Starting /dee2/code/volunteer_pipeline.sh SRR6031390 current disk space = 3085182066688 free memory = 1484506376 SRR6031390 SRAfilesize 5da200589cdf35f2def6ea2a83d854d8 SRR6031390.sra SRR6031390.sra file validated SRR6031390 is paired end SRR6031390 is conventional basespace SRR6031390 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031390_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6055 34.0 33.0 34.0 32.0 34.0 2 33.20375 34.0 33.0 34.0 32.0 34.0 3 33.27025 34.0 33.0 34.0 32.0 34.0 4 33.3035 34.0 33.0 34.0 33.0 34.0 5 33.21875 34.0 33.0 34.0 33.0 34.0 6 36.94625 38.0 38.0 38.0 36.0 38.0 7 37.29275 38.0 38.0 38.0 37.0 38.0 8 37.3645 38.0 38.0 38.0 37.0 38.0 9 37.48725 38.0 38.0 38.0 37.0 38.0 10-14 37.4368 38.0 38.0 38.0 37.0 38.0 15-19 37.388799999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.35980000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.32785 38.0 38.0 38.0 37.0 38.0 30-34 37.282050000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.221050000000005 38.0 38.0 38.0 36.6 38.0 40-44 37.038149999999995 38.0 38.0 38.0 36.0 38.0 45-49 36.91695 38.0 38.0 38.0 35.6 38.0 50-54 36.882099999999994 38.0 38.0 38.0 35.2 38.0 55-59 36.774 38.0 38.0 38.0 35.2 38.0 60-64 36.761849999999995 38.0 38.0 38.0 35.0 38.0 65-69 36.8061 38.0 38.0 38.0 35.0 38.0 70-74 36.709950000000006 38.0 38.0 38.0 34.8 38.0 75-79 36.6005 38.0 38.0 38.0 34.2 38.0 80-84 36.56015 38.0 38.0 38.0 34.0 38.0 85-89 36.476099999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.38719999999999 38.0 38.0 38.0 34.0 38.0 95-99 36.259249999999994 38.0 37.6 38.0 33.8 38.0 100-104 36.237 38.0 37.2 38.0 33.6 38.0 105-109 35.999399999999994 38.0 37.0 38.0 32.4 38.0 110-114 35.883750000000006 38.0 37.0 38.0 31.8 38.0 115-119 35.679 38.0 37.0 38.0 31.0 38.0 120-124 35.398 38.0 36.2 38.0 30.0 38.0 125-129 35.1172 38.0 36.0 38.0 28.2 38.0 130-134 34.7342 38.0 35.2 38.0 27.2 38.0 135-139 34.40905 38.0 34.4 38.0 25.6 38.0 140-144 33.90815 38.0 33.2 38.0 23.2 38.0 145-149 32.896750000000004 38.0 33.0 38.0 14.8 38.0 150 25.63875 33.0 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 5.0 18 4.0 19 3.0 20 4.0 21 2.0 22 9.0 23 9.0 24 14.0 25 18.0 26 25.0 27 36.0 28 37.0 29 55.0 30 39.0 31 72.0 32 79.0 33 109.0 34 166.0 35 305.0 36 616.0 37 2388.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.483986676915194 13.861132462208559 8.480655905713554 40.1742249551627 2 20.65 18.75 36.725 23.875 3 18.65 24.15 26.55 30.65 4 21.75 31.7 23.925 22.625 5 20.51282051282051 35.49522373051785 24.63549522373052 19.356460532931123 6 16.8 35.5 26.724999999999998 20.974999999999998 7 13.825000000000001 21.95 45.125 19.1 8 16.675 22.85 32.550000000000004 27.925 9 17.275 22.925 34.225 25.575 10-14 19.33 29.56 27.57 23.54 15-19 19.455 28.060000000000002 28.54 23.945 20-24 19.325 28.375 28.37 23.93 25-29 19.37 28.660000000000004 28.65 23.32 30-34 19.585 29.080000000000002 27.650000000000002 23.685000000000002 35-39 19.265 28.88 27.93 23.925 40-44 20.105 28.994999999999997 27.52 23.380000000000003 45-49 19.38 29.494999999999997 27.825 23.3 50-54 19.634999999999998 28.53 27.66 24.175 55-59 19.64 28.815 27.615000000000002 23.93 60-64 19.865 28.970000000000002 27.42 23.745 65-69 19.305 28.785 27.875 24.035 70-74 19.015 28.849999999999998 28.084999999999997 24.05 75-79 19.85 29.255 26.945000000000004 23.95 80-84 19.485 28.549999999999997 28.355000000000004 23.61 85-89 20.005 28.165000000000003 28.265 23.565 90-94 19.075 28.215 28.215 24.495 95-99 19.485 28.815 27.485 24.215 100-104 19.48 28.555000000000003 28.075 23.89 105-109 19.580000000000002 29.07 27.994999999999997 23.355 110-114 19.88 28.76 27.32 24.04 115-119 19.74 28.63 27.96 23.669999999999998 120-124 19.53 29.310000000000002 27.625 23.535 125-129 20.315 28.88 27.345000000000002 23.46 130-134 20.150000000000002 28.389999999999997 28.199999999999996 23.26 135-139 19.830000000000002 28.810000000000002 27.665 23.695 140-144 20.105 28.22 27.825 23.849999999999998 145-149 20.175 28.294999999999998 27.994999999999997 23.535 150 19.44723618090452 27.311557788944725 28.316582914572862 24.92462311557789 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 5.0 23 5.0 24 3.0 25 3.0 26 3.5 27 8.0 28 11.0 29 13.0 30 21.0 31 24.5 32 35.0 33 53.0 34 61.0 35 70.5 36 94.5 37 130.0 38 151.0 39 173.0 40 209.0 41 230.0 42 249.5 43 267.0 44 276.0 45 275.5 46 257.0 47 241.0 48 213.0 49 181.5 50 163.5 51 130.0 52 104.5 53 84.5 54 59.5 55 45.5 56 35.5 57 29.0 58 20.0 59 14.0 60 11.5 61 8.0 62 5.5 63 3.5 64 4.0 65 3.0 66 1.5 67 1.5 68 0.0 69 1.5 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.5499999999999999 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.5 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.1875 0.0 0.0 0.0 0.0 118-119 0.21250000000000002 0.0 0.0 0.0 0.0 120-121 0.225 0.0 0.0 0.0 0.0 122-123 0.2375 0.0 0.0 0.0 0.0 124-125 0.35 0.0 0.0 0.0 0.0 126-127 0.375 0.0 0.0 0.0 0.0 128-129 0.425 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.5125 0.0 0.0 0.0 0.0 134-135 0.5625 0.0 0.0 0.0 0.0 136-137 0.6375 0.0 0.0 0.0 0.0 138 0.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTGAGAG 10 0.0069754543 143.9875 9 TGTACAA 10 0.0069754543 143.9875 7 ACAACCT 10 0.0069754543 143.9875 4 >>END_MODULE SRR6031390 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031390_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.445 33.0 33.0 34.0 31.0 34.0 2 32.76025 33.0 33.0 34.0 32.0 34.0 3 32.81675 33.0 33.0 34.0 32.0 34.0 4 32.71 33.0 33.0 34.0 32.0 34.0 5 32.79225 33.0 33.0 34.0 32.0 34.0 6 36.886 38.0 38.0 38.0 36.0 38.0 7 37.03475 38.0 38.0 38.0 36.0 38.0 8 37.03375 38.0 38.0 38.0 36.0 38.0 9 37.0355 38.0 38.0 38.0 36.0 38.0 10-14 36.900099999999995 38.0 38.0 38.0 36.0 38.0 15-19 36.856849999999994 38.0 38.0 38.0 36.0 38.0 20-24 36.9011 38.0 38.0 38.0 36.0 38.0 25-29 36.86465 38.0 38.0 38.0 36.0 38.0 30-34 36.8857 38.0 38.0 38.0 36.0 38.0 35-39 36.4713 38.0 38.0 38.0 35.4 38.0 40-44 36.305400000000006 38.0 38.0 38.0 34.8 38.0 45-49 36.66275 38.0 38.0 38.0 35.2 38.0 50-54 36.743249999999996 38.0 38.0 38.0 35.8 38.0 55-59 36.684099999999994 38.0 38.0 38.0 35.0 38.0 60-64 36.65665 38.0 38.0 38.0 35.0 38.0 65-69 36.6037 38.0 38.0 38.0 35.0 38.0 70-74 36.5235 38.0 38.0 38.0 34.8 38.0 75-79 36.40155 38.0 38.0 38.0 34.4 38.0 80-84 35.672450000000005 38.0 38.0 38.0 33.4 38.0 85-89 34.90115 38.0 38.0 38.0 29.0 38.0 90-94 35.025800000000004 38.0 37.4 38.0 28.8 38.0 95-99 34.89275 38.0 37.4 38.0 28.4 38.0 100-104 35.468050000000005 38.0 37.0 38.0 29.0 38.0 105-109 35.78235 38.0 37.4 38.0 32.6 38.0 110-114 35.61735 38.0 37.2 38.0 31.4 38.0 115-119 35.33390000000001 38.0 37.0 38.0 30.0 38.0 120-124 35.09665 38.0 36.6 38.0 28.8 38.0 125-129 34.31465000000001 38.0 36.0 38.0 24.4 38.0 130-134 32.98665 38.0 34.0 38.0 15.0 38.0 135-139 31.958299999999998 38.0 33.0 38.0 6.4 38.0 140-144 31.733050000000002 38.0 33.0 38.0 2.0 38.0 145-149 30.91085 38.0 33.0 38.0 2.0 38.0 150 23.329 31.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 1.0 5 3.0 6 2.0 7 1.0 8 0.0 9 1.0 10 5.0 11 2.0 12 2.0 13 7.0 14 4.0 15 1.0 16 7.0 17 8.0 18 4.0 19 15.0 20 8.0 21 17.0 22 27.0 23 34.0 24 27.0 25 39.0 26 42.0 27 42.0 28 54.0 29 56.0 30 62.0 31 81.0 32 92.0 33 153.0 34 133.0 35 224.0 36 469.0 37 2370.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.8412221387428 19.434009516654143 13.097921362384172 29.626846982218886 2 24.675 27.200000000000003 33.7 14.424999999999999 3 20.65 28.575 30.525000000000002 20.25 4 24.224999999999998 35.5 22.325 17.95 5 24.7 38.35 22.075 14.875 6 18.775 39.225 23.95 18.05 7 18.725 18.025 43.025000000000006 20.225 8 20.5 23.974999999999998 29.325000000000003 26.200000000000003 9 21.375 25.525 30.125 22.975 10-14 23.105 29.2 26.63 21.065 15-19 23.215 28.54 27.66 20.585 20-24 22.575 28.475 28.660000000000004 20.29 25-29 22.830000000000002 28.705000000000002 28.23 20.235 30-34 22.681804541362407 28.388516554966493 28.628588576572973 20.30109032709813 35-39 22.664036019628675 28.2794556584206 28.360398644204988 20.69610967774574 40-44 22.89352204129255 27.768477654339772 28.504032871709022 20.83396743265865 45-49 22.45327454026156 28.21065290374305 28.516310066643285 20.819762489352104 50-54 22.96 28.105000000000004 28.310000000000002 20.625 55-59 22.435 28.299999999999997 28.705000000000002 20.560000000000002 60-64 22.93 27.834999999999997 28.794999999999998 20.44 65-69 23.54 27.99 28.310000000000002 20.16 70-74 23.189999999999998 28.075 28.065 20.669999999999998 75-79 23.02374511571987 27.45716862037872 29.23554754032662 20.283538723574793 80-84 23.587023056519076 27.647418894103243 28.188124872475008 20.577433176902673 85-89 23.28295987493486 28.118811881188122 28.389786347055757 20.20844189682126 90-94 23.443790647259213 27.573036027665943 28.822132755238982 20.161040569835862 95-99 23.189155629139073 27.58174668874172 28.84416390728477 20.384933774834437 100-104 23.474674312157337 27.458377345203967 28.766158643931394 20.30078969870731 105-109 23.085 27.939999999999998 28.78 20.195 110-114 23.135 28.389999999999997 28.215 20.26 115-119 23.48 28.110000000000003 27.975 20.435 120-124 23.380000000000003 28.475 28.134999999999998 20.01 125-129 23.36472384830746 28.231102061593283 28.648511071519472 19.755663018579792 130-134 23.432741783051558 28.236900136511604 28.525674682348 19.804683398088837 135-139 23.961233668879846 27.832512315270936 28.6463910901692 19.559862925680015 140-144 23.797414706505617 27.73892773892774 28.77198559016741 19.691671964399237 145-149 23.904241319971657 28.120255086547218 28.20123494280798 19.774268650673147 150 24.32911392405063 27.417721518987342 29.16455696202532 19.08860759493671 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 2.0 18 2.0 19 2.5 20 2.5 21 3.0 22 4.5 23 3.5 24 5.5 25 8.0 26 9.5 27 13.0 28 19.0 29 20.5 30 22.0 31 29.5 32 34.5 33 54.0 34 67.0 35 80.5 36 100.5 37 109.5 38 139.0 39 186.5 40 220.5 41 236.0 42 255.5 43 267.5 44 267.5 45 275.5 46 275.0 47 238.0 48 206.5 49 186.0 50 145.0 51 121.5 52 99.5 53 67.0 54 48.0 55 36.0 56 29.5 57 24.0 58 18.0 59 14.5 60 11.0 61 8.5 62 7.5 63 5.0 64 5.0 65 4.5 66 2.0 67 1.5 68 2.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.17500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.03 35-39 1.165 40-44 1.435 45-49 0.215 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.19 80-84 1.9800000000000002 85-89 4.05 90-94 3.1300000000000003 95-99 3.36 100-104 0.5950000000000001 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.775 130-134 4.77 135-139 6.619999999999999 140-144 5.62 145-149 1.21 150 1.25 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72417251755266 99.425 2 0.25075225677031093 0.5 3 0.025075225677031094 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.037500000000000006 0.0 0.0 0.0 0.0 92-93 0.05 0.0 0.0 0.0 0.0 94-95 0.05 0.0 0.0 0.0 0.0 96-97 0.05 0.0 0.0 0.0 0.0 98-99 0.05 0.0 0.0 0.0 0.0 100-101 0.05 0.0 0.0 0.0 0.0 102-103 0.075 0.0 0.0 0.0 0.0 104-105 0.125 0.0 0.0 0.0 0.0 106-107 0.125 0.0 0.0 0.0 0.0 108-109 0.15 0.0 0.0 0.0 0.0 110-111 0.15 0.0 0.0 0.0 0.0 112-113 0.15 0.0 0.0 0.0 0.0 114-115 0.15 0.0 0.0 0.0 0.0 116-117 0.1875 0.0 0.0 0.0 0.0 118-119 0.21250000000000002 0.0 0.0 0.0 0.0 120-121 0.2375 0.0 0.0 0.0 0.0 122-123 0.2625 0.0 0.0 0.0 0.0 124-125 0.375 0.0 0.0 0.0 0.0 126-127 0.4 0.0 0.0 0.0 0.0 128-129 0.425 0.0 0.0 0.0 0.0 130-131 0.475 0.0 0.0 0.0 0.0 132-133 0.5125 0.0 0.0 0.0 0.0 134-135 0.575 0.0 0.0 0.0 0.0 136-137 0.6625000000000001 0.0 0.0 0.0 0.0 138 0.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATTCA 10 0.007250439 142.1375 3 GGTTATG 10 0.007250439 142.1375 6 AGGTTAT 10 0.007250439 142.1375 5 TCTTTTC 10 0.007250439 142.1375 3 TTTATTC 10 0.007250439 142.1375 2 CCCCCCC 20 0.006150597 28.787342 30-34 >>END_MODULE Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114282 spots for SRR6031390.sra Written 1114282 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra Read 1114280 spots for SRR6031390.sra Written 1114280 spots for SRR6031390.sra SRR ids: ['SRR6031390.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g6y_1s0z SRR6031390.sra spots: 22285602 blocks: [[1, 1114280], [1114281, 2228560], [2228561, 3342840], [3342841, 4457120], [4457121, 5571400], [5571401, 6685680], [6685681, 7799960], [7799961, 8914240], [8914241, 10028520], [10028521, 11142800], [11142801, 12257080], [12257081, 13371360], [13371361, 14485640], [14485641, 15599920], [15599921, 16714200], [16714201, 17828480], [17828481, 18942760], [18942761, 20057040], [20057041, 21171320], [21171321, 22285602]] SRR6031390 file size 7486632 SRR6031390 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031390 SRR6031390_1.fastq SRR6031390_2.fastq Input file: SRR6031390_1.fastq Paired file: SRR6031390_2.fastq trimmed: SRR6031390-trimmed-pair1.fastq, SRR6031390-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:37:33 2025 >> started Fri Feb 14 06:37:58 2025 >> done (24.815s) 22285602 read pairs processed; of these: 25080 ( 0.11%) short read pairs filtered out after trimming by size control 21805 ( 0.10%) empty read pairs filtered out after trimming by size control 22238717 (99.79%) read pairs available; of these: 12066744 (54.26%) trimmed read pairs available after processing 10171973 (45.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 5 0.00% 20 7 0.00% 21 3 0.00% 22 10 0.00% 23 8 0.00% 24 2 0.00% 25 4 0.00% 26 7 0.00% 27 11 0.00% 28 6 0.00% 29 9 0.00% 30 16 0.00% 31 13 0.00% 32 9 0.00% 33 15 0.00% 34 9 0.00% 35 13 0.00% 36 7 0.00% 37 15 0.00% 38 22 0.00% 39 14 0.00% 40 21 0.00% 41 20 0.00% 42 18 0.00% 43 34 0.00% 44 21 0.00% 45 29 0.00% 46 38 0.00% 47 32 0.00% 48 42 0.00% 49 38 0.00% 50 60 0.00% 51 60 0.00% 52 81 0.00% 53 70 0.00% 54 72 0.00% 55 72 0.00% 56 96 0.00% 57 108 0.00% 58 108 0.00% 59 123 0.00% 60 132 0.00% 61 131 0.00% 62 176 0.00% 63 196 0.00% 64 232 0.00% 65 232 0.00% 66 269 0.00% 67 349 0.00% 68 485 0.00% 69 853 0.00% 70 619 0.00% 71 432 0.00% 72 505 0.00% 73 535 0.00% 74 593 0.00% 75 655 0.00% 76 741 0.00% 77 836 0.00% 78 860 0.00% 79 969 0.00% 80 1074 0.00% 81 1194 0.01% 82 1403 0.01% 83 1753 0.01% 84 2866 0.01% 85 2972 0.01% 86 3249 0.01% 87 3410 0.02% 88 3672 0.02% 89 3844 0.02% 90 4084 0.02% 91 4294 0.02% 92 4696 0.02% 93 5027 0.02% 94 5361 0.02% 95 5692 0.03% 96 6136 0.03% 97 6955 0.03% 98 7658 0.03% 99 6909 0.03% 100 7471 0.03% 101 8069 0.04% 102 8413 0.04% 103 8997 0.04% 104 9609 0.04% 105 10441 0.05% 106 10994 0.05% 107 11638 0.05% 108 12385 0.06% 109 12996 0.06% 110 13913 0.06% 111 15074 0.07% 112 15670 0.07% 113 16697 0.08% 114 17822 0.08% 115 18963 0.09% 116 20196 0.09% 117 21407 0.10% 118 22293 0.10% 119 24248 0.11% 120 25411 0.11% 121 27153 0.12% 122 29099 0.13% 123 31497 0.14% 124 33890 0.15% 125 37928 0.17% 126 39711 0.18% 127 40482 0.18% 128 43038 0.19% 129 45832 0.21% 130 48330 0.22% 131 51564 0.23% 132 55867 0.25% 133 61097 0.27% 134 65479 0.29% 135 71549 0.32% 136 79783 0.36% 137 90230 0.41% 138 99910 0.45% 139 110331 0.50% 140 122539 0.55% 141 137049 0.62% 142 155991 0.70% 143 187555 0.84% 144 235061 1.06% 145 306874 1.38% 146 429801 1.93% 147 672316 3.02% 148 1402107 6.30% 149 6948577 31.25% 150 10171973 45.74% 22238717 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=40 prefix-density=0.09 prefix-fanout=1.9 sequence=CGGTCCGGTGTGGTACGGGCCGCACTGTTAAGGCCCCTGATC criterion=fanout-score sequence-density=0.05 sequence-density-rank=22 fanout-score=544.98 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=35.8 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=5.14 fanout-score-rank=34 prefix-density=0.14 prefix-fanout=3.2 sequence=AAGACCATCACCCTTGAGGTGGAAAGCTC criterion=fanout-score sequence-density=0.06 sequence-density-rank=18 fanout-score=547.36 fanout-score-rank=1 prefix-density=0.93 prefix-fanout=34.1 sequence=AAGAAGAAGAAG SRR6031390 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:38:41 Started mapping on | Feb 14 06:38:42 Finished on | Feb 14 06:40:44 Mapping speed, Million of reads per hour | 656.22 Number of input reads | 22238717 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 21290118 Uniquely mapped reads % | 95.73% Average mapped length | 294.68 Number of splices: Total | 20158098 Number of splices: Annotated (sjdb) | 19701509 Number of splices: GT/AG | 19812634 Number of splices: GC/AG | 291284 Number of splices: AT/AC | 17304 Number of splices: Non-canonical | 36876 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.02% Deletion average length | 2.41 Insertion rate per base | 0.02% Insertion average length | 1.72 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 512844 % of reads mapped to multiple loci | 2.31% Number of reads mapped to too many loci | 38498 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.74% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 458449 458449 458449 N_multimapping 512844 512844 512844 N_noFeature 829559 21065197 941888 N_ambiguous 224842 1196 111624 UnstrandedReadsAssigned:20235717 PositiveStrandReadsAssigned:223725 NegativeStrandReadsAssigned:20236606 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031390 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031390-trimmed-pair1.fastq SRR6031390-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,238,717 reads, 20,348,091 reads pseudoaligned [quant] estimated average fragment length: 325.31 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,156 rounds 52401 SRR6031390.ke.tsv 34699 SRR6031390.se.tsv 87100 total ==> SRR6031390.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1693.69 940 27.3071 Potri.005G024800.1.v4.1 1035 710.69 269 18.6232 Potri.004G059700.1.v4.1 961 636.912 81 6.25731 Potri.007G009000.2.v4.1 1416 1091.69 0 0 Potri.003G141000.2.v4.1 2943 2618.69 972.871 18.279 Potri.016G087400.1.v4.1 270 54.4746 1562 1410.81 Potri.015G069301.1.v4.1 564 258.418 0 0 Potri.010G195200.1.v4.1 1773 1448.69 109 3.70197 Potri.012G127500.1.v4.1 977 652.8 1609 121.271 ==> SRR6031390.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 13 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 275 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 15 SRR6031390 completed mapping pipeline successfully