Starting /dee2/code/volunteer_pipeline.sh SRR6031394 current disk space = 3118145146880 free memory = 1579922404 SRR6031394 SRAfilesize 545b3785368ff6607c1428c294398fb0 SRR6031394.sra SRR6031394.sra file validated SRR6031394 is paired end SRR6031394 is conventional basespace SRR6031394 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9415 34.0 33.0 34.0 32.0 34.0 2 33.313 34.0 33.0 34.0 33.0 34.0 3 33.27825 34.0 33.0 34.0 33.0 34.0 4 33.3485 34.0 33.0 34.0 33.0 34.0 5 33.41225 34.0 33.0 34.0 33.0 34.0 6 37.10475 38.0 38.0 38.0 36.0 38.0 7 37.40125 38.0 38.0 38.0 37.0 38.0 8 37.3815 38.0 38.0 38.0 37.0 38.0 9 37.4805 38.0 38.0 38.0 37.0 38.0 10-14 37.4046 38.0 38.0 38.0 37.0 38.0 15-19 37.439550000000004 38.0 38.0 38.0 37.0 38.0 20-24 37.46425 38.0 38.0 38.0 37.2 38.0 25-29 37.434000000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.39815 38.0 38.0 38.0 37.0 38.0 35-39 37.325950000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.21955 38.0 38.0 38.0 37.0 38.0 45-49 37.1759 38.0 38.0 38.0 36.0 38.0 50-54 37.00945 38.0 38.0 38.0 36.0 38.0 55-59 37.0258 38.0 38.0 38.0 36.0 38.0 60-64 37.012950000000004 38.0 38.0 38.0 36.0 38.0 65-69 37.01975 38.0 38.0 38.0 36.0 38.0 70-74 36.9282 38.0 38.0 38.0 35.6 38.0 75-79 36.8648 38.0 38.0 38.0 35.8 38.0 80-84 36.763749999999995 38.0 38.0 38.0 35.2 38.0 85-89 36.69965 38.0 38.0 38.0 35.0 38.0 90-94 36.678700000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.5867 38.0 38.0 38.0 34.4 38.0 100-104 36.513549999999995 38.0 38.0 38.0 34.2 38.0 105-109 36.3158 38.0 38.0 38.0 34.0 38.0 110-114 36.17315000000001 38.0 38.0 38.0 33.6 38.0 115-119 36.02505 38.0 37.8 38.0 33.2 38.0 120-124 35.878550000000004 38.0 37.6 38.0 32.6 38.0 125-129 35.69245 38.0 37.0 38.0 31.0 38.0 130-134 35.5284 38.0 37.0 38.0 31.0 38.0 135-139 35.26365 38.0 36.0 38.0 31.0 38.0 140-144 34.8011 38.0 36.0 38.0 28.8 38.0 145-149 33.92895 38.0 35.2 38.0 24.0 38.0 150 25.8355 33.0 18.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 3.0 16 4.0 17 2.0 18 3.0 19 6.0 20 4.0 21 3.0 22 9.0 23 9.0 24 6.0 25 23.0 26 15.0 27 15.0 28 19.0 29 38.0 30 47.0 31 60.0 32 72.0 33 81.0 34 134.0 35 220.0 36 480.0 37 2743.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.94389689158454 12.939095274197623 8.491281273692191 32.625726560525656 2 23.674999999999997 15.925 34.150000000000006 26.25 3 18.8 22.2 28.999999999999996 30.0 4 23.5 30.55 23.325000000000003 22.625 5 21.7 35.699999999999996 23.75 18.85 6 18.175 35.975 24.825 21.025 7 14.224999999999998 24.5 43.35 17.925 8 17.275 23.65 31.35 27.725 9 16.525000000000002 22.7 34.25 26.525 10-14 20.005 29.880000000000003 27.075 23.04 15-19 20.02 28.689999999999998 28.08 23.21 20-24 20.25 28.465 28.43 22.855 25-29 20.346017300865043 28.7964398219911 27.396369818490925 23.461173058652932 30-34 19.77 29.32 27.705000000000002 23.205000000000002 35-39 19.695 28.910000000000004 27.889999999999997 23.505000000000003 40-44 20.055 29.049999999999997 27.165 23.73 45-49 19.66 28.16 28.1 24.08 50-54 20.395 28.689999999999998 27.58 23.335 55-59 20.41 28.194999999999997 28.28 23.115 60-64 19.950000000000003 28.68 27.73 23.64 65-69 20.175 28.71 27.224999999999998 23.89 70-74 20.23 29.049999999999997 27.485 23.235 75-79 19.735 28.965000000000003 27.810000000000002 23.49 80-84 20.14 28.595 27.560000000000002 23.705000000000002 85-89 20.080000000000002 28.494999999999997 28.055000000000003 23.369999999999997 90-94 20.435 28.055000000000003 27.865000000000002 23.645 95-99 20.330000000000002 28.720000000000002 27.62 23.330000000000002 100-104 19.965 28.7 28.18 23.155 105-109 20.69 28.935 27.405 22.97 110-114 20.445 28.58 27.93 23.044999999999998 115-119 21.095 28.4 27.615000000000002 22.89 120-124 20.255000000000003 29.13 27.08 23.535 125-129 20.51 28.675 27.57 23.244999999999997 130-134 20.935000000000002 28.53 27.54 22.994999999999997 135-139 20.830000000000002 28.754999999999995 26.484999999999996 23.93 140-144 21.47 28.395 26.935 23.200000000000003 145-149 20.9 28.560000000000002 27.185 23.355 150 20.150000000000002 27.85 26.875 25.124999999999996 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 3.0 23 3.5 24 2.5 25 4.0 26 7.5 27 9.0 28 11.5 29 17.5 30 23.0 31 23.5 32 31.5 33 48.5 34 60.0 35 70.5 36 87.0 37 104.5 38 124.0 39 165.5 40 215.0 41 226.5 42 244.5 43 269.5 44 263.5 45 265.0 46 250.0 47 235.0 48 233.5 49 207.0 50 163.5 51 133.0 52 112.5 53 93.0 54 78.0 55 61.0 56 43.0 57 31.5 58 22.0 59 11.5 60 7.0 61 6.5 62 8.5 63 5.0 64 1.5 65 2.5 66 2.0 67 1.0 68 0.5 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59809093192665 99.125 2 0.37678975131876413 0.75 3 0.0 0.0 4 0.0 0.0 5 0.025119316754584273 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACCCTTAGATCTCGTATGC 5 0.125 TruSeq Adapter, Index 8 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 0.9375 0.0 0.0 0.0 0.0 110-111 1.0499999999999998 0.0 0.0 0.0 0.0 112-113 1.1625 0.0 0.0 0.0 0.0 114-115 1.3125 0.0 0.0 0.0 0.0 116-117 1.5125000000000002 0.0 0.0 0.0 0.0 118-119 1.6375 0.0 0.0 0.0 0.0 120-121 1.8375 0.0 0.0 0.0 0.0 122-123 2.1125 0.0 0.0 0.0 0.0 124-125 2.4375 0.0 0.0 0.0 0.0 126-127 2.825 0.0 0.0 0.0 0.0 128-129 3.1500000000000004 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.5999999999999996 0.0 0.0 0.0 0.0 134-135 3.9875 0.0 0.0 0.0 0.0 136-137 4.375 0.0 0.0 0.0 0.0 138 4.7 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTACAAG 10 0.006973645 144.0 5 AGATCTG 10 0.006973645 144.0 4 >>END_MODULE SRR6031394 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031394_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.575 33.0 33.0 34.0 32.0 34.0 2 32.654 33.0 33.0 34.0 32.0 34.0 3 32.701 34.0 33.0 34.0 32.0 34.0 4 32.66375 34.0 33.0 34.0 32.0 34.0 5 32.67925 34.0 33.0 34.0 32.0 34.0 6 36.8355 38.0 38.0 38.0 36.0 38.0 7 36.78075 38.0 38.0 38.0 36.0 38.0 8 36.8655 38.0 38.0 38.0 36.0 38.0 9 36.71575 38.0 38.0 38.0 36.0 38.0 10-14 36.7609 38.0 38.0 38.0 36.0 38.0 15-19 36.6743 38.0 38.0 38.0 36.0 38.0 20-24 36.701800000000006 38.0 38.0 38.0 36.0 38.0 25-29 36.72500000000001 38.0 38.0 38.0 36.0 38.0 30-34 36.6915 38.0 38.0 38.0 36.0 38.0 35-39 36.5804 38.0 38.0 38.0 35.8 38.0 40-44 36.3374 38.0 38.0 38.0 35.2 38.0 45-49 36.5802 38.0 38.0 38.0 35.8 38.0 50-54 36.546800000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.541399999999996 38.0 38.0 38.0 35.4 38.0 60-64 36.5261 38.0 38.0 38.0 35.4 38.0 65-69 36.503699999999995 38.0 38.0 38.0 35.6 38.0 70-74 36.416900000000005 38.0 38.0 38.0 35.2 38.0 75-79 36.3316 38.0 38.0 38.0 35.0 38.0 80-84 35.792449999999995 38.0 38.0 38.0 33.8 38.0 85-89 35.160199999999996 38.0 38.0 38.0 31.0 38.0 90-94 35.128750000000004 38.0 38.0 38.0 31.0 38.0 95-99 35.00235 38.0 38.0 38.0 29.6 38.0 100-104 35.519349999999996 38.0 38.0 38.0 29.8 38.0 105-109 35.78335 38.0 38.0 38.0 33.4 38.0 110-114 35.75735 38.0 38.0 38.0 33.2 38.0 115-119 35.59975 38.0 38.0 38.0 32.2 38.0 120-124 35.39595 38.0 37.6 38.0 31.4 38.0 125-129 34.7975 38.0 37.0 38.0 27.8 38.0 130-134 33.49315 38.0 36.0 38.0 15.8 38.0 135-139 32.7644 38.0 35.4 38.0 8.6 38.0 140-144 32.27589999999999 38.0 33.4 38.0 2.0 38.0 145-149 31.836599999999997 38.0 33.0 38.0 2.0 38.0 150 23.999 32.0 2.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 23.0 3 4.0 4 1.0 5 5.0 6 2.0 7 3.0 8 3.0 9 5.0 10 3.0 11 5.0 12 3.0 13 4.0 14 2.0 15 9.0 16 3.0 17 1.0 18 15.0 19 11.0 20 9.0 21 9.0 22 13.0 23 17.0 24 26.0 25 33.0 26 30.0 27 62.0 28 50.0 29 43.0 30 41.0 31 70.0 32 82.0 33 115.0 34 112.0 35 182.0 36 393.0 37 2611.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.03152364273205 21.065799349512133 12.83462596947711 24.06805103827871 2 28.325 22.625 31.85 17.2 3 20.424999999999997 25.650000000000002 34.325 19.6 4 22.85 34.875 23.3 18.975 5 25.0 36.075 23.025000000000002 15.9 6 20.075000000000003 38.675 23.275000000000002 17.974999999999998 7 19.525000000000002 20.025000000000002 40.775 19.675 8 21.325 24.375 28.249999999999996 26.05 9 22.55 25.05 28.075 24.325 10-14 22.735 28.875 27.62 20.77 15-19 22.745 28.439999999999998 28.299999999999997 20.515 20-24 22.455 29.095 28.205000000000002 20.244999999999997 25-29 23.565 27.97 27.83 20.635 30-34 22.585 28.449999999999996 28.660000000000004 20.305 35-39 22.59923817161187 27.666399358460303 28.9093825180433 20.824979951884522 40-44 22.92926239419589 27.967553405884725 28.74848851269649 20.354695687222893 45-49 23.199639927985597 28.075615123024605 28.335667133426686 20.389077815563112 50-54 22.845 28.12 28.565 20.47 55-59 23.175 27.839999999999996 28.09 20.895 60-64 22.525000000000002 27.58 28.565 21.33 65-69 22.915 27.810000000000002 28.345 20.93 70-74 22.985 27.55 28.54 20.925 75-79 22.564999999999998 27.779999999999998 28.804999999999996 20.849999999999998 80-84 22.927546519292196 27.99776910206358 28.9154793895452 20.159204989099024 85-89 22.948790676086844 27.72420194935795 28.45650043834769 20.87050693620752 90-94 23.41370230781145 27.73504052867985 28.302958335484536 20.548298828024162 95-99 22.795409903856097 27.307970639925568 29.12746821048279 20.769151245735554 100-104 23.46959323399114 27.5724929520741 28.13632702376158 20.82158679017318 105-109 23.69 27.560000000000002 28.525 20.225 110-114 23.765 27.700000000000003 28.12 20.415 115-119 23.515 27.534999999999997 28.65 20.3 120-124 23.765 27.57 28.09 20.575 125-129 24.153270650085936 27.797998180163784 28.03558790819937 20.013143261550905 130-134 23.438965912644637 28.1663713124153 28.385280934014386 20.009381840925673 135-139 24.108568387440126 27.903139968068118 28.179882916444914 19.808408728046835 140-144 23.873183619550858 28.110964332893 27.978863936591807 20.036988110964334 145-149 24.351570415400204 27.993920972644375 27.993920972644375 19.660587639311046 150 25.374999999999996 26.3 28.499999999999996 19.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 1.0 17 1.0 18 1.0 19 2.0 20 1.5 21 0.5 22 1.0 23 2.0 24 3.5 25 5.5 26 8.0 27 7.0 28 9.0 29 16.5 30 20.5 31 28.0 32 41.5 33 56.0 34 64.0 35 77.5 36 98.5 37 128.5 38 146.0 39 161.0 40 203.5 41 228.5 42 269.0 43 286.0 44 264.0 45 266.0 46 258.5 47 235.0 48 216.0 49 202.5 50 165.5 51 125.0 52 102.5 53 74.5 54 56.0 55 46.5 56 31.0 57 22.5 58 19.0 59 14.0 60 8.5 61 6.5 62 5.5 63 3.0 64 2.0 65 1.5 66 1.0 67 1.5 68 2.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.075 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.24 40-44 0.76 45-49 0.02 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.385 85-89 3.045 90-94 3.1550000000000002 95-99 3.27 100-104 0.6799999999999999 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.09 130-134 4.07 135-139 6.05 140-144 5.375 145-149 1.3 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57307885484681 99.125 2 0.4018081366147665 0.8 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.36250000000000004 0.0 0.0 0.0 0.0 100-101 0.4625 0.0 0.0 0.0 0.0 102-103 0.5625 0.0 0.0 0.0 0.0 104-105 0.6875 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 0.8999999999999999 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.1375000000000002 0.0 0.0 0.0 0.0 114-115 1.2875 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.7875 0.0 0.0 0.0 0.0 122-123 2.05 0.0 0.0 0.0 0.0 124-125 2.3625 0.0 0.0 0.0 0.0 126-127 2.7 0.0 0.0 0.0 0.0 128-129 3.0 0.0 0.0 0.0 0.0 130-131 3.2375 0.0 0.0 0.0 0.0 132-133 3.4749999999999996 0.0 0.0 0.0 0.0 134-135 3.8375 0.0 0.0 0.0 0.0 136-137 4.199999999999999 0.0 0.0 0.0 0.0 138 4.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998788 spots for SRR6031394.sra Written 998788 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra Read 998780 spots for SRR6031394.sra Written 998780 spots for SRR6031394.sra SRR ids: ['SRR6031394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nh5mpj6z SRR6031394.sra spots: 19975608 blocks: [[1, 998780], [998781, 1997560], [1997561, 2996340], [2996341, 3995120], [3995121, 4993900], [4993901, 5992680], [5992681, 6991460], [6991461, 7990240], [7990241, 8989020], [8989021, 9987800], [9987801, 10986580], [10986581, 11985360], [11985361, 12984140], [12984141, 13982920], [13982921, 14981700], [14981701, 15980480], [15980481, 16979260], [16979261, 17978040], [17978041, 18976820], [18976821, 19975608]] SRR6031394 file size 6708362 SRR6031394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031394 SRR6031394_1.fastq SRR6031394_2.fastq Input file: SRR6031394_1.fastq Paired file: SRR6031394_2.fastq trimmed: SRR6031394-trimmed-pair1.fastq, SRR6031394-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:24:23 2025 >> started Fri Feb 14 08:24:43 2025 >> done (20.536s) 19975608 read pairs processed; of these: 35806 ( 0.18%) short read pairs filtered out after trimming by size control 59847 ( 0.30%) empty read pairs filtered out after trimming by size control 19879955 (99.52%) read pairs available; of these: 7760285 (39.04%) trimmed read pairs available after processing 12119670 (60.96%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 10 0.00% 20 8 0.00% 21 9 0.00% 22 10 0.00% 23 13 0.00% 24 10 0.00% 25 17 0.00% 26 16 0.00% 27 15 0.00% 28 18 0.00% 29 24 0.00% 30 15 0.00% 31 25 0.00% 32 20 0.00% 33 16 0.00% 34 22 0.00% 35 19 0.00% 36 24 0.00% 37 23 0.00% 38 35 0.00% 39 24 0.00% 40 51 0.00% 41 42 0.00% 42 47 0.00% 43 43 0.00% 44 48 0.00% 45 65 0.00% 46 73 0.00% 47 98 0.00% 48 74 0.00% 49 102 0.00% 50 86 0.00% 51 122 0.00% 52 121 0.00% 53 132 0.00% 54 146 0.00% 55 134 0.00% 56 150 0.00% 57 173 0.00% 58 182 0.00% 59 218 0.00% 60 211 0.00% 61 281 0.00% 62 287 0.00% 63 307 0.00% 64 363 0.00% 65 375 0.00% 66 415 0.00% 67 502 0.00% 68 615 0.00% 69 809 0.00% 70 1013 0.01% 71 868 0.00% 72 901 0.00% 73 980 0.00% 74 1053 0.01% 75 1213 0.01% 76 1325 0.01% 77 1354 0.01% 78 1549 0.01% 79 1739 0.01% 80 1961 0.01% 81 2342 0.01% 82 2654 0.01% 83 3273 0.02% 84 5828 0.03% 85 6225 0.03% 86 6315 0.03% 87 6282 0.03% 88 6596 0.03% 89 6741 0.03% 90 7256 0.04% 91 7754 0.04% 92 8308 0.04% 93 8748 0.04% 94 9392 0.05% 95 9868 0.05% 96 10507 0.05% 97 11254 0.06% 98 11568 0.06% 99 11984 0.06% 100 12666 0.06% 101 13213 0.07% 102 14470 0.07% 103 15319 0.08% 104 16435 0.08% 105 17523 0.09% 106 18160 0.09% 107 19010 0.10% 108 19554 0.10% 109 20107 0.10% 110 20988 0.11% 111 21796 0.11% 112 22791 0.11% 113 24319 0.12% 114 25189 0.13% 115 26569 0.13% 116 27795 0.14% 117 28626 0.14% 118 29408 0.15% 119 30381 0.15% 120 30826 0.16% 121 32338 0.16% 122 33253 0.17% 123 35447 0.18% 124 37318 0.19% 125 39292 0.20% 126 40970 0.21% 127 43494 0.22% 128 44521 0.22% 129 46721 0.24% 130 48715 0.25% 131 50282 0.25% 132 53086 0.27% 133 55787 0.28% 134 58803 0.30% 135 63586 0.32% 136 69293 0.35% 137 75352 0.38% 138 80703 0.41% 139 86333 0.43% 140 91461 0.46% 141 96387 0.48% 142 105221 0.53% 143 118416 0.60% 144 137291 0.69% 145 164677 0.83% 146 215691 1.08% 147 318340 1.60% 148 620496 3.12% 149 4278366 21.52% 150 12119670 60.96% 19879955 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=7.11 fanout-score-rank=20 prefix-density=0.23 prefix-fanout=4.5 sequence=GCTCTCCACCTCCA criterion=fanout-score sequence-density=0.04 sequence-density-rank=39 fanout-score=35.42 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.6 sequence=CAAAGATCATGCCACCAAA criterion=sequence-density sequence-density=0.16 sequence-density-rank=1 fanout-score=4.75 fanout-score-rank=26 prefix-density=0.22 prefix-fanout=3.5 sequence=ACCCAGAAGATGAGCT criterion=fanout-score sequence-density=0.04 sequence-density-rank=35 fanout-score=35.32 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=7.8 sequence=AGGAAGCAGCTGATCCTGAAGAGCAATTCGCTAGCCTGTTAAAGTTAATTA SRR6031394 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:25:38 Started mapping on | Feb 14 08:25:38 Finished on | Feb 14 08:27:58 Mapping speed, Million of reads per hour | 511.20 Number of input reads | 19879955 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 18507063 Uniquely mapped reads % | 93.09% Average mapped length | 293.56 Number of splices: Total | 15923261 Number of splices: Annotated (sjdb) | 15575196 Number of splices: GT/AG | 15645850 Number of splices: GC/AG | 207985 Number of splices: AT/AC | 9797 Number of splices: Non-canonical | 59629 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.03% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 904195 % of reads mapped to multiple loci | 4.55% Number of reads mapped to too many loci | 38115 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 504602 504602 504602 N_multimapping 904195 904195 904195 N_noFeature 529040 18151848 710702 N_ambiguous 301098 2981 125523 UnstrandedReadsAssigned:17676925 PositiveStrandReadsAssigned:352234 NegativeStrandReadsAssigned:17670838 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031394 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031394-trimmed-pair1.fastq SRR6031394-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,879,955 reads, 18,028,908 reads pseudoaligned [quant] estimated average fragment length: 255.04 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR6031394.ke.tsv 34699 SRR6031394.se.tsv 87100 total ==> SRR6031394.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.96 521 14.906 Potri.005G024800.1.v4.1 1035 780.96 1333 86.1416 Potri.004G059700.1.v4.1 961 707.017 12 0.85657 Potri.007G009000.2.v4.1 1416 1161.96 0 0 Potri.003G141000.2.v4.1 2943 2688.96 331 6.21234 Potri.016G087400.1.v4.1 270 76.1699 986.659 653.725 Potri.015G069301.1.v4.1 564 317.371 0 0 Potri.010G195200.1.v4.1 1773 1518.96 198 6.57855 Potri.012G127500.1.v4.1 977 722.993 1773 123.762 ==> SRR6031394.se.tsv <== Potri.001G166300.v4.1 301 Potri.001G448400.v4.1 27 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 522 Potri.001G212900.v4.1 98 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 2 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 10 Potri.001G452600.v4.1 7 SRR6031394 completed mapping pipeline successfully