Starting /dee2/code/volunteer_pipeline.sh SRR6031395 current disk space = 3118514339840 free memory = 1581176332 SRR6031395 SRAfilesize fc1970c8781e46a68b0fb2a8289bd36b SRR6031395.sra SRR6031395.sra file validated SRR6031395 is paired end SRR6031395 is conventional basespace SRR6031395 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.762 34.0 33.0 34.0 33.0 34.0 2 33.31575 34.0 33.0 34.0 33.0 34.0 3 33.41325 34.0 34.0 34.0 33.0 34.0 4 33.4445 34.0 34.0 34.0 33.0 34.0 5 33.44125 34.0 34.0 34.0 33.0 34.0 6 37.2085 38.0 38.0 38.0 36.0 38.0 7 37.38775 38.0 38.0 38.0 37.0 38.0 8 37.39375 38.0 38.0 38.0 37.0 38.0 9 37.4385 38.0 38.0 38.0 37.0 38.0 10-14 37.4088 38.0 38.0 38.0 37.0 38.0 15-19 37.4298 38.0 38.0 38.0 37.2 38.0 20-24 37.47545 38.0 38.0 38.0 37.6 38.0 25-29 37.427350000000004 38.0 38.0 38.0 37.4 38.0 30-34 37.37025 38.0 38.0 38.0 37.0 38.0 35-39 37.327600000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.16075 38.0 38.0 38.0 36.4 38.0 45-49 37.1553 38.0 38.0 38.0 36.6 38.0 50-54 37.0512 38.0 38.0 38.0 36.0 38.0 55-59 37.094049999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.0955 38.0 38.0 38.0 36.0 38.0 65-69 37.07455 38.0 38.0 38.0 36.0 38.0 70-74 36.999399999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.8913 38.0 38.0 38.0 35.6 38.0 80-84 36.8326 38.0 38.0 38.0 35.2 38.0 85-89 36.8435 38.0 38.0 38.0 35.4 38.0 90-94 36.79835 38.0 38.0 38.0 35.4 38.0 95-99 36.7177 38.0 38.0 38.0 35.0 38.0 100-104 36.65405 38.0 38.0 38.0 34.6 38.0 105-109 36.4346 38.0 38.0 38.0 34.0 38.0 110-114 36.39005 38.0 38.0 38.0 34.0 38.0 115-119 36.2324 38.0 38.0 38.0 33.8 38.0 120-124 36.1204 38.0 38.0 38.0 33.8 38.0 125-129 35.8682 38.0 37.0 38.0 32.2 38.0 130-134 35.7779 38.0 37.0 38.0 31.8 38.0 135-139 35.62565 38.0 36.4 38.0 31.8 38.0 140-144 35.18765 38.0 36.0 38.0 31.0 38.0 145-149 34.55625 38.0 36.0 38.0 28.8 38.0 150 28.223 33.0 26.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 1.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 0.0 17 1.0 18 3.0 19 3.0 20 4.0 21 5.0 22 7.0 23 8.0 24 6.0 25 10.0 26 13.0 27 22.0 28 26.0 29 41.0 30 26.0 31 45.0 32 63.0 33 99.0 34 114.0 35 200.0 36 504.0 37 2793.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.39316675165732 14.278429372768993 8.847526772055074 37.48087710351861 2 20.674999999999997 19.675 36.6 23.05 3 18.275 25.05 27.175 29.5 4 22.650000000000002 32.800000000000004 22.475 22.075 5 21.55 36.175000000000004 24.175 18.099999999999998 6 16.675 36.675000000000004 26.924999999999997 19.725 7 13.225000000000001 23.1 44.875 18.8 8 16.725 23.150000000000002 32.475 27.650000000000002 9 17.05 23.1 34.725 25.124999999999996 10-14 19.885 29.265 27.32 23.53 15-19 19.395 28.575 28.199999999999996 23.830000000000002 20-24 19.175 29.310000000000002 27.794999999999998 23.72 25-29 19.74 29.53 27.389999999999997 23.34 30-34 19.035 28.87 27.925 24.169999999999998 35-39 19.59 29.64 27.375 23.395 40-44 19.465 29.080000000000002 27.76 23.695 45-49 19.91 28.915000000000003 27.665 23.51 50-54 19.755 28.910000000000004 27.72 23.615 55-59 19.735 28.92 27.11 24.235 60-64 19.52 29.385 27.87 23.225 65-69 19.564999999999998 28.87 27.955000000000002 23.61 70-74 19.825 28.975 27.37 23.830000000000002 75-79 19.785 28.345 28.12 23.75 80-84 19.725 28.194999999999997 28.675 23.405 85-89 19.88 28.68 28.165000000000003 23.275000000000002 90-94 20.080000000000002 28.07 28.000000000000004 23.849999999999998 95-99 19.685 29.404999999999998 27.655 23.255 100-104 20.24 28.32 28.565 22.875 105-109 20.22 28.57 28.000000000000004 23.21 110-114 19.77 28.435 28.53 23.265 115-119 20.115 28.455000000000002 28.27 23.16 120-124 20.145 28.194999999999997 28.165000000000003 23.494999999999997 125-129 19.96 28.505000000000003 28.23 23.305 130-134 20.48 28.27 28.15 23.1 135-139 19.825 28.725 27.925 23.525 140-144 20.294999999999998 28.49 27.71 23.505000000000003 145-149 20.424999999999997 28.475 27.415 23.685000000000002 150 20.225 28.15 28.225 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 1.0 19 0.5 20 1.0 21 2.5 22 2.5 23 2.0 24 1.0 25 2.5 26 3.5 27 4.5 28 10.5 29 16.5 30 20.0 31 27.0 32 36.0 33 57.0 34 73.5 35 82.0 36 104.5 37 120.0 38 145.0 39 190.0 40 220.0 41 231.5 42 249.5 43 259.5 44 272.0 45 279.5 46 254.5 47 230.0 48 217.5 49 189.5 50 153.5 51 118.5 52 93.0 53 76.0 54 64.0 55 52.5 56 35.0 57 27.5 58 17.5 59 15.0 60 11.5 61 4.5 62 8.0 63 6.5 64 2.0 65 2.5 66 2.0 67 0.5 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.84977466199298 99.7 2 0.15022533800701052 0.3 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.25 0.0 0.0 0.0 0.0 108-109 0.2875 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5625 0.0 0.0 0.0 0.0 116-117 0.625 0.0 0.0 0.0 0.0 118-119 0.7125 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 1.025 0.0 0.0 0.0 0.0 124-125 1.1625 0.0 0.0 0.0 0.0 126-127 1.275 0.0 0.0 0.0 0.0 128-129 1.375 0.0 0.0 0.0 0.0 130-131 1.55 0.0 0.0 0.0 0.0 132-133 1.775 0.0 0.0 0.0 0.0 134-135 2.0125 0.0 0.0 0.0 0.0 136-137 2.2875 0.0 0.0 0.0 0.0 138 2.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6031395 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6031395_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5785 33.0 33.0 34.0 32.0 34.0 2 32.69575 33.0 33.0 34.0 32.0 34.0 3 32.685 34.0 33.0 34.0 32.0 34.0 4 32.69625 34.0 33.0 34.0 32.0 34.0 5 32.8015 34.0 33.0 34.0 32.0 34.0 6 36.9055 38.0 38.0 38.0 36.0 38.0 7 36.9215 38.0 38.0 38.0 36.0 38.0 8 36.91225 38.0 38.0 38.0 36.0 38.0 9 36.938 38.0 38.0 38.0 36.0 38.0 10-14 36.89125 38.0 38.0 38.0 36.0 38.0 15-19 36.81805000000001 38.0 38.0 38.0 36.0 38.0 20-24 36.86045 38.0 38.0 38.0 36.0 38.0 25-29 36.873200000000004 38.0 38.0 38.0 36.0 38.0 30-34 36.836949999999995 38.0 38.0 38.0 36.0 38.0 35-39 36.726 38.0 38.0 38.0 36.0 38.0 40-44 36.3956 38.0 38.0 38.0 35.6 38.0 45-49 36.7418 38.0 38.0 38.0 35.8 38.0 50-54 36.7464 38.0 38.0 38.0 36.0 38.0 55-59 36.67875 38.0 38.0 38.0 35.8 38.0 60-64 36.66105 38.0 38.0 38.0 35.6 38.0 65-69 36.62695 38.0 38.0 38.0 35.8 38.0 70-74 36.6403 38.0 38.0 38.0 36.0 38.0 75-79 36.5767 38.0 38.0 38.0 35.6 38.0 80-84 35.90345 38.0 38.0 38.0 34.2 38.0 85-89 35.17135 38.0 38.0 38.0 32.0 38.0 90-94 35.0497 38.0 38.0 38.0 29.8 38.0 95-99 34.95129999999999 38.0 38.0 38.0 29.2 38.0 100-104 35.80455 38.0 38.0 38.0 31.6 38.0 105-109 36.2208 38.0 38.0 38.0 34.0 38.0 110-114 36.13935 38.0 38.0 38.0 34.0 38.0 115-119 36.02045 38.0 38.0 38.0 33.6 38.0 120-124 35.858050000000006 38.0 38.0 38.0 33.4 38.0 125-129 35.0206 38.0 37.2 38.0 29.0 38.0 130-134 33.665049999999994 38.0 36.0 38.0 17.0 38.0 135-139 32.71894999999999 38.0 35.8 38.0 6.4 38.0 140-144 32.55195 38.0 34.4 38.0 6.4 38.0 145-149 32.33755 38.0 34.0 38.0 2.0 38.0 150 26.2575 33.0 15.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 4.0 4 5.0 5 2.0 6 4.0 7 2.0 8 3.0 9 2.0 10 3.0 11 3.0 12 1.0 13 3.0 14 5.0 15 4.0 16 8.0 17 5.0 18 5.0 19 6.0 20 6.0 21 5.0 22 9.0 23 21.0 24 28.0 25 42.0 26 41.0 27 54.0 28 51.0 29 60.0 30 52.0 31 54.0 32 75.0 33 122.0 34 99.0 35 186.0 36 377.0 37 2646.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.81990995497749 17.608804402201102 14.4072036018009 28.16408204102051 2 26.6 23.9 32.925 16.575 3 20.825 28.075 31.3 19.8 4 23.549999999999997 34.449999999999996 22.825 19.175 5 24.349999999999998 37.125 22.85 15.675 6 18.275 38.125 25.6 18.0 7 19.975 17.875 41.05 21.099999999999998 8 19.475 24.25 29.099999999999998 27.175 9 21.525 25.0 30.275000000000002 23.200000000000003 10-14 22.86 29.785 26.185000000000002 21.17 15-19 22.82 27.74 28.455000000000002 20.985 20-24 22.035 27.83 28.665000000000003 21.47 25-29 22.685 28.515 28.625 20.175 30-34 22.375 27.894999999999996 28.599999999999998 21.13 35-39 22.359499773994273 27.93933001858269 29.07438099542966 20.626789211993373 40-44 23.001821125050586 28.004856333468233 28.505665722379604 20.48765681910158 45-49 23.125 27.6 28.405 20.87 50-54 22.11 28.96 28.18 20.75 55-59 22.925 27.24 28.65 21.185000000000002 60-64 22.755 28.804999999999996 28.16 20.28 65-69 23.01 28.105000000000004 28.52 20.365 70-74 23.14 27.860000000000003 28.294999999999998 20.705000000000002 75-79 22.62 28.255000000000003 28.62 20.505000000000003 80-84 23.1090298279548 28.972818894431434 27.92934948590044 19.988801791713325 85-89 23.51289517470882 28.17179700499168 28.166597337770384 20.14871048252912 90-94 23.133357614860294 27.758988500962587 28.81003173942453 20.297622144752587 95-99 22.872451102788183 28.740116521015395 28.68289637952559 19.704535996670828 100-104 23.020063357972546 28.621712676622916 28.03841705636848 20.319806909036053 105-109 23.175 27.939999999999998 28.26 20.625 110-114 23.119999999999997 27.52 29.160000000000004 20.200000000000003 115-119 23.294999999999998 28.34 27.925 20.44 120-124 23.34 27.834999999999997 28.744999999999997 20.080000000000002 125-129 23.536281927588483 28.050576346925304 28.081044025795972 20.332097699690248 130-134 23.75699356064605 28.317322917766287 27.72616911221366 20.19951440937401 135-139 23.55553148860129 28.185411815671195 28.32078843342178 19.938268262305733 140-144 24.046230402910805 28.171651773770666 28.193054738081223 19.589063085237303 145-149 23.741116751269036 28.258883248730964 28.19289340101523 19.807106598984774 150 24.175 26.85 29.25 19.725 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.0 21 1.0 22 3.0 23 4.5 24 6.5 25 11.5 26 12.0 27 11.5 28 15.5 29 22.5 30 27.0 31 31.0 32 40.0 33 50.0 34 70.5 35 73.5 36 92.0 37 133.5 38 152.5 39 176.0 40 200.5 41 236.0 42 253.5 43 257.5 44 271.5 45 270.0 46 256.0 47 237.5 48 212.5 49 187.5 50 155.5 51 126.5 52 102.5 53 81.0 54 65.0 55 42.5 56 28.5 57 20.5 58 16.0 59 11.0 60 10.0 61 7.5 62 4.0 63 3.5 64 2.0 65 1.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.445 40-44 1.16 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 1.77 85-89 3.84 90-94 3.9050000000000002 95-99 3.88 100-104 0.565 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 1.5350000000000001 130-134 5.27 135-139 7.664999999999999 140-144 6.555 145-149 1.5 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.025 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.025 0.0 0.0 0.0 0.0 90-91 0.05 0.0 0.0 0.0 0.0 92-93 0.0625 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.2 0.0 0.0 0.0 0.0 104-105 0.2 0.0 0.0 0.0 0.0 106-107 0.225 0.0 0.0 0.0 0.0 108-109 0.2625 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.6 0.0 0.0 0.0 0.0 118-119 0.6875 0.0 0.0 0.0 0.0 120-121 0.8125 0.0 0.0 0.0 0.0 122-123 1.0 0.0 0.0 0.0 0.0 124-125 1.125 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.5 0.0 0.0 0.0 0.0 132-133 1.6875 0.0 0.0 0.0 0.0 134-135 1.9 0.0 0.0 0.0 0.0 136-137 2.0875 0.0 0.0 0.0 0.0 138 2.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGGGTT 10 0.007250439 142.1375 2 >>END_MODULE Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra Read 1278725 spots for SRR6031395.sra Written 1278725 spots for SRR6031395.sra SRR ids: ['SRR6031395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hxtc88m6 SRR6031395.sra spots: 25574500 blocks: [[1, 1278725], [1278726, 2557450], [2557451, 3836175], [3836176, 5114900], [5114901, 6393625], [6393626, 7672350], [7672351, 8951075], [8951076, 10229800], [10229801, 11508525], [11508526, 12787250], [12787251, 14065975], [14065976, 15344700], [15344701, 16623425], [16623426, 17902150], [17902151, 19180875], [19180876, 20459600], [20459601, 21738325], [21738326, 23017050], [23017051, 24295775], [24295776, 25574500]] SRR6031395 file size 8594708 SRR6031395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6031395 SRR6031395_1.fastq SRR6031395_2.fastq Input file: SRR6031395_1.fastq Paired file: SRR6031395_2.fastq trimmed: SRR6031395-trimmed-pair1.fastq, SRR6031395-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Fri Feb 14 08:07:41 2025 >> started Fri Feb 14 08:08:08 2025 >> done (26.758s) 25574500 read pairs processed; of these: 28862 ( 0.11%) short read pairs filtered out after trimming by size control 28067 ( 0.11%) empty read pairs filtered out after trimming by size control 25517571 (99.78%) read pairs available; of these: 9162020 (35.90%) trimmed read pairs available after processing 16355551 (64.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 5 0.00% 20 4 0.00% 21 4 0.00% 22 9 0.00% 23 5 0.00% 24 10 0.00% 25 9 0.00% 26 6 0.00% 27 7 0.00% 28 11 0.00% 29 10 0.00% 30 17 0.00% 31 10 0.00% 32 10 0.00% 33 11 0.00% 34 15 0.00% 35 14 0.00% 36 11 0.00% 37 20 0.00% 38 21 0.00% 39 17 0.00% 40 25 0.00% 41 33 0.00% 42 27 0.00% 43 33 0.00% 44 37 0.00% 45 37 0.00% 46 54 0.00% 47 47 0.00% 48 57 0.00% 49 62 0.00% 50 80 0.00% 51 74 0.00% 52 91 0.00% 53 83 0.00% 54 99 0.00% 55 105 0.00% 56 121 0.00% 57 125 0.00% 58 139 0.00% 59 156 0.00% 60 152 0.00% 61 183 0.00% 62 217 0.00% 63 227 0.00% 64 258 0.00% 65 270 0.00% 66 282 0.00% 67 370 0.00% 68 467 0.00% 69 569 0.00% 70 606 0.00% 71 509 0.00% 72 506 0.00% 73 599 0.00% 74 659 0.00% 75 761 0.00% 76 817 0.00% 77 844 0.00% 78 952 0.00% 79 1122 0.00% 80 1231 0.00% 81 1363 0.01% 82 1572 0.01% 83 2061 0.01% 84 4033 0.02% 85 4166 0.02% 86 4359 0.02% 87 4550 0.02% 88 4734 0.02% 89 4982 0.02% 90 5236 0.02% 91 5599 0.02% 92 5896 0.02% 93 6459 0.03% 94 6677 0.03% 95 7060 0.03% 96 7497 0.03% 97 8040 0.03% 98 8442 0.03% 99 8685 0.03% 100 9180 0.04% 101 9913 0.04% 102 10455 0.04% 103 11140 0.04% 104 12026 0.05% 105 12865 0.05% 106 13467 0.05% 107 14117 0.06% 108 14911 0.06% 109 15703 0.06% 110 16513 0.06% 111 17511 0.07% 112 18401 0.07% 113 19407 0.08% 114 20313 0.08% 115 21344 0.08% 116 22277 0.09% 117 23274 0.09% 118 24555 0.10% 119 25344 0.10% 120 26390 0.10% 121 27644 0.11% 122 29008 0.11% 123 30690 0.12% 124 32140 0.13% 125 34068 0.13% 126 35759 0.14% 127 37928 0.15% 128 39516 0.15% 129 42134 0.17% 130 44796 0.18% 131 46956 0.18% 132 50118 0.20% 133 53311 0.21% 134 56561 0.22% 135 60834 0.24% 136 67524 0.26% 137 75325 0.30% 138 84466 0.33% 139 91275 0.36% 140 97302 0.38% 141 105387 0.41% 142 117061 0.46% 143 135641 0.53% 144 161157 0.63% 145 199043 0.78% 146 295519 1.16% 147 395428 1.55% 148 798337 3.13% 149 5443254 21.33% 150 16355551 64.10% 25517571 reads passed initial QC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=39 prefix-density=0.09 prefix-fanout=2.0 sequence=ACTACATAGGATATGCAAGGGGTTAAGGTGTTAATCACCTGATTACATGAAATCGCTGCTTTAGTGGTGGATGCAGTCATGACCATGATGCACACAACCAAGCAAACTAAATGAAGGGCTCTCGGACCTGCCATGATTGATGAATCTATTG criterion=fanout-score sequence-density=0.05 sequence-density-rank=17 fanout-score=576.22 fanout-score-rank=1 prefix-density=0.85 prefix-fanout=36.1 sequence=CTTCTTCTTCTC criterion=sequence-density sequence-density=0.09 sequence-density-rank=1 fanout-score=377.37 fanout-score-rank=3 prefix-density=0.96 prefix-fanout=34.2 sequence=AAGAAGAAGAAA criterion=fanout-score sequence-density=0.06 sequence-density-rank=13 fanout-score=536.18 fanout-score-rank=1 prefix-density=0.96 prefix-fanout=34.2 sequence=AAGAAGAAGAAG SRR6031395 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 14 08:08:48 Started mapping on | Feb 14 08:08:48 Finished on | Feb 14 08:10:50 Mapping speed, Million of reads per hour | 752.98 Number of input reads | 25517571 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 24469919 Uniquely mapped reads % | 95.89% Average mapped length | 295.50 Number of splices: Total | 22854172 Number of splices: Annotated (sjdb) | 22347255 Number of splices: GT/AG | 22470067 Number of splices: GC/AG | 321192 Number of splices: AT/AC | 18979 Number of splices: Non-canonical | 43934 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.02% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 1.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 575492 % of reads mapped to multiple loci | 2.26% Number of reads mapped to too many loci | 31752 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.68% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 504452 504452 504452 N_multimapping 575492 575492 575492 N_noFeature 996413 24163448 1183478 N_ambiguous 246599 1512 126237 UnstrandedReadsAssigned:23226907 PositiveStrandReadsAssigned:304959 NegativeStrandReadsAssigned:23160204 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=149 echo kmer=145 SRR6031395 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6031395-trimmed-pair1.fastq SRR6031395-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,517,571 reads, 23,321,414 reads pseudoaligned [quant] estimated average fragment length: 278.713 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,185 rounds 52401 SRR6031395.ke.tsv 34699 SRR6031395.se.tsv 87100 total ==> SRR6031395.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.29 1578 41.1189 Potri.005G024800.1.v4.1 1035 757.287 498 29.8211 Potri.004G059700.1.v4.1 961 683.426 133 8.82501 Potri.007G009000.2.v4.1 1416 1138.29 2 0.0796771 Potri.003G141000.2.v4.1 2943 2665.29 1294.88 22.0314 Potri.016G087400.1.v4.1 270 66.7193 1854 1260.12 Potri.015G069301.1.v4.1 564 298.368 0 0 Potri.010G195200.1.v4.1 1773 1495.29 129 3.91219 Potri.012G127500.1.v4.1 977 699.368 1935 125.467 ==> SRR6031395.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 18 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 361 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 25 SRR6031395 completed mapping pipeline successfully