 17.1595 Potri.016G087400.1.v4.1 270 65.4824 1569 1132.14 Potri.015G069301.1.v4.1 564 297.804 0 0 Potri.010G195200.1.v4.1 1773 1497.42 357.923 11.294 Potri.012G127500.1.v4.1 977 701.455 10234 689.365 ==> SRR6031389.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 0 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 240 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 125 SRR6031389 completed mapping pipeline successfully