Starting /dee2/code/volunteer_pipeline.sh SRR6053275 current disk space = 3049800949760 free memory = 1494043012 SRR6053275 SRAfilesize ac33cff150d18e76904a38fd42104112 SRR6053275.sra SRR6053275.sra file validated SRR6053275 is paired end SRR6053275 is conventional basespace SRR6053275 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053275_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.41725 34.0 33.0 34.0 32.0 34.0 2 33.23925 34.0 33.0 34.0 32.0 34.0 3 33.32925 34.0 33.0 34.0 32.0 34.0 4 33.431 34.0 34.0 34.0 33.0 34.0 5 33.3785 34.0 33.0 34.0 33.0 34.0 6 36.938 38.0 37.0 38.0 35.0 38.0 7 37.40825 38.0 38.0 38.0 37.0 38.0 8 37.41875 38.0 38.0 38.0 37.0 38.0 9 37.49725 38.0 38.0 38.0 38.0 38.0 10-14 37.4956 38.0 38.0 38.0 37.6 38.0 15-19 37.5272 38.0 38.0 38.0 38.0 38.0 20-24 37.5038 38.0 38.0 38.0 37.8 38.0 25-29 37.46105 38.0 38.0 38.0 37.4 38.0 30-34 37.4619 38.0 38.0 38.0 37.8 38.0 35-39 37.3948 38.0 38.0 38.0 37.0 38.0 40-44 37.3644 38.0 38.0 38.0 37.0 38.0 45-49 37.34935 38.0 38.0 38.0 37.0 38.0 50-54 37.294650000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.257600000000004 38.0 38.0 38.0 37.0 38.0 60-64 37.24945 38.0 38.0 38.0 37.0 38.0 65-69 37.2299 38.0 38.0 38.0 36.8 38.0 70-74 37.17434999999999 38.0 38.0 38.0 37.0 38.0 75-79 37.1365 38.0 38.0 38.0 36.4 38.0 80-84 37.101800000000004 38.0 38.0 38.0 36.0 38.0 85-89 37.01755 38.0 38.0 38.0 36.0 38.0 90-94 36.879949999999994 38.0 38.0 38.0 36.0 38.0 95-99 36.781800000000004 38.0 38.0 38.0 35.4 38.0 100-104 36.76505 38.0 38.0 38.0 35.0 38.0 105-109 36.6808 38.0 38.0 38.0 35.0 38.0 110-114 36.57745 38.0 38.0 38.0 34.8 38.0 115-119 36.38035 38.0 38.0 38.0 34.0 38.0 120-124 36.27395 38.0 38.0 38.0 34.0 38.0 125-129 36.178700000000006 38.0 38.0 38.0 33.8 38.0 130-134 36.060449999999996 38.0 37.8 38.0 33.4 38.0 135-139 35.848 38.0 37.0 38.0 33.0 38.0 140-144 35.55310000000001 38.0 36.4 38.0 32.2 38.0 145-149 35.008849999999995 38.0 36.0 38.0 30.4 38.0 150-151 32.398 36.5 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 2.0 19 5.0 20 4.0 21 6.0 22 2.0 23 5.0 24 5.0 25 9.0 26 19.0 27 18.0 28 23.0 29 26.0 30 24.0 31 37.0 32 51.0 33 66.0 34 98.0 35 169.0 36 464.0 37 2958.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.415698424993543 10.921766072811774 11.23160340821069 47.43093209398399 2 20.275000000000002 17.025000000000002 38.224999999999994 24.474999999999998 3 22.05 21.925 23.35 32.675 4 23.599999999999998 31.525 20.325 24.55 5 22.125 35.475 23.849999999999998 18.55 6 17.424999999999997 36.199999999999996 25.624999999999996 20.75 7 13.025 24.75 44.3 17.925 8 17.775 24.025 31.35 26.85 9 17.8 23.025000000000002 33.175 26.0 10-14 18.905 31.945 27.0 22.15 15-19 18.795 29.95 27.215 24.04 20-24 19.869999999999997 29.099999999999998 27.33 23.7 25-29 19.77 29.49 27.175 23.565 30-34 19.400000000000002 29.25 27.555000000000003 23.794999999999998 35-39 20.064999999999998 29.03 27.6 23.305 40-44 19.84 28.994999999999997 27.71 23.455000000000002 45-49 19.975 28.634999999999998 27.98 23.41 50-54 20.315 29.020000000000003 27.18 23.485 55-59 20.13 28.249999999999996 27.375 24.245 60-64 20.195 28.735 27.279999999999998 23.79 65-69 20.415 27.905 27.950000000000003 23.73 70-74 19.545 28.485 27.92 24.05 75-79 19.605 28.794999999999998 27.389999999999997 24.21 80-84 19.885 28.175 27.439999999999998 24.5 85-89 20.19 28.110000000000003 27.665 24.035 90-94 20.215 27.365000000000002 27.725 24.695 95-99 20.674999999999997 28.4 27.245 23.68 100-104 21.005 27.875 27.55 23.57 105-109 21.055 27.55 27.694999999999997 23.7 110-114 21.325 28.365000000000002 26.71 23.599999999999998 115-119 21.785 28.139999999999997 26.384999999999998 23.69 120-124 20.91 28.21 27.169999999999998 23.71 125-129 21.545 28.165000000000003 25.990000000000002 24.3 130-134 21.805 28.22 26.13 23.845 135-139 21.265 28.565 25.44 24.73 140-144 21.455 29.035 24.985 24.525 145-149 22.015 28.494999999999997 24.895 24.595 150-151 21.9 29.349999999999998 24.6625 24.087500000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 1.0 22 0.5 23 2.5 24 2.5 25 3.0 26 5.5 27 9.5 28 10.0 29 13.0 30 21.5 31 28.5 32 46.0 33 60.5 34 62.5 35 75.0 36 98.0 37 127.5 38 142.0 39 151.5 40 175.5 41 193.0 42 241.5 43 268.5 44 250.5 45 244.5 46 255.0 47 267.0 48 244.0 49 201.0 50 162.0 51 133.5 52 107.5 53 85.5 54 63.5 55 51.5 56 41.0 57 33.0 58 30.0 59 17.0 60 13.5 61 12.0 62 10.5 63 9.5 64 6.5 65 4.5 66 4.0 67 3.0 68 2.0 69 1.5 70 1.0 71 1.0 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69909729187563 99.4 2 0.3009027081243731 0.6 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.3625 0.0 0.0 0.0 0.0 102-103 1.7 0.0 0.0 0.0 0.0 104-105 2.15 0.0 0.0 0.0 0.0 106-107 2.7125 0.0 0.0 0.0 0.0 108-109 3.0875 0.0 0.0 0.0 0.0 110-111 3.55 0.0 0.0 0.0 0.0 112-113 3.975 0.0 0.0 0.0 0.0 114-115 4.737500000000001 0.0 0.0 0.0 0.0 116-117 5.5125 0.0 0.0 0.0 0.0 118-119 6.300000000000001 0.0 0.0 0.0 0.0 120-121 7.2125 0.0 0.0 0.0 0.0 122-123 8.1125 0.0 0.0 0.0 0.0 124-125 9.162500000000001 0.0 0.0 0.0 0.0 126-127 10.3125 0.0 0.0 0.0 0.0 128-129 11.375 0.0 0.0 0.0 0.0 130-131 12.675 0.0 0.0 0.0 0.0 132-133 13.9375 0.0 0.0 0.0 0.0 134-135 15.4875 0.0 0.0 0.0 0.0 136-137 16.9125 0.0 0.0 0.0 0.0 138-139 18.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6053275 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053275_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9895 33.0 33.0 34.0 32.0 34.0 2 33.01675 33.0 33.0 34.0 32.0 34.0 3 33.167 34.0 33.0 34.0 33.0 34.0 4 33.16375 34.0 33.0 34.0 33.0 34.0 5 33.164 34.0 33.0 34.0 33.0 34.0 6 37.40825 38.0 38.0 38.0 37.0 38.0 7 37.36975 38.0 38.0 38.0 37.0 38.0 8 37.31525 38.0 38.0 38.0 37.0 38.0 9 37.36525 38.0 38.0 38.0 37.0 38.0 10-14 37.33315 38.0 38.0 38.0 37.0 38.0 15-19 37.33435 38.0 38.0 38.0 37.0 38.0 20-24 37.3346 38.0 38.0 38.0 37.0 38.0 25-29 37.328050000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.299099999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.36005 38.0 38.0 38.0 37.2 38.0 40-44 37.306200000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.32325000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.26425 38.0 38.0 38.0 37.0 38.0 55-59 37.22265 38.0 38.0 38.0 37.0 38.0 60-64 37.15625 38.0 38.0 38.0 37.0 38.0 65-69 37.1711 38.0 38.0 38.0 37.0 38.0 70-74 37.1382 38.0 38.0 38.0 37.0 38.0 75-79 37.09415 38.0 38.0 38.0 37.0 38.0 80-84 37.10065 38.0 38.0 38.0 37.0 38.0 85-89 37.070100000000004 38.0 38.0 38.0 37.0 38.0 90-94 36.95335 38.0 38.0 38.0 36.2 38.0 95-99 36.8831 38.0 38.0 38.0 36.0 38.0 100-104 36.8596 38.0 38.0 38.0 36.0 38.0 105-109 36.7977 38.0 38.0 38.0 35.6 38.0 110-114 36.62675 38.0 38.0 38.0 35.2 38.0 115-119 36.53705 38.0 38.0 38.0 35.0 38.0 120-124 36.3549 38.0 38.0 38.0 34.0 38.0 125-129 36.39735 38.0 38.0 38.0 34.6 38.0 130-134 36.20575 38.0 38.0 38.0 34.0 38.0 135-139 36.041650000000004 38.0 38.0 38.0 33.8 38.0 140-144 35.689049999999995 38.0 38.0 38.0 33.0 38.0 145-149 35.2368 38.0 36.8 38.0 32.2 38.0 150-151 32.2135 36.5 32.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 6.0 4 0.0 5 1.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 4.0 15 2.0 16 1.0 17 3.0 18 2.0 19 1.0 20 5.0 21 3.0 22 6.0 23 5.0 24 7.0 25 12.0 26 19.0 27 10.0 28 18.0 29 31.0 30 37.0 31 34.0 32 30.0 33 63.0 34 98.0 35 143.0 36 358.0 37 3096.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.7 13.900000000000002 17.724999999999998 36.675000000000004 2 24.9 21.125 36.825 17.150000000000002 3 21.325 26.674999999999997 29.099999999999998 22.900000000000002 4 25.174999999999997 32.7 22.55 19.575 5 27.224999999999998 34.475 21.349999999999998 16.950000000000003 6 18.71871871871872 38.63863863863864 23.373373373373376 19.26926926926927 7 20.0 17.171464330413016 41.95244055068836 20.876095118898625 8 22.528160200250312 21.8523153942428 27.709637046307883 27.909887359198997 9 22.252816020025033 23.27909887359199 30.312891113892366 24.155193992490613 10-14 23.62953692115144 28.72090112640801 26.012515644555695 21.637046307884855 15-19 24.28035043804756 27.819774718397998 26.9837296620776 20.916145181476846 20-24 22.996044660291393 28.919040704951687 27.33690482150904 20.748009813247883 25-29 24.74969963956748 27.678213856627952 26.787144573488185 20.784941930316382 30-34 23.94852793911476 27.703785299419188 27.148007210094132 21.19967955137192 35-39 24.20905086103324 28.083700440528638 26.69703644373248 21.010212254705646 40-44 24.230441964062265 28.129536012813457 26.552880524550776 21.0871414985735 45-49 23.73229213595635 27.977173749812284 27.02107423537068 21.26945987886069 50-54 24.814777733279936 28.083700440528638 26.71205446535843 20.389467360833 55-59 24.819783740488585 27.758309971966362 26.877252703243894 20.544653584301162 60-64 25.030042058882433 27.183056278790307 27.228119367113962 20.558782295213298 65-69 24.399158822351293 27.72381333867414 27.183056278790307 20.693971560184256 70-74 24.49684589966957 27.42064684089316 27.55081606087914 20.531691198558125 75-79 24.316474712068104 27.801702553830747 27.651477215823732 20.230345518277414 80-84 24.24758375481997 28.08352947067955 27.53768340928439 20.131203365216084 85-89 24.233620516930472 27.529553195752353 27.769985974754558 20.466840312562613 90-94 23.84218695238572 27.64231712812297 28.193060631853 20.322435287638314 95-99 24.317965660509586 28.332582469840318 27.28637933623667 20.063072533413425 100-104 23.824780976220275 27.88485607008761 28.130162703379224 20.16020025031289 105-109 24.68579440188273 28.155825947624052 27.615041810625407 19.543337839867807 110-114 24.5703692569768 27.576531890375268 27.972343303772735 19.880755548875197 115-119 25.065104166666668 27.569110576923077 27.564102564102566 19.801682692307693 120-124 25.141455109909366 28.15081868709629 27.24450453157078 19.463221671423565 125-129 25.47694156526964 27.549947423764458 27.670121676430824 19.302989334535077 130-134 26.48635111445029 28.004007012271476 26.446280991735538 19.0633608815427 135-139 26.259136877941323 28.28176629618504 26.689696605587265 18.76940022028637 140-144 27.0397437180899 28.496345980578635 26.278906797477227 18.18500350385424 145-149 28.010811893082387 28.216037641405546 26.258884773250575 17.51426569226149 150-151 28.055034396497813 28.342714196372732 26.053783614759222 17.548467792370232 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 2.0 3 1.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 3.0 28 4.0 29 6.0 30 9.5 31 11.5 32 15.0 33 23.5 34 30.0 35 47.0 36 67.5 37 77.0 38 101.0 39 138.5 40 160.0 41 198.0 42 250.5 43 262.5 44 285.5 45 333.5 46 333.0 47 277.0 48 236.5 49 213.0 50 194.0 51 155.5 52 118.5 53 106.0 54 79.0 55 59.0 56 48.0 57 36.5 58 25.0 59 18.0 60 14.0 61 12.5 62 9.0 63 5.5 64 4.0 65 2.0 66 3.0 67 3.5 68 2.5 69 2.5 70 3.0 71 1.5 72 0.0 73 0.5 74 1.5 75 1.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.125 8 0.125 9 0.125 10-14 0.125 15-19 0.125 20-24 0.135 25-29 0.12 30-34 0.13999999999999999 35-39 0.12 40-44 0.105 45-49 0.11499999999999999 50-54 0.12 55-59 0.12 60-64 0.13999999999999999 65-69 0.13999999999999999 70-74 0.13 75-79 0.15 80-84 0.155 85-89 0.18 90-94 0.135 95-99 0.11499999999999999 100-104 0.125 105-109 0.145 110-114 0.20500000000000002 115-119 0.16 120-124 0.145 125-129 0.145 130-134 0.17500000000000002 135-139 0.13 140-144 0.11 145-149 0.11 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57286432160805 99.075 2 0.35175879396984927 0.7000000000000001 3 0.07537688442211055 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.525 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 2.0875 0.0 0.0 0.0 0.0 106-107 2.6125 0.0 0.0 0.0 0.0 108-109 2.9875 0.0 0.0 0.0 0.0 110-111 3.45 0.0 0.0 0.0 0.0 112-113 3.875 0.0 0.0 0.0 0.0 114-115 4.637499999999999 0.0 0.0 0.0 0.0 116-117 5.4375 0.0 0.0 0.0 0.0 118-119 6.2 0.0 0.0 0.0 0.0 120-121 7.125 0.0 0.0 0.0 0.0 122-123 8.0375 0.0 0.0 0.0 0.0 124-125 9.075 0.0 0.0 0.0 0.0 126-127 10.2125 0.0 0.0 0.0 0.0 128-129 11.3 0.0 0.0 0.0 0.0 130-131 12.625 0.0 0.0 0.0 0.0 132-133 13.875 0.0 0.0 0.0 0.0 134-135 15.4 0.0 0.0 0.0 0.0 136-137 16.8125 0.0 0.0 0.0 0.0 138-139 18.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141515 spots for SRR6053275.sra Written 2141515 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra Read 2141500 spots for SRR6053275.sra Written 2141500 spots for SRR6053275.sra SRR ids: ['SRR6053275.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_r669it0d SRR6053275.sra spots: 42830015 blocks: [[1, 2141500], [2141501, 4283000], [4283001, 6424500], [6424501, 8566000], [8566001, 10707500], [10707501, 12849000], [12849001, 14990500], [14990501, 17132000], [17132001, 19273500], [19273501, 21415000], [21415001, 23556500], [23556501, 25698000], [25698001, 27839500], [27839501, 29981000], [29981001, 32122500], [32122501, 34264000], [34264001, 36405500], [36405501, 38547000], [38547001, 40688500], [40688501, 42830015]] SRR6053275 file size 14491986 SRR6053275 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053275 SRR6053275_1.fastq SRR6053275_2.fastq Input file: SRR6053275_1.fastq Paired file: SRR6053275_2.fastq trimmed: SRR6053275-trimmed-pair1.fastq, SRR6053275-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:18:04 2025 >> started Tue Feb 11 15:18:56 2025 >> done (51.855s) 42830015 read pairs processed; of these: 48638 ( 0.11%) short read pairs filtered out after trimming by size control 33610 ( 0.08%) empty read pairs filtered out after trimming by size control 42747767 (99.81%) read pairs available; of these: 19162680 (44.83%) trimmed read pairs available after processing 23585087 (55.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 13 0.00% 20 11 0.00% 21 8 0.00% 22 12 0.00% 23 10 0.00% 24 9 0.00% 25 13 0.00% 26 5 0.00% 27 9 0.00% 28 10 0.00% 29 5 0.00% 30 12 0.00% 31 11 0.00% 32 15 0.00% 33 19 0.00% 34 14 0.00% 35 16 0.00% 36 14 0.00% 37 13 0.00% 38 39 0.00% 39 39 0.00% 40 48 0.00% 41 48 0.00% 42 47 0.00% 43 60 0.00% 44 74 0.00% 45 73 0.00% 46 91 0.00% 47 89 0.00% 48 120 0.00% 49 137 0.00% 50 167 0.00% 51 203 0.00% 52 220 0.00% 53 232 0.00% 54 324 0.00% 55 387 0.00% 56 387 0.00% 57 418 0.00% 58 546 0.00% 59 570 0.00% 60 668 0.00% 61 831 0.00% 62 945 0.00% 63 1093 0.00% 64 1237 0.00% 65 1447 0.00% 66 1513 0.00% 67 1796 0.00% 68 2153 0.01% 69 2886 0.01% 70 3158 0.01% 71 3176 0.01% 72 3820 0.01% 73 4198 0.01% 74 4808 0.01% 75 5440 0.01% 76 6004 0.01% 77 6494 0.02% 78 7550 0.02% 79 8680 0.02% 80 9617 0.02% 81 11106 0.03% 82 12832 0.03% 83 14570 0.03% 84 16804 0.04% 85 18925 0.04% 86 20680 0.05% 87 23062 0.05% 88 25359 0.06% 89 27540 0.06% 90 30507 0.07% 91 33743 0.08% 92 37550 0.09% 93 42206 0.10% 94 46144 0.11% 95 50136 0.12% 96 53872 0.13% 97 58723 0.14% 98 62704 0.15% 99 67723 0.16% 100 73160 0.17% 101 79193 0.19% 102 85976 0.20% 103 91587 0.21% 104 98509 0.23% 105 105985 0.25% 106 111854 0.26% 107 118800 0.28% 108 122334 0.29% 109 130766 0.31% 110 136327 0.32% 111 143424 0.34% 112 153636 0.36% 113 159965 0.37% 114 170634 0.40% 115 180937 0.42% 116 187248 0.44% 117 192202 0.45% 118 199982 0.47% 119 204122 0.48% 120 208939 0.49% 121 219596 0.51% 122 227022 0.53% 123 234175 0.55% 124 244540 0.57% 125 254191 0.59% 126 263321 0.62% 127 270294 0.63% 128 277720 0.65% 129 274552 0.64% 130 279228 0.65% 131 283584 0.66% 132 289938 0.68% 133 298386 0.70% 134 308222 0.72% 135 322324 0.75% 136 326203 0.76% 137 335379 0.78% 138 339746 0.79% 139 344898 0.81% 140 345030 0.81% 141 357074 0.84% 142 364897 0.85% 143 378351 0.89% 144 400359 0.94% 145 432074 1.01% 146 465067 1.09% 147 526193 1.23% 148 642883 1.50% 149 999070 2.34% 150 5166531 12.09% 151 23585087 55.17% 42747767 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=42 prefix-density=0.19 prefix-fanout=2.0 sequence=TTAATAACTGGAGAGCAGGAGATGCCAGTGCCTCAGACAAACTGATCAAGGTACTCTTCCACGGTGGTATATTTGACATCTGGATATAGCTCAGAGGCCTCAAGCCCCCATGATGGGTCAATCTCAAAGTTGGTCATGTCACCATTAACGAGGGCTGAGTGGTTGATTGACAGAACAATATTAATCGGAATCGGAGACTCTTGGATGTCCTTCAGAAGTTTCTCTTCAGGAACAAAGGTTTTTTCGAGGGTTTTGCCAATCTTTTTCTCCCATAGATCAATAAGCTCATTGAATGAGTAGGTGTTTTTAGGAGGCTTGATTAGGACAGTCTTGTTCAAGGTTCTTGCATCATCCACAGC criterion=fanout-score sequence-density=0.08 sequence-density-rank=32 fanout-score=38.56 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=12.8 sequence=CCATCACCAACAGGAAGCATGCAAATTTCAATCCTGGGGTCAGC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=8.55 fanout-score-rank=13 prefix-density=0.33 prefix-fanout=5.7 sequence=AGGTTCTTGAAGACAGCTGCATACGGACATTTTGGAAGGGATGACCCAGACTTCACCTGGGAAGT criterion=fanout-score sequence-density=0.13 sequence-density-rank=7 fanout-score=39.29 fanout-score-rank=1 prefix-density=0.41 prefix-fanout=12.2 sequence=GAGAAGGCAATGAGAGATGCGATTGATGGAATGAACGGCCAAGACCTTGATGGGCGTAACATCACCGTGAA SRR6053275 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:19:52 Started mapping on | Feb 11 15:19:52 Finished on | Feb 11 15:24:13 Mapping speed, Million of reads per hour | 589.62 Number of input reads | 42747767 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 39871370 Uniquely mapped reads % | 93.27% Average mapped length | 286.55 Number of splices: Total | 30284909 Number of splices: Annotated (sjdb) | 29556550 Number of splices: GT/AG | 29726873 Number of splices: GC/AG | 383808 Number of splices: AT/AC | 36573 Number of splices: Non-canonical | 137655 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.07% Deletion average length | 2.90 Insertion rate per base | 0.05% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1230060 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 867697 % of reads mapped to too many loci | 2.03% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.43% % of reads unmapped: other | 0.39% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1662867 1662867 1662867 N_multimapping 1230060 1230060 1230060 N_noFeature 978570 39234996 1261886 N_ambiguous 539382 3668 184192 UnstrandedReadsAssigned:38353418 PositiveStrandReadsAssigned:632706 NegativeStrandReadsAssigned:38425292 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=138 echo kmer=133 SRR6053275 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053275-trimmed-pair1.fastq SRR6053275-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 42,747,767 reads, 38,737,705 reads pseudoaligned [quant] estimated average fragment length: 179.925 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,327 rounds 52401 SRR6053275.ke.tsv 34699 SRR6053275.se.tsv 87100 total ==> SRR6053275.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1839.07 2235 30.21 Potri.005G024800.1.v4.1 1035 856.075 478 13.88 Potri.004G059700.1.v4.1 961 782.075 52 1.65283 Potri.007G009000.2.v4.1 1416 1237.07 0 0 Potri.003G141000.2.v4.1 2943 2764.07 874.08 7.86093 Potri.016G087400.1.v4.1 270 99.9484 5967 1484.06 Potri.015G069301.1.v4.1 564 385.187 0 0 Potri.010G195200.1.v4.1 1773 1594.07 90 1.40348 Potri.012G127500.1.v4.1 977 798.075 16608 517.305 ==> SRR6053275.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4696 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1101 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 64 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR6053275 completed mapping pipeline successfully