Starting /dee2/code/volunteer_pipeline.sh SRR6031393 current disk space = 3119109140480 free memory = 1577715628 SRR6031393 SRAfilesize b71ea1c6b171fe18a0eacb775462b0f6 SRR6031393.sra SRR6031393.sra file validated SRR6031393 is paired end SRR6031393 is conventional basespace SRR6031393 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.78375 34.0 33.0 34.0 33.0 34.0 2 33.29825 34.0 33.0 34.0 33.0 34.0 3 33.33975 34.0 33.0 34.0 33.0 34.0 4 33.395 34.0 33.0 34.0 33.0 34.0 5 33.40325 34.0 33.0 34.0 33.0 34.0 6 37.146 38.0 38.0 38.0 36.0 38.0 7 37.35025 38.0 38.0 38.0 37.0 38.0 8 37.3395 38.0 38.0 38.0 37.0 38.0 9 37.3755 38.0 38.0 38.0 37.0 38.0 10-14 37.3857 38.0 38.0 38.0 37.0 38.0 15-19 37.45745 38.0 38.0 38.0 37.2 38.0 20-24 37.45445 38.0 38.0 38.0 37.4 38.0 25-29 37.42805 38.0 38.0 38.0 37.0 38.0 30-34 37.3865 38.0 38.0 38.0 37.0 38.0 35-39 37.34544999999999 38.0 38.0 38.0 37.0 38.0 40-44 36.98295 38.0 38.0 38.0 35.8 38.0 45-49 37.1216 38.0 38.0 38.0 36.0 38.0 50-54 37.064949999999996 38.0 38.0 38.0 36.0 38.0 55-59 37.08315 38.0 38.0 38.0 36.0 38.0 60-64 37.03165 38.0 38.0 38.0 36.0 38.0 65-69 36.896550000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.440900000000006 38.0 38.0 38.0 34.6 38.0 75-79 35.08935 38.0 38.0 38.0 30.6 38.0 80-84 35.06535 38.0 38.0 38.0 31.0 38.0 85-89 35.025 38.0 38.0 38.0 31.4 38.0 90-94 34.9384 38.0 38.0 38.0 30.2 38.0 95-99 34.8625 38.0 38.0 38.0 29.8 38.0 100-104 34.75124999999999 38.0 38.0 38.0 28.8 38.0 105-109 34.5822 38.0 37.4 38.0 27.4 38.0 110-114 34.51485 38.0 37.4 38.0 26.6 38.0 115-119 34.40955 38.0 37.0 38.0 25.2 38.0 120-124 34.3537 38.0 37.0 38.0 25.2 38.0 125-129 34.10765 38.0 36.2 38.0 22.6 38.0 130-134 34.06225 38.0 36.0 38.0 22.6 38.0 135-139 33.8813 38.0 36.0 38.0 19.8 38.0 140-144 33.425700000000006 38.0 35.4 38.0 14.8 38.0 145-149 33.04965 38.0 35.0 38.0 10.8 38.0 150 26.95425 33.0 21.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 2.0 11 0.0 12 2.0 13 1.0 14 4.0 15 6.0 16 5.0 17 12.0 18 56.0 19 125.0 20 13.0 21 10.0 22 7.0 23 7.0 24 13.0 25 18.0 26 14.0 27 15.0 28 23.0 29 34.0 30 38.0 31 37.0 32 56.0 33 69.0 34 88.0 35 184.0 36 409.0 37 2748.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.2108080550599 13.433596737190925 7.111904154983431 28.24369105276574 2 21.349999999999998 19.925 33.125 25.6 3 18.75 21.675 32.725 26.85 4 22.325 28.599999999999998 22.1 26.974999999999998 5 26.35 32.35 23.35 17.95 6 23.599999999999998 33.625 23.325000000000003 19.45 7 13.55 28.9 41.25 16.3 8 15.950000000000001 29.075 29.175 25.8 9 22.5 23.275000000000002 31.6 22.625 10-14 20.155 31.0 25.545 23.3 15-19 19.975 28.435 27.279999999999998 24.310000000000002 20-24 20.51 28.720000000000002 28.005000000000003 22.765 25-29 19.49 27.655 28.105000000000004 24.75 30-34 18.54 27.77 28.810000000000002 24.88 35-39 22.39 27.334999999999997 26.0 24.275 40-44 18.795 28.7 28.685 23.82 45-49 21.215 27.99 28.915000000000003 21.88 50-54 20.495 26.724999999999998 26.93 25.85 55-59 20.380000000000003 26.400000000000002 30.28 22.939999999999998 60-64 19.99 28.615000000000002 27.855 23.54 65-69 19.139999999999997 33.005 25.69 22.165000000000003 70-74 19.42 31.865 26.900000000000002 21.815 75-79 19.869999999999997 30.645 26.755000000000003 22.73 80-84 20.575 29.220000000000002 27.250000000000004 22.955000000000002 85-89 20.23 28.78 27.42 23.57 90-94 20.49 27.92 28.13 23.46 95-99 19.735 28.415000000000003 27.79 24.060000000000002 100-104 20.175 30.314999999999998 27.29 22.220000000000002 105-109 19.965 31.22 26.045 22.770000000000003 110-114 20.23 30.755 26.71 22.305 115-119 20.4 29.965000000000003 26.540000000000003 23.095 120-124 21.115000000000002 28.895 26.655 23.335 125-129 20.895 29.15 26.340000000000003 23.615 130-134 20.794999999999998 28.77 26.919999999999998 23.515 135-139 20.845 29.099999999999998 26.640000000000004 23.415 140-144 20.9 28.705000000000002 26.884999999999998 23.51 145-149 21.029999999999998 29.215000000000003 26.13 23.625 150 20.275000000000002 29.349999999999998 26.075 24.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 2.0 23 3.0 24 3.0 25 2.5 26 3.5 27 9.0 28 12.0 29 15.5 30 23.0 31 29.0 32 35.5 33 35.0 34 49.5 35 78.0 36 92.0 37 95.0 38 126.5 39 161.5 40 183.0 41 208.5 42 239.5 43 282.0 44 282.0 45 271.0 46 290.5 47 275.0 48 242.0 49 204.5 50 160.0 51 143.0 52 120.5 53 85.0 54 59.5 55 42.5 56 32.0 57 23.5 58 17.5 59 15.0 60 11.5 61 9.5 62 6.5 63 4.5 64 2.5 65 2.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.925 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.68119022316685 93.8 2 0.2656748140276302 0.5 3 0.026567481402763018 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026567481402763018 5.625 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTGGCGCATCTCGTATGC 225 5.625 TruSeq Adapter, Index 4 (97% over 37bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.9625 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.6124999999999998 0.0 0.0 0.0 0.0 106-107 1.7875 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.15 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.5125 0.0 0.0 0.0 0.0 116-117 2.875 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.5375 0.0 0.0 0.0 0.0 124-125 3.875 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.5875 0.0 0.0 0.0 0.0 130-131 4.9375 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 5.975 0.0 0.0 0.0 0.0 138 6.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGATA 10 0.0069754543 143.9875 2 CTTGTCC 10 0.0069754543 143.9875 5 GAGCACA 30 1.4618472E-5 95.99167 9 CGGAAGA 30 1.4618472E-5 95.99167 4 AGAGCAC 30 1.4618472E-5 95.99167 8 GATCGGA 35 2.9476229E-5 83.32007 1 AAGAGCA 35 3.1425407E-5 82.27857 7 GAAGAGC 35 3.1425407E-5 82.27857 6 TCGGAAG 35 3.1425407E-5 82.27857 3 ATCGGAA 35 3.1425407E-5 82.27857 2 GGAAGAG 40 6.093763E-5 71.99375 5 ACACGTC 20 0.006141849 28.797503 10-14 ACGTCTG 20 0.006141849 28.797503 15-19 TGCCGTC 20 0.006141849 28.797503 45-49 CCAGTCA 20 0.006141849 28.797503 25-29 CACGTCT 20 0.006141849 28.797503 10-14 TATGCCG 20 0.006141849 28.797503 45-49 TCCAGTC 20 0.006141849 28.797503 25-29 CTGGCGC 20 0.006141849 28.797503 30-34 CTGAACT 20 0.006141849 28.797503 15-19 >>END_MODULE SRR6031393 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031393_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55425 33.0 33.0 34.0 32.0 34.0 2 32.60125 33.0 33.0 34.0 31.0 34.0 3 32.646 34.0 33.0 34.0 32.0 34.0 4 32.38575 34.0 33.0 34.0 31.0 34.0 5 32.51325 33.0 33.0 34.0 31.0 34.0 6 36.69225 38.0 38.0 38.0 35.0 38.0 7 36.48625 38.0 38.0 38.0 35.0 38.0 8 36.552 38.0 38.0 38.0 35.0 38.0 9 36.525 38.0 38.0 38.0 35.0 38.0 10-14 36.4962 38.0 38.0 38.0 34.6 38.0 15-19 36.4862 38.0 38.0 38.0 34.6 38.0 20-24 36.5323 38.0 38.0 38.0 35.2 38.0 25-29 36.4547 38.0 38.0 38.0 34.6 38.0 30-34 36.189800000000005 38.0 38.0 38.0 33.6 38.0 35-39 35.8858 38.0 38.0 38.0 31.8 38.0 40-44 35.6298 38.0 38.0 38.0 31.2 38.0 45-49 35.661199999999994 38.0 38.0 38.0 29.2 38.0 50-54 35.682100000000005 38.0 38.0 38.0 30.4 38.0 55-59 35.849199999999996 38.0 38.0 38.0 31.8 38.0 60-64 36.10625 38.0 38.0 38.0 34.0 38.0 65-69 35.62094999999999 38.0 38.0 38.0 32.6 38.0 70-74 34.67764999999999 38.0 38.0 38.0 28.0 38.0 75-79 34.58785 38.0 38.0 38.0 27.4 38.0 80-84 33.92745 38.0 38.0 38.0 16.8 38.0 85-89 33.09785 38.0 37.8 38.0 4.4 38.0 90-94 32.963 38.0 37.0 38.0 2.0 38.0 95-99 32.81635 38.0 37.0 38.0 2.0 38.0 100-104 33.658500000000004 38.0 37.0 38.0 16.2 38.0 105-109 34.07885 38.0 37.8 38.0 19.4 38.0 110-114 33.967150000000004 38.0 37.6 38.0 15.0 38.0 115-119 33.8733 38.0 37.2 38.0 15.0 38.0 120-124 33.70705 38.0 37.0 38.0 15.0 38.0 125-129 32.82065 38.0 35.8 38.0 9.2 38.0 130-134 31.447449999999996 38.0 34.0 38.0 2.0 38.0 135-139 30.568450000000002 38.0 33.0 38.0 2.0 38.0 140-144 30.395099999999996 38.0 31.8 38.0 2.0 38.0 145-149 29.935899999999997 38.0 31.0 38.0 2.0 38.0 150 24.3665 33.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 9.0 4 3.0 5 7.0 6 4.0 7 6.0 8 10.0 9 7.0 10 6.0 11 13.0 12 16.0 13 26.0 14 54.0 15 45.0 16 57.0 17 13.0 18 8.0 19 12.0 20 6.0 21 12.0 22 15.0 23 18.0 24 26.0 25 34.0 26 38.0 27 55.0 28 52.0 29 55.0 30 62.0 31 47.0 32 83.0 33 101.0 34 110.0 35 176.0 36 350.0 37 2446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.11202800700175 21.305326331582897 10.277569392348088 20.305076269067268 2 24.5 29.049999999999997 30.4 16.05 3 18.05 26.075 38.175 17.7 4 23.7 31.35 22.275 22.675 5 28.349999999999998 34.5 20.8 16.35 6 24.15 36.225 22.1 17.525 7 18.65 25.324999999999996 37.55 18.475 8 18.9 28.9 27.375 24.825 9 26.6 23.875 27.55 21.975 10-14 24.404999999999998 28.57 25.935000000000002 21.09 15-19 23.674999999999997 26.484999999999996 28.975 20.865000000000002 20-24 25.619999999999997 28.09 26.825 19.465 25-29 24.115000000000002 30.314999999999998 26.13 19.439999999999998 30-34 23.82 27.389999999999997 29.53 19.259999999999998 35-39 22.023600301280442 27.411498870198344 29.214160180768268 21.35074064775295 40-44 26.279552473042067 26.613678934845343 27.352807168531363 19.753961423581227 45-49 22.759999999999998 26.44 28.544999999999998 22.255 50-54 23.135 27.400000000000002 28.970000000000002 20.495 55-59 21.85 29.425 28.525 20.200000000000003 60-64 21.47 31.979999999999997 26.6 19.950000000000003 65-69 22.235 31.840000000000003 26.105 19.82 70-74 22.835 30.705 26.735 19.725 75-79 22.735 29.79 27.295 20.18 80-84 23.617194662320465 28.944687786492818 27.106040541917082 20.332077009269632 85-89 23.577871630429115 28.82319203295271 27.368475937223003 20.230460399395174 90-94 23.748891092208943 28.231487762876377 27.130407556228146 20.88921358868653 95-99 23.630672926447573 28.591549295774648 27.40740740740741 20.37037037037037 100-104 23.527340409477336 28.079883293928265 27.40580512098194 20.986971175612457 105-109 23.1 29.56 27.315 20.025000000000002 110-114 23.49 28.7 27.279999999999998 20.53 115-119 23.955000000000002 29.005 27.205000000000002 19.835 120-124 24.595 28.634999999999998 27.055 19.715 125-129 23.993493289955268 28.32452216348109 27.384099227328186 20.297885319235462 130-134 24.554633398530424 28.059417455199025 27.070888618702753 20.315060527567795 135-139 24.660131072956723 28.70606077018903 26.32291610247522 20.31089205437903 140-144 24.058902275769746 28.963855421686745 26.811244979919678 20.16599732262383 145-149 24.79565416053206 28.278418033203025 26.81118952124689 20.11473828501802 150 24.525 28.050000000000004 27.3 20.125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.5 20 1.0 21 1.5 22 1.0 23 1.5 24 2.5 25 4.5 26 8.5 27 8.5 28 9.0 29 12.0 30 19.0 31 27.0 32 29.5 33 40.0 34 59.0 35 76.5 36 96.5 37 127.0 38 155.5 39 172.5 40 192.5 41 224.0 42 264.0 43 297.0 44 303.0 45 284.0 46 258.0 47 238.5 48 215.0 49 187.5 50 154.5 51 122.0 52 95.0 53 72.5 54 56.5 55 45.5 56 38.0 57 25.5 58 15.0 59 11.5 60 10.5 61 8.5 62 8.0 63 5.5 64 3.5 65 2.0 66 1.0 67 1.0 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.42500000000000004 40-44 1.2349999999999999 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.83 85-89 4.105 90-94 4.185 95-99 4.15 100-104 0.605 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.6400000000000001 130-134 5.415 135-139 7.6850000000000005 140-144 6.625 145-149 1.5150000000000001 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.53161592505855 95.625 2 0.28623471246422066 0.5499999999999999 3 0.078064012490242 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.052042674993494666 0.3 7 0.026021337496747333 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.026021337496747333 3.125 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCG 125 3.125 Illumina Single End PCR Primer 1 (100% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTTGCCG 7 0.17500000000000002 Illumina Single End PCR Primer 1 (98% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTGGCCG 6 0.15 Illumina Single End PCR Primer 1 (98% over 50bp) GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGGCG 6 0.15 Illumina Single End PCR Primer 1 (98% over 50bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.4125 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.2999999999999998 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7125 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.2125 0.0 0.0 0.0 0.0 114-115 2.4375 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.2625 0.0 0.0 0.0 0.0 122-123 3.4625 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.05 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 4.95 0.0 0.0 0.0 0.0 134-135 5.1875 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138 5.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCGAG 10 0.0073195035 141.6875 5 GAGCGTC 25 9.5512846E-4 85.012505 9 AAGAGCG 25 9.5512846E-4 85.012505 7 AGAGCGT 25 9.5512846E-4 85.012505 8 GATCGGA 35 3.4039207E-5 80.96429 1 TCGGAAG 35 3.4039207E-5 80.96429 3 CGGAAGA 35 3.4039207E-5 80.96429 4 ATCGGAA 35 3.4039207E-5 80.96429 2 GAAGAGC 30 0.0019699687 70.84375 6 GGAAGAG 30 0.0019699687 70.84375 5 GTGTAGG 20 0.0066444953 28.337502 15-19 TCGTGTA 20 0.0066444953 28.337502 10-14 AGAGTGT 20 0.0066444953 28.337502 25-29 TCTCGGT 20 0.0066444953 28.337502 35-39 TGTAGGG 20 0.0066444953 28.337502 15-19 GTAGGGA 20 0.0066444953 28.337502 15-19 TAGGGAA 20 0.0066444953 28.337502 15-19 TTAAAAA 20 0.0066444953 28.337502 55-59 AAAAAAA 350 1.1954481E-4 6.072322 60-64 >>END_MODULE Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286840 spots for SRR6031393.sra Written 1286840 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra Read 1286828 spots for SRR6031393.sra Written 1286828 spots for SRR6031393.sra SRR ids: ['SRR6031393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k3g3tslt SRR6031393.sra spots: 25736572 blocks: [[1, 1286828], [1286829, 2573656], [2573657, 3860484], [3860485, 5147312], [5147313, 6434140], [6434141, 7720968], [7720969, 9007796], [9007797, 10294624], [10294625, 11581452], [11581453, 12868280], [12868281, 14155108], [14155109, 15441936], [15441937, 16728764], [16728765, 18015592], [18015593, 19302420], [19302421, 20589248], [20589249, 21876076], [21876077, 23162904], [23162905, 24449732], [24449733, 25736572]] SRR6031393 file size 8649312 SRR6031393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031393 SRR6031393_1.fastq SRR6031393_2.fastq Input file: SRR6031393_1.fastq Paired file: SRR6031393_2.fastq trimmed: SRR6031393-trimmed-pair1.fastq, SRR6031393-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 07:51:37 2025 >> started Fri Feb 14 07:52:04 2025 >> done (26.574s) 25736572 read pairs processed; of these: 48848 ( 0.19%) short read pairs filtered out after trimming by size control 1480542 ( 5.75%) empty read pairs filtered out after trimming by size control 24207182 (94.06%) read pairs available; of these: 9685894 (40.01%) trimmed read pairs available after processing 14521288 (59.99%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 17 0.00% 19 14 0.00% 20 18 0.00% 21 17 0.00% 22 15 0.00% 23 15 0.00% 24 24 0.00% 25 16 0.00% 26 16 0.00% 27 19 0.00% 28 23 0.00% 29 22 0.00% 30 28 0.00% 31 31 0.00% 32 28 0.00% 33 27 0.00% 34 34 0.00% 35 49 0.00% 36 46 0.00% 37 52 0.00% 38 59 0.00% 39 41 0.00% 40 69 0.00% 41 83 0.00% 42 87 0.00% 43 131 0.00% 44 217 0.00% 45 359 0.00% 46 408 0.00% 47 389 0.00% 48 413 0.00% 49 433 0.00% 50 390 0.00% 51 473 0.00% 52 474 0.00% 53 511 0.00% 54 605 0.00% 55 559 0.00% 56 578 0.00% 57 596 0.00% 58 672 0.00% 59 708 0.00% 60 785 0.00% 61 830 0.00% 62 968 0.00% 63 1097 0.00% 64 1228 0.01% 65 1665 0.01% 66 1674 0.01% 67 1686 0.01% 68 2049 0.01% 69 3081 0.01% 70 3277 0.01% 71 2482 0.01% 72 2615 0.01% 73 2721 0.01% 74 3063 0.01% 75 3289 0.01% 76 3544 0.01% 77 3834 0.02% 78 4141 0.02% 79 4760 0.02% 80 5257 0.02% 81 5940 0.02% 82 6914 0.03% 83 8073 0.03% 84 11556 0.05% 85 11986 0.05% 86 12646 0.05% 87 13275 0.05% 88 13597 0.06% 89 14276 0.06% 90 15188 0.06% 91 16440 0.07% 92 17655 0.07% 93 19091 0.08% 94 20259 0.08% 95 21826 0.09% 96 22699 0.09% 97 23296 0.10% 98 24709 0.10% 99 25402 0.10% 100 26473 0.11% 101 27966 0.12% 102 29907 0.12% 103 31797 0.13% 104 33078 0.14% 105 35221 0.15% 106 36474 0.15% 107 37568 0.16% 108 38017 0.16% 109 39079 0.16% 110 40035 0.17% 111 41786 0.17% 112 43212 0.18% 113 45237 0.19% 114 47111 0.19% 115 49494 0.20% 116 49695 0.21% 117 51604 0.21% 118 52130 0.22% 119 52834 0.22% 120 54420 0.22% 121 54920 0.23% 122 57282 0.24% 123 59321 0.25% 124 61738 0.26% 125 63964 0.26% 126 66073 0.27% 127 68284 0.28% 128 69699 0.29% 129 71909 0.30% 130 73765 0.30% 131 75356 0.31% 132 78702 0.33% 133 81503 0.34% 134 85192 0.35% 135 89232 0.37% 136 95334 0.39% 137 102019 0.42% 138 109793 0.45% 139 114830 0.47% 140 119280 0.49% 141 125869 0.52% 142 135013 0.56% 143 149930 0.62% 144 171331 0.71% 145 200683 0.83% 146 282107 1.17% 147 360526 1.49% 148 691880 2.86% 149 4739581 19.58% 150 14521288 59.99% 24207182 reads passed initial QC criterion=sequence-density sequence-density=0.12 sequence-density-rank=1 fanout-score=5.41 fanout-score-rank=22 prefix-density=0.18 prefix-fanout=3.6 sequence=CCAGGATTTGGGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=44 fanout-score=28.81 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.0 sequence=ATGATCATATCAGGCGATCGAGCTCCCTCATTCAGGATTGCAGTACTGATCTATATCATTCTTACATCATTTTATACTCGATTTTAGAAGCTCTATCGGATGGTACAAACACAACAGGAAAAGGGA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.24 fanout-score-rank=33 prefix-density=0.21 prefix-fanout=3.2 sequence=ACCCAGAAGATGAGCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=317.89 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=19.8 sequence=ATTGAAGAAAGAAAGCAACATAGCTGACAAAAAGATGGGCCTGAAAGTTGTCTCCTCAGCAATAATATCATTCTCACTGTTTTTATTGTTAGCATCAACTGCTAAAGCCCAATCAAAAGGTGTCTTCGATGTGACTAAATATGGTTCCGATAAAGATATCA SRR6031393 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 07:52:47 Started mapping on | Feb 14 07:52:47 Finished on | Feb 14 07:55:41 Mapping speed, Million of reads per hour | 500.84 Number of input reads | 24207182 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 22524779 Uniquely mapped reads % | 93.05% Average mapped length | 291.31 Number of splices: Total | 18964286 Number of splices: Annotated (sjdb) | 18545027 Number of splices: GT/AG | 18629821 Number of splices: GC/AG | 247359 Number of splices: AT/AC | 10806 Number of splices: Non-canonical | 76300 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.03% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1141344 % of reads mapped to multiple loci | 4.71% Number of reads mapped to too many loci | 64720 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.90% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 585096 585096 585096 N_multimapping 1141344 1141344 1141344 N_noFeature 656487 22118137 847842 N_ambiguous 357523 3173 139974 UnstrandedReadsAssigned:21510769 PositiveStrandReadsAssigned:403469 NegativeStrandReadsAssigned:21536963 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031393 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031393-trimmed-pair1.fastq SRR6031393-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,207,182 reads, 22,027,448 reads pseudoaligned [quant] estimated average fragment length: 239.516 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,094 rounds 52401 SRR6031393.ke.tsv 34699 SRR6031393.se.tsv 87100 total ==> SRR6031393.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1779.48 518 12.5102 Potri.005G024800.1.v4.1 1035 796.484 1576 85.0368 Potri.004G059700.1.v4.1 961 722.526 15 0.892207 Potri.007G009000.2.v4.1 1416 1177.48 0 0 Potri.003G141000.2.v4.1 2943 2704.48 416.187 6.61351 Potri.016G087400.1.v4.1 270 83.1005 1152 595.767 Potri.015G069301.1.v4.1 564 330.702 0 0 Potri.010G195200.1.v4.1 1773 1534.48 159 4.4531 Potri.012G127500.1.v4.1 977 738.507 3625 210.951 ==> SRR6031393.se.tsv <== Potri.001G166300.v4.1 429 Potri.001G448400.v4.1 33 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 667 Potri.001G212900.v4.1 191 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 8 Potri.001G416900.v4.1 6 Potri.001G452600.v4.1 6 SRR6031393 completed mapping pipeline successfully