Starting /dee2/code/volunteer_pipeline.sh SRR6031392 current disk space = 3085109141504 free memory = 1469183956 SRR6031392 SRAfilesize 509713ed9b84fe9dd38852ce15961bed SRR6031392.sra SRR6031392.sra file validated SRR6031392 is paired end SRR6031392 is conventional basespace SRR6031392 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.77025 34.0 33.0 34.0 33.0 34.0 2 33.31275 34.0 33.0 34.0 33.0 34.0 3 33.375 34.0 33.0 34.0 33.0 34.0 4 33.42775 34.0 33.0 34.0 33.0 34.0 5 33.43525 34.0 34.0 34.0 33.0 34.0 6 37.15425 38.0 38.0 38.0 36.0 38.0 7 37.3935 38.0 38.0 38.0 37.0 38.0 8 37.43975 38.0 38.0 38.0 37.0 38.0 9 37.3935 38.0 38.0 38.0 37.0 38.0 10-14 37.37675 38.0 38.0 38.0 37.0 38.0 15-19 37.41105 38.0 38.0 38.0 37.0 38.0 20-24 37.430099999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.393449999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.35965 38.0 38.0 38.0 37.0 38.0 35-39 37.31845 38.0 38.0 38.0 37.0 38.0 40-44 37.13995 38.0 38.0 38.0 36.2 38.0 45-49 37.08425 38.0 38.0 38.0 36.0 38.0 50-54 37.009699999999995 38.0 38.0 38.0 36.0 38.0 55-59 37.00345 38.0 38.0 38.0 36.0 38.0 60-64 37.00005 38.0 38.0 38.0 36.0 38.0 65-69 37.012600000000006 38.0 38.0 38.0 36.0 38.0 70-74 36.926100000000005 38.0 38.0 38.0 36.0 38.0 75-79 36.6305 38.0 38.0 38.0 35.2 38.0 80-84 36.51675 38.0 38.0 38.0 34.8 38.0 85-89 36.479 38.0 38.0 38.0 35.0 38.0 90-94 36.44840000000001 38.0 38.0 38.0 34.8 38.0 95-99 36.40905 38.0 38.0 38.0 34.4 38.0 100-104 36.3832 38.0 38.0 38.0 34.2 38.0 105-109 36.16975 38.0 38.0 38.0 34.0 38.0 110-114 36.10565 38.0 38.0 38.0 33.8 38.0 115-119 35.897149999999996 38.0 37.6 38.0 33.0 38.0 120-124 35.91445 38.0 38.0 38.0 33.0 38.0 125-129 35.5823 38.0 37.0 38.0 31.4 38.0 130-134 35.4988 38.0 37.0 38.0 31.4 38.0 135-139 35.362700000000004 38.0 36.2 38.0 31.0 38.0 140-144 34.85625 38.0 36.0 38.0 29.4 38.0 145-149 34.296949999999995 38.0 36.0 38.0 28.2 38.0 150 28.0305 33.0 25.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 1.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 5.0 17 3.0 18 8.0 19 22.0 20 6.0 21 5.0 22 5.0 23 9.0 24 9.0 25 15.0 26 15.0 27 19.0 28 22.0 29 28.0 30 35.0 31 49.0 32 65.0 33 82.0 34 110.0 35 202.0 36 494.0 37 2781.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 48.914985958641815 12.432984426857288 9.70130201684963 28.950727597651266 2 24.65 15.225 33.975 26.150000000000002 3 20.625 23.45 28.449999999999996 27.474999999999998 4 24.224999999999998 28.775000000000002 24.05 22.95 5 24.025 32.75 25.275 17.95 6 19.275000000000002 33.975 25.775 20.974999999999998 7 13.675 24.525 44.324999999999996 17.474999999999998 8 16.275000000000002 25.6 32.2 25.924999999999997 9 18.35 23.45 34.025 24.175 10-14 20.265 29.794999999999998 27.325 22.615 15-19 19.86 28.92 28.599999999999998 22.62 20-24 19.615 29.085 28.42 22.88 25-29 20.455000000000002 28.915000000000003 28.12 22.509999999999998 30-34 20.095 28.904999999999998 28.125 22.875 35-39 19.97 29.205 27.97 22.855 40-44 20.005 29.154999999999998 28.21 22.63 45-49 20.44 28.904999999999998 27.99 22.665 50-54 19.495 28.29 29.125 23.09 55-59 20.34 28.494999999999997 28.18 22.985 60-64 20.28 28.505000000000003 28.015 23.200000000000003 65-69 20.22 28.999999999999996 27.915 22.865 70-74 19.725 28.910000000000004 28.42 22.945 75-79 20.035 28.79 27.794999999999998 23.380000000000003 80-84 20.080000000000002 27.555000000000003 28.74 23.625 85-89 20.73 28.64 28.405 22.225 90-94 19.99 28.794999999999998 28.084999999999997 23.13 95-99 20.165 27.825 28.58 23.43 100-104 20.1 28.689999999999998 28.48 22.73 105-109 20.015 28.470000000000002 28.415000000000003 23.1 110-114 19.84 28.815 28.435 22.91 115-119 19.79 28.875 28.044999999999998 23.29 120-124 20.65 28.199999999999996 28.410000000000004 22.74 125-129 20.5 27.93 28.189999999999998 23.380000000000003 130-134 20.544999999999998 28.405 27.88 23.169999999999998 135-139 20.825 28.96 27.450000000000003 22.765 140-144 21.3 28.065 27.52 23.115 145-149 20.69 28.38 27.295 23.635 150 20.45 28.325 28.050000000000004 23.175 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.5 15 1.0 16 1.5 17 2.5 18 3.0 19 6.0 20 6.0 21 5.0 22 5.5 23 7.5 24 12.0 25 12.5 26 14.0 27 15.5 28 21.5 29 28.0 30 32.0 31 41.0 32 45.5 33 48.0 34 58.5 35 82.0 36 92.5 37 96.0 38 131.5 39 166.0 40 181.5 41 198.0 42 227.0 43 239.0 44 243.0 45 262.5 46 252.0 47 241.0 48 226.0 49 197.5 50 162.0 51 141.0 52 125.5 53 93.5 54 74.5 55 57.0 56 41.0 57 26.0 58 18.5 59 12.5 60 9.0 61 9.5 62 8.5 63 5.5 64 2.5 65 1.5 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54395743602737 98.225 2 0.354699771978718 0.7000000000000001 3 0.02533569799847986 0.075 4 0.05067139599695972 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02533569799847986 0.8 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTCTCCATCTCGTATGC 32 0.8 TruSeq Adapter, Index 1 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.4625 0.0 0.0 0.0 0.0 112-113 1.6125 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.525 0.0 0.0 0.0 0.0 122-123 2.8625 0.0 0.0 0.0 0.0 124-125 3.1625 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.5999999999999996 0.0 0.0 0.0 0.0 130-131 3.925 0.0 0.0 0.0 0.0 132-133 4.262499999999999 0.0 0.0 0.0 0.0 134-135 4.7 0.0 0.0 0.0 0.0 136-137 5.0375 0.0 0.0 0.0 0.0 138 5.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGGAA 10 0.006973645 144.0 1 >>END_MODULE SRR6031392 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031392_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.53125 33.0 33.0 34.0 32.0 34.0 2 32.538 33.0 33.0 34.0 31.0 34.0 3 32.581 33.0 33.0 34.0 32.0 34.0 4 32.56825 33.0 33.0 34.0 32.0 34.0 5 32.5775 33.0 33.0 34.0 32.0 34.0 6 36.7235 38.0 38.0 38.0 35.0 38.0 7 36.57925 38.0 38.0 38.0 36.0 38.0 8 36.60925 38.0 38.0 38.0 35.0 38.0 9 36.59725 38.0 38.0 38.0 36.0 38.0 10-14 36.574400000000004 38.0 38.0 38.0 35.6 38.0 15-19 36.5078 38.0 38.0 38.0 35.2 38.0 20-24 36.547650000000004 38.0 38.0 38.0 35.8 38.0 25-29 36.5527 38.0 38.0 38.0 35.8 38.0 30-34 36.4947 38.0 38.0 38.0 35.6 38.0 35-39 36.30815 38.0 38.0 38.0 35.4 38.0 40-44 35.93025 38.0 38.0 38.0 34.0 38.0 45-49 36.291199999999996 38.0 38.0 38.0 34.4 38.0 50-54 36.29275 38.0 38.0 38.0 34.6 38.0 55-59 36.27290000000001 38.0 38.0 38.0 34.6 38.0 60-64 36.333349999999996 38.0 38.0 38.0 34.8 38.0 65-69 36.14885 38.0 38.0 38.0 34.2 38.0 70-74 35.99465 38.0 38.0 38.0 34.0 38.0 75-79 35.9911 38.0 38.0 38.0 34.0 38.0 80-84 35.2997 38.0 38.0 38.0 32.2 38.0 85-89 34.563900000000004 38.0 38.0 38.0 26.4 38.0 90-94 34.420849999999994 38.0 38.0 38.0 25.4 38.0 95-99 34.39495 38.0 38.0 38.0 24.8 38.0 100-104 35.17245 38.0 38.0 38.0 29.0 38.0 105-109 35.5597 38.0 38.0 38.0 33.0 38.0 110-114 35.50495 38.0 38.0 38.0 33.0 38.0 115-119 35.3566 38.0 38.0 38.0 31.8 38.0 120-124 35.23625 38.0 38.0 38.0 31.0 38.0 125-129 34.3446 38.0 37.0 38.0 23.8 38.0 130-134 33.0758 38.0 35.8 38.0 11.4 38.0 135-139 32.17255 38.0 34.4 38.0 2.0 38.0 140-144 32.0651 38.0 33.6 38.0 2.0 38.0 145-149 31.63425 38.0 33.0 38.0 2.0 38.0 150 25.72875 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 27.0 3 5.0 4 4.0 5 3.0 6 10.0 7 3.0 8 6.0 9 5.0 10 4.0 11 6.0 12 3.0 13 11.0 14 11.0 15 13.0 16 18.0 17 5.0 18 6.0 19 8.0 20 6.0 21 11.0 22 17.0 23 24.0 24 40.0 25 31.0 26 31.0 27 41.0 28 55.0 29 47.0 30 49.0 31 58.0 32 92.0 33 90.0 34 96.0 35 182.0 36 370.0 37 2612.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.98574643660915 21.13028257064266 14.603650912728183 21.280320080020005 2 27.575 23.25 31.75 17.424999999999997 3 20.175 26.625 34.525 18.675 4 23.95 32.45 24.725 18.875 5 24.975 38.05 20.974999999999998 16.0 6 19.85 37.9 24.224999999999998 18.025 7 18.95 21.4 40.849999999999994 18.8 8 19.975 25.474999999999998 29.5 25.05 9 20.849999999999998 26.35 29.575000000000003 23.225 10-14 22.805 29.4 26.695 21.099999999999998 15-19 21.85 28.685 29.020000000000003 20.445 20-24 22.93 28.71 28.17 20.19 25-29 22.745 29.375 27.515 20.365 30-34 21.790000000000003 28.79 28.42 21.0 35-39 21.95563603440471 28.061968713847392 29.40495950907902 20.57743574266888 40-44 23.206858070406817 27.96489804200061 28.58374759054479 20.244496297047785 45-49 22.720000000000002 27.11 29.325000000000003 20.845 50-54 22.695 27.915 28.910000000000004 20.48 55-59 21.935 29.075 28.21 20.78 60-64 23.01 28.7 28.410000000000004 19.88 65-69 22.575 29.42 27.67 20.335 70-74 22.18 29.395 27.884999999999998 20.54 75-79 22.105 29.054999999999996 28.235 20.605 80-84 23.219751071209956 28.483982860640683 27.749438890022443 20.546827178126915 85-89 23.493286145518894 28.68741542625169 27.82346205891538 19.99583636931404 90-94 23.21865403632957 28.673294123770365 28.168427627127468 19.939624212772603 95-99 23.003643935450285 28.68818323789693 28.365434669442998 19.942738157209785 100-104 23.070343161920096 28.217771963369227 28.05675757270806 20.655127302002615 105-109 22.645 28.26 28.225 20.87 110-114 23.11 28.849999999999998 27.96 20.080000000000002 115-119 22.605 28.705000000000002 28.060000000000002 20.630000000000003 120-124 23.22 28.754999999999995 27.91 20.115 125-129 23.154362416107382 28.38621110433191 28.233679072605245 20.22574740695546 130-134 23.955916473317863 28.612107150390216 27.499472685087532 19.93250369120439 135-139 23.34825521816515 28.27787066501267 28.36416590259425 20.009708214227928 140-144 24.514614892255175 28.32302112225304 27.538937486665244 19.62342649882654 145-149 24.11462832173162 28.408109344037396 27.6307098216554 19.84655251257558 150 24.099999999999998 29.525000000000002 27.800000000000004 18.575 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 1.0 2 1.5 3 1.0 4 2.0 5 2.5 6 1.0 7 0.5 8 1.0 9 0.5 10 1.0 11 1.5 12 1.0 13 1.5 14 2.5 15 2.0 16 1.0 17 0.5 18 3.5 19 6.0 20 4.0 21 9.0 22 13.0 23 12.5 24 10.5 25 10.5 26 15.5 27 18.5 28 21.0 29 27.0 30 37.0 31 40.5 32 45.0 33 60.0 34 79.5 35 84.5 36 95.5 37 111.5 38 128.0 39 161.0 40 197.0 41 211.5 42 215.5 43 244.0 44 258.5 45 257.5 46 233.0 47 213.5 48 230.0 49 200.0 50 157.0 51 131.5 52 110.0 53 86.5 54 55.0 55 42.5 56 36.5 57 30.5 58 23.0 59 15.0 60 9.0 61 6.0 62 4.5 63 4.0 64 3.0 65 2.0 66 2.5 67 2.0 68 1.0 69 1.5 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.5950000000000001 40-44 1.43 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.9800000000000002 85-89 3.93 90-94 3.9350000000000005 95-99 3.95 100-104 0.63 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.66 130-134 5.18 135-139 7.295 140-144 6.260000000000001 145-149 1.595 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54591321897074 98.65 2 0.4036326942482341 0.8 3 0.025227043390514632 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025227043390514632 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 19 0.475 Illumina Single End PCR Primer 1 (100% over 50bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 0.9875 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2875 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.775 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.125 0.0 0.0 0.0 0.0 120-121 2.3875 0.0 0.0 0.0 0.0 122-123 2.7 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.325 0.0 0.0 0.0 0.0 130-131 3.5999999999999996 0.0 0.0 0.0 0.0 132-133 3.9125 0.0 0.0 0.0 0.0 134-135 4.2875 0.0 0.0 0.0 0.0 136-137 4.6 0.0 0.0 0.0 0.0 138 4.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATATGAG 10 0.007066775 143.3625 5 >>END_MODULE Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232819 spots for SRR6031392.sra Written 1232819 spots for SRR6031392.sra Read 1232824 spots for SRR6031392.sra Written 1232824 spots for SRR6031392.sra SRR ids: ['SRR6031392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_tbbmgnih SRR6031392.sra spots: 24656385 blocks: [[1, 1232819], [1232820, 2465638], [2465639, 3698457], [3698458, 4931276], [4931277, 6164095], [6164096, 7396914], [7396915, 8629733], [8629734, 9862552], [9862553, 11095371], [11095372, 12328190], [12328191, 13561009], [13561010, 14793828], [14793829, 16026647], [16026648, 17259466], [17259467, 18492285], [18492286, 19725104], [19725105, 20957923], [20957924, 22190742], [22190743, 23423561], [23423562, 24656385]] SRR6031392 file size 8285382 SRR6031392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031392 SRR6031392_1.fastq SRR6031392_2.fastq Input file: SRR6031392_1.fastq Paired file: SRR6031392_2.fastq trimmed: SRR6031392-trimmed-pair1.fastq, SRR6031392-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 06:44:32 2025 >> started Fri Feb 14 06:45:01 2025 >> done (29.795s) 24656385 read pairs processed; of these: 48705 ( 0.20%) short read pairs filtered out after trimming by size control 214104 ( 0.87%) empty read pairs filtered out after trimming by size control 24393576 (98.93%) read pairs available; of these: 9595440 (39.34%) trimmed read pairs available after processing 14798136 (60.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 10 0.00% 20 16 0.00% 21 14 0.00% 22 10 0.00% 23 21 0.00% 24 26 0.00% 25 27 0.00% 26 33 0.00% 27 19 0.00% 28 21 0.00% 29 22 0.00% 30 28 0.00% 31 30 0.00% 32 27 0.00% 33 29 0.00% 34 31 0.00% 35 41 0.00% 36 28 0.00% 37 52 0.00% 38 40 0.00% 39 49 0.00% 40 60 0.00% 41 64 0.00% 42 84 0.00% 43 94 0.00% 44 104 0.00% 45 118 0.00% 46 147 0.00% 47 152 0.00% 48 186 0.00% 49 191 0.00% 50 191 0.00% 51 215 0.00% 52 234 0.00% 53 267 0.00% 54 256 0.00% 55 241 0.00% 56 287 0.00% 57 300 0.00% 58 348 0.00% 59 366 0.00% 60 433 0.00% 61 446 0.00% 62 524 0.00% 63 621 0.00% 64 680 0.00% 65 857 0.00% 66 1002 0.00% 67 1209 0.00% 68 1548 0.01% 69 2395 0.01% 70 2324 0.01% 71 1689 0.01% 72 1655 0.01% 73 1828 0.01% 74 2014 0.01% 75 2251 0.01% 76 2421 0.01% 77 2717 0.01% 78 2917 0.01% 79 3153 0.01% 80 3738 0.02% 81 4194 0.02% 82 4863 0.02% 83 5812 0.02% 84 9730 0.04% 85 9970 0.04% 86 10401 0.04% 87 10718 0.04% 88 11057 0.05% 89 11745 0.05% 90 12419 0.05% 91 13071 0.05% 92 14101 0.06% 93 15085 0.06% 94 16099 0.07% 95 17169 0.07% 96 18199 0.07% 97 19049 0.08% 98 19980 0.08% 99 20849 0.09% 100 21733 0.09% 101 22675 0.09% 102 24179 0.10% 103 25841 0.11% 104 26946 0.11% 105 29011 0.12% 106 30147 0.12% 107 31050 0.13% 108 32041 0.13% 109 32942 0.14% 110 33676 0.14% 111 35138 0.14% 112 36620 0.15% 113 38194 0.16% 114 39449 0.16% 115 41396 0.17% 116 42813 0.18% 117 43770 0.18% 118 44454 0.18% 119 45894 0.19% 120 46875 0.19% 121 48096 0.20% 122 49680 0.20% 123 51263 0.21% 124 53819 0.22% 125 56040 0.23% 126 58209 0.24% 127 60746 0.25% 128 62948 0.26% 129 65271 0.27% 130 66815 0.27% 131 69222 0.28% 132 71968 0.30% 133 74610 0.31% 134 78292 0.32% 135 82705 0.34% 136 88605 0.36% 137 95427 0.39% 138 104632 0.43% 139 109370 0.45% 140 115732 0.47% 141 122948 0.50% 142 132297 0.54% 143 148384 0.61% 144 172366 0.71% 145 206506 0.85% 146 294480 1.21% 147 381043 1.56% 148 739064 3.03% 149 4924635 20.19% 150 14798136 60.66% 24393576 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=3.20 fanout-score-rank=33 prefix-density=0.17 prefix-fanout=2.2 sequence=TGACCAGCCTCTTGCACTGATTCCTTTGCAGATTGAGCAGCATT criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=43.17 fanout-score-rank=1 prefix-density=0.29 prefix-fanout=11.7 sequence=CTTGTTGAACTGGCTTACGGTCTGGTAAGTCTTGTGGGCCAAAGGTT criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=3.86 fanout-score-rank=27 prefix-density=0.20 prefix-fanout=3.1 sequence=ACCCAGAAGATGAGCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=32 fanout-score=429.78 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=28.1 sequence=AAGAAGAAAAACAGTTTCTCAAGAGCAGTATATATAGATCTTTCAGAAGAATTAAGGAGATGGCAGACGAGGGAACAGCAACTTGCATAGACATCTTGTTGGCCATCATCTTGCCTCCGCTTGGTGTCTTCCTCAAGTTCGGCTGCGGGGTGGAGTTTTGGATCTGCTTGCTTCTCACCTTCTTTGGCTACCTCCCTGGAATTATTTATGCTATCTACGCCATCACCAA SRR6031392 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 06:46:10 Started mapping on | Feb 14 06:46:11 Finished on | Feb 14 07:00:39 Mapping speed, Million of reads per hour | 101.17 Number of input reads | 24393576 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 18679981 Uniquely mapped reads % | 76.58% Average mapped length | 292.26 Number of splices: Total | 17223580 Number of splices: Annotated (sjdb) | 16864033 Number of splices: GT/AG | 16948557 Number of splices: GC/AG | 216106 Number of splices: AT/AC | 10619 Number of splices: Non-canonical | 48298 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.75 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 568609 % of reads mapped to multiple loci | 2.33% Number of reads mapped to too many loci | 28168 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 20.92% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5190399 5190399 5190399 N_multimapping 568609 568609 568609 N_noFeature 510210 18361992 692045 N_ambiguous 294566 1976 156875 UnstrandedReadsAssigned:17875205 PositiveStrandReadsAssigned:316013 NegativeStrandReadsAssigned:17831061 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031392 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031392-trimmed-pair1.fastq SRR6031392-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,393,576 reads, 17,961,851 reads pseudoaligned [quant] estimated average fragment length: 253.319 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR6031392.ke.tsv 34699 SRR6031392.se.tsv 87100 total ==> SRR6031392.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1765.68 547 16.4256 Potri.005G024800.1.v4.1 1035 782.681 343 23.2357 Potri.004G059700.1.v4.1 961 708.71 19 1.42145 Potri.007G009000.2.v4.1 1416 1163.68 0 0 Potri.003G141000.2.v4.1 2943 2690.68 333 6.56189 Potri.016G087400.1.v4.1 270 80.1416 1062 702.608 Potri.015G069301.1.v4.1 564 319.087 0 0 Potri.010G195200.1.v4.1 1773 1520.68 22 0.767064 Potri.012G127500.1.v4.1 977 724.704 2914 213.194 ==> SRR6031392.se.tsv <== Potri.001G166300.v4.1 124 Potri.001G448400.v4.1 730 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 596 Potri.001G212900.v4.1 956 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 1 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR6031392 completed mapping pipeline successfully