Starting /dee2/code/volunteer_pipeline.sh SRR6053276 current disk space = 3049858400256 free memory = 1416308044 SRR6053276 SRAfilesize 4806c20bac9548800aa66570322221de SRR6053276.sra SRR6053276.sra file validated SRR6053276 is paired end SRR6053276 is conventional basespace SRR6053276 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053276_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.67975 28.0 18.0 33.0 18.0 33.0 2 29.8525 31.0 27.0 33.0 27.0 33.0 3 30.7455 33.0 29.0 33.0 27.0 33.0 4 30.67925 33.0 31.0 33.0 27.0 33.0 5 32.257 33.0 32.0 33.0 32.0 34.0 6 36.39 38.0 37.0 38.0 33.0 38.0 7 36.66125 38.0 37.0 38.0 34.0 38.0 8 36.8625 38.0 38.0 38.0 35.0 38.0 9 37.01325 38.0 38.0 38.0 35.0 38.0 10-14 37.2127 38.0 38.0 38.0 36.4 38.0 15-19 37.25505 38.0 38.0 38.0 36.4 38.0 20-24 37.286199999999994 38.0 38.0 38.0 36.6 38.0 25-29 37.1673 38.0 38.0 38.0 36.0 38.0 30-34 37.17035 38.0 38.0 38.0 36.0 38.0 35-39 37.00085 38.0 38.0 38.0 36.0 38.0 40-44 36.95825000000001 38.0 38.0 38.0 35.6 38.0 45-49 36.78795 38.0 38.0 38.0 35.0 38.0 50-54 36.761700000000005 38.0 38.0 38.0 34.8 38.0 55-59 36.53195 38.0 37.8 38.0 34.0 38.0 60-64 36.4051 38.0 37.6 38.0 33.8 38.0 65-69 36.4465 38.0 37.6 38.0 33.8 38.0 70-74 36.3534 38.0 37.0 38.0 33.6 38.0 75-79 36.136700000000005 38.0 37.0 38.0 33.0 38.0 80-84 35.9062 38.0 36.8 38.0 32.0 38.0 85-89 35.75655 38.0 36.6 38.0 31.0 38.0 90-94 35.55925 38.0 36.0 38.0 30.0 38.0 95-99 35.4165 38.0 36.0 38.0 29.4 38.0 100-104 35.27335000000001 38.0 36.0 38.0 29.2 38.0 105-109 34.85295 38.0 35.0 38.0 27.6 38.0 110-114 34.287549999999996 38.0 34.2 38.0 24.6 38.0 115-119 34.4351 38.0 34.8 38.0 25.2 38.0 120-124 34.310050000000004 38.0 34.2 38.0 24.6 38.0 125-129 33.93515 38.0 34.0 38.0 23.0 38.0 130-134 33.7063 38.0 34.0 38.0 22.0 38.0 135-139 33.173249999999996 37.6 33.4 38.0 16.6 38.0 140-144 32.45615 36.6 32.2 38.0 14.6 38.0 145-149 31.94875 36.0 32.2 38.0 13.8 38.0 150-151 27.44525 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 8.0 18 7.0 19 6.0 20 3.0 21 3.0 22 10.0 23 12.0 24 9.0 25 9.0 26 27.0 27 32.0 28 53.0 29 52.0 30 75.0 31 100.0 32 146.0 33 206.0 34 346.0 35 553.0 36 1108.0 37 1227.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.27513227513228 8.201058201058201 8.042328042328043 36.48148148148148 2 21.75 12.55 34.949999999999996 30.75 3 20.325 16.675 28.849999999999998 34.150000000000006 4 22.625 22.975 25.55 28.849999999999998 5 22.475 29.125 24.45 23.95 6 19.575 34.275 25.6 20.549999999999997 7 14.399999999999999 26.05 41.825 17.724999999999998 8 17.65 26.275 31.075000000000003 25.0 9 16.45 25.8 35.375 22.375 10-14 19.29 30.395 27.6 22.715 15-19 19.139999999999997 28.175 28.515 24.169999999999998 20-24 19.055 28.9 28.694999999999997 23.35 25-29 19.2 28.815 28.225 23.76 30-34 19.165 29.445 27.915 23.474999999999998 35-39 19.465 28.610000000000003 27.925 24.0 40-44 19.7 28.95 27.98 23.369999999999997 45-49 19.97 28.89 27.994999999999997 23.145 50-54 19.555 28.970000000000002 27.67 23.805 55-59 19.475 28.57 28.115000000000002 23.84 60-64 19.99 28.32 27.815 23.875 65-69 19.42 28.675 28.025 23.880000000000003 70-74 19.89 28.744999999999997 27.785 23.580000000000002 75-79 19.77 28.48 27.57 24.18 80-84 19.37 29.115000000000002 27.93 23.585 85-89 19.950000000000003 29.580000000000002 27.229999999999997 23.24 90-94 20.3 28.615000000000002 27.665 23.419999999999998 95-99 20.215 29.425 27.265 23.095 100-104 20.24 29.03 27.83 22.900000000000002 105-109 20.305 28.345 27.74 23.61 110-114 20.06 28.675 28.044999999999998 23.22 115-119 19.655 28.660000000000004 28.000000000000004 23.685000000000002 120-124 20.25 28.28 27.495000000000005 23.974999999999998 125-129 20.29 28.294999999999998 27.975 23.44 130-134 20.765 28.765 27.465 23.005 135-139 20.445 28.895 27.11 23.549999999999997 140-144 20.645 28.425 26.82 24.11 145-149 19.865 28.77 27.474999999999998 23.89 150-151 20.225 28.475 26.8 24.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 1.0 18 1.5 19 0.5 20 0.5 21 1.5 22 1.5 23 1.5 24 6.0 25 7.5 26 6.5 27 5.5 28 11.5 29 18.5 30 16.0 31 27.5 32 42.5 33 49.0 34 76.5 35 98.0 36 108.0 37 126.0 38 150.0 39 176.5 40 195.5 41 198.0 42 210.0 43 234.0 44 249.5 45 266.5 46 267.5 47 256.5 48 219.0 49 176.0 50 155.5 51 130.0 52 104.0 53 94.0 54 76.5 55 56.5 56 46.0 57 35.0 58 29.5 59 21.5 60 12.5 61 9.0 62 7.5 63 5.0 64 2.5 65 2.5 66 2.0 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2422328870927 98.225 2 0.6567314978529932 1.3 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.025258903763576663 0.15 7 0.025258903763576663 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACACAGCAACATCTCGTAT 7 0.17500000000000002 TruSeq Adapter, Index 5 (97% over 37bp) GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.375 0.0 0.0 0.0 0.0 116-117 1.5375 0.0 0.0 0.0 0.0 118-119 1.775 0.0 0.0 0.0 0.0 120-121 2.075 0.0 0.0 0.0 0.0 122-123 2.2125000000000004 0.0 0.0 0.0 0.0 124-125 2.4875 0.0 0.0 0.0 0.0 126-127 2.8625 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.375 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.3875 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAATAA 10 0.0068449317 144.90001 145 >>END_MODULE SRR6053276 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053276_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.63925 33.0 33.0 34.0 32.0 34.0 2 32.63875 33.0 33.0 34.0 32.0 34.0 3 32.48425 33.0 33.0 34.0 31.0 34.0 4 32.6005 33.0 33.0 34.0 32.0 34.0 5 32.68475 33.0 33.0 34.0 32.0 34.0 6 36.835 38.0 38.0 38.0 35.0 38.0 7 36.8005 38.0 38.0 38.0 35.0 38.0 8 36.74575 38.0 38.0 38.0 35.0 38.0 9 36.7685 38.0 38.0 38.0 35.0 38.0 10-14 36.737049999999996 38.0 38.0 38.0 35.4 38.0 15-19 36.7042 38.0 38.0 38.0 35.4 38.0 20-24 36.61985 38.0 38.0 38.0 35.0 38.0 25-29 36.51705 38.0 38.0 38.0 34.6 38.0 30-34 36.77065 38.0 38.0 38.0 36.0 38.0 35-39 36.76365 38.0 38.0 38.0 35.6 38.0 40-44 36.45205 38.0 38.0 38.0 34.4 38.0 45-49 36.26195 38.0 38.0 38.0 34.0 38.0 50-54 36.19195 38.0 38.0 38.0 33.8 38.0 55-59 36.2054 38.0 38.0 38.0 33.8 38.0 60-64 36.20155 38.0 38.0 38.0 33.8 38.0 65-69 36.1531 38.0 38.0 38.0 33.6 38.0 70-74 35.69555 38.0 37.2 38.0 30.4 38.0 75-79 35.636849999999995 38.0 37.0 38.0 30.6 38.0 80-84 35.5979 38.0 37.0 38.0 30.4 38.0 85-89 35.798 38.0 37.4 38.0 32.4 38.0 90-94 35.770799999999994 38.0 37.0 38.0 32.4 38.0 95-99 35.58695 38.0 37.0 38.0 31.4 38.0 100-104 35.23405 38.0 36.4 38.0 29.6 38.0 105-109 35.207550000000005 38.0 36.2 38.0 29.6 38.0 110-114 34.81305 38.0 35.6 38.0 27.4 38.0 115-119 34.1863 38.0 34.8 38.0 22.2 38.0 120-124 33.39885 38.0 34.0 38.0 16.2 38.0 125-129 33.44115 38.0 34.0 38.0 18.2 38.0 130-134 33.39575 38.0 33.8 38.0 19.0 38.0 135-139 32.87935 37.8 33.2 38.0 14.6 38.0 140-144 31.746249999999996 36.4 31.8 38.0 14.0 38.0 145-149 31.32665 37.0 31.8 38.0 8.8 38.0 150-151 27.444000000000003 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 12.0 4 5.0 5 6.0 6 1.0 7 7.0 8 2.0 9 2.0 10 2.0 11 3.0 12 1.0 13 4.0 14 2.0 15 1.0 16 7.0 17 10.0 18 6.0 19 8.0 20 12.0 21 14.0 22 16.0 23 16.0 24 17.0 25 23.0 26 29.0 27 38.0 28 44.0 29 52.0 30 64.0 31 86.0 32 107.0 33 175.0 34 221.0 35 389.0 36 813.0 37 1800.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.56778389194598 20.66033016508254 17.18359179589795 26.588294147073537 2 28.349999999999998 26.474999999999998 27.875 17.299999999999997 3 21.875 28.275 30.375000000000004 19.475 4 23.075000000000003 33.75 24.3 18.875 5 24.425 34.925 22.7 17.95 6 21.25 37.3 24.224999999999998 17.224999999999998 7 21.05 21.675 39.2 18.075 8 23.325000000000003 25.75 26.575 24.349999999999998 9 21.725 26.1 29.849999999999998 22.325 10-14 23.91 27.805000000000003 26.865 21.42 15-19 23.41 28.48 27.47 20.64 20-24 23.525 28.634999999999998 27.705000000000002 20.135 25-29 23.385 27.88 28.075 20.66 30-34 23.53 28.4 28.175 19.895 35-39 23.325000000000003 28.389999999999997 27.73 20.555 40-44 23.880000000000003 27.534999999999997 27.85 20.735 45-49 23.365 27.935 28.43 20.27 50-54 23.36 27.655 28.860000000000003 20.125 55-59 23.635 27.495000000000005 28.439999999999998 20.43 60-64 23.325000000000003 28.055000000000003 28.355000000000004 20.265 65-69 23.685000000000002 28.225 28.349999999999998 19.74 70-74 23.54 28.34 28.04 20.080000000000002 75-79 23.335 28.37 28.345 19.950000000000003 80-84 23.200000000000003 28.235 28.365000000000002 20.200000000000003 85-89 24.005000000000003 27.884999999999998 28.315 19.794999999999998 90-94 23.115 27.439999999999998 29.035 20.41 95-99 22.905 28.15 28.455000000000002 20.49 100-104 23.73 27.99 28.595 19.685 105-109 23.415 28.01 28.365000000000002 20.21 110-114 23.494999999999997 27.875 28.37 20.26 115-119 24.705 27.555000000000003 28.28 19.46 120-124 24.085 27.92 28.449999999999996 19.545 125-129 24.665 28.015 27.950000000000003 19.37 130-134 24.055 28.410000000000004 27.42 20.115 135-139 24.7 27.639999999999997 28.025 19.634999999999998 140-144 24.035 29.020000000000003 26.99 19.955000000000002 145-149 24.915000000000003 28.860000000000003 27.169999999999998 19.055 150-151 24.925 28.225 27.6375 19.2125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 1.0 22 1.0 23 1.5 24 1.5 25 1.0 26 3.0 27 6.5 28 7.0 29 7.5 30 10.5 31 22.0 32 36.0 33 44.0 34 60.0 35 75.0 36 106.5 37 132.5 38 154.5 39 187.5 40 205.5 41 228.5 42 236.5 43 251.0 44 285.5 45 287.5 46 251.0 47 231.5 48 207.5 49 174.0 50 151.5 51 120.5 52 101.5 53 96.5 54 76.5 55 56.0 56 53.5 57 39.5 58 22.0 59 15.0 60 10.0 61 8.0 62 8.0 63 8.5 64 5.5 65 1.5 66 1.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.5 73 0.5 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21736935117394 98.25 2 0.6059075990911386 1.2 3 0.15147689977278464 0.44999999999999996 4 0.025246149962130777 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3625 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.5625 0.0 0.0 0.0 0.0 102-103 0.7125 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.95 0.0 0.0 0.0 0.0 108-109 1.075 0.0 0.0 0.0 0.0 110-111 1.225 0.0 0.0 0.0 0.0 112-113 1.25 0.0 0.0 0.0 0.0 114-115 1.3875000000000002 0.0 0.0 0.0 0.0 116-117 1.5625 0.0 0.0 0.0 0.0 118-119 1.8 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.2625 0.0 0.0 0.0 0.0 124-125 2.5375 0.0 0.0 0.0 0.0 126-127 2.925 0.0 0.0 0.0 0.0 128-129 3.2125 0.0 0.0 0.0 0.0 130-131 3.5 0.0 0.0 0.0 0.0 132-133 3.875 0.0 0.0 0.0 0.0 134-135 4.2875 0.0 0.0 0.0 0.0 136-137 4.5375 0.0 0.0 0.0 0.0 138-139 4.824999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGAATC 10 0.006830828 145.0 4 >>END_MODULE Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868344 spots for SRR6053276.sra Written 2868344 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra Read 2868343 spots for SRR6053276.sra Written 2868343 spots for SRR6053276.sra SRR ids: ['SRR6053276.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a5xsd7or SRR6053276.sra spots: 57366861 blocks: [[1, 2868343], [2868344, 5736686], [5736687, 8605029], [8605030, 11473372], [11473373, 14341715], [14341716, 17210058], [17210059, 20078401], [20078402, 22946744], [22946745, 25815087], [25815088, 28683430], [28683431, 31551773], [31551774, 34420116], [34420117, 37288459], [37288460, 40156802], [40156803, 43025145], [43025146, 45893488], [45893489, 48761831], [48761832, 51630174], [51630175, 54498517], [54498518, 57366861]] SRR6053276 file size 19418046 SRR6053276 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053276 SRR6053276_1.fastq SRR6053276_2.fastq Input file: SRR6053276_1.fastq Paired file: SRR6053276_2.fastq trimmed: SRR6053276-trimmed-pair1.fastq, SRR6053276-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 14:52:01 2025 >> started Tue Feb 11 14:53:50 2025 >> done (108.675s) 57366861 read pairs processed; of these: 89571 ( 0.16%) short read pairs filtered out after trimming by size control 119214 ( 0.21%) empty read pairs filtered out after trimming by size control 57158076 (99.64%) read pairs available; of these: 24083861 (42.14%) trimmed read pairs available after processing 33074215 (57.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 9 0.00% 20 7 0.00% 21 12 0.00% 22 16 0.00% 23 14 0.00% 24 14 0.00% 25 11 0.00% 26 17 0.00% 27 16 0.00% 28 16 0.00% 29 13 0.00% 30 18 0.00% 31 8 0.00% 32 18 0.00% 33 10 0.00% 34 24 0.00% 35 20 0.00% 36 31 0.00% 37 27 0.00% 38 30 0.00% 39 39 0.00% 40 38 0.00% 41 42 0.00% 42 48 0.00% 43 42 0.00% 44 56 0.00% 45 62 0.00% 46 74 0.00% 47 77 0.00% 48 107 0.00% 49 125 0.00% 50 142 0.00% 51 156 0.00% 52 164 0.00% 53 191 0.00% 54 231 0.00% 55 238 0.00% 56 251 0.00% 57 271 0.00% 58 370 0.00% 59 395 0.00% 60 399 0.00% 61 515 0.00% 62 573 0.00% 63 653 0.00% 64 706 0.00% 65 728 0.00% 66 832 0.00% 67 958 0.00% 68 1051 0.00% 69 1235 0.00% 70 1496 0.00% 71 1633 0.00% 72 1842 0.00% 73 2181 0.00% 74 2361 0.00% 75 2700 0.00% 76 3117 0.01% 77 3504 0.01% 78 3749 0.01% 79 4281 0.01% 80 4758 0.01% 81 5503 0.01% 82 6395 0.01% 83 7609 0.01% 84 12278 0.02% 85 16008 0.03% 86 16729 0.03% 87 18861 0.03% 88 20075 0.04% 89 20145 0.04% 90 21209 0.04% 91 21572 0.04% 92 22838 0.04% 93 24384 0.04% 94 25854 0.05% 95 27566 0.05% 96 29057 0.05% 97 29932 0.05% 98 31876 0.06% 99 33296 0.06% 100 36242 0.06% 101 38214 0.07% 102 41014 0.07% 103 43298 0.08% 104 46172 0.08% 105 49338 0.09% 106 52786 0.09% 107 53636 0.09% 108 56405 0.10% 109 59300 0.10% 110 63604 0.11% 111 66166 0.12% 112 70869 0.12% 113 76804 0.13% 114 81238 0.14% 115 86823 0.15% 116 90435 0.16% 117 91941 0.16% 118 93841 0.16% 119 96984 0.17% 120 100494 0.18% 121 103011 0.18% 122 109422 0.19% 123 115490 0.20% 124 120358 0.21% 125 126005 0.22% 126 131245 0.23% 127 136457 0.24% 128 140950 0.25% 129 147160 0.26% 130 153035 0.27% 131 160160 0.28% 132 169090 0.30% 133 179026 0.31% 134 189376 0.33% 135 203088 0.36% 136 213065 0.37% 137 227013 0.40% 138 240147 0.42% 139 256905 0.45% 140 273528 0.48% 141 300677 0.53% 142 334086 0.58% 143 375016 0.66% 144 431611 0.76% 145 513472 0.90% 146 632284 1.11% 147 850022 1.49% 148 1243916 2.18% 149 2420371 4.23% 150 11758355 20.57% 151 33074215 57.86% 57158076 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=2.56 fanout-score-rank=30 prefix-density=0.33 prefix-fanout=2.3 sequence=ATCAGGCAGTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=42 fanout-score=21.02 fanout-score-rank=1 prefix-density=0.03 prefix-fanout=3.9 sequence=GTGCCTGATTTAAAATTGCCTCTGGTGATTTAACCTTTTATCCCTTATTAGAAAAAGTGGCAAAAACAGGCAAGCCGGTGATTTTATCTACAGGAATGTCTGATATTGGGGAAATTTGGGAAGCAGTTAAAGTTTTAGAAAATAATGGATGCAGGGATATTATTTTATTGCATTGTATTTCATCTTACCCAACCCCTTATGAAGATGTCAATTTAAACGCTATTAAAACCTTGAAAAGTATATTCAATATCCCTGTGGGATATTCTGACCATACATTGGGAATACTCGCCCCAGTAGTTTCTGTTGCCTTAGGAGCGGATGTTATTGAGAAGCACTTTACCTTAGATAAAAATATGGAAGGTCCTGATCATGCTTTGTCAGCAGACCCAGAAGAATTTAAGGAAATGGTTAATAACATAAGATTAGTTGAAAAAATGCTTGGAAGTGGGGAAAAGATACCAATGCCTTCTGAAAGAGACGTTATTG criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=3.60 fanout-score-rank=23 prefix-density=0.36 prefix-fanout=2.9 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=131.02 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=10.4 sequence=TGGAGATTGTCTCGTACGGTTAAGAGCCTCCGCCCGTCTCTGGGACTATGGACGGGCACGCTCATATCAGGCTATATTTGGTCCGGGTTATTATCGTCGCGGTTACCGTAATACTTCAGATCAGTTAAGTAGGGCCATATGCCTCGGGAATAAGCTGACGGTGACAAGGTTTCCCCCTAATCGAGACGCTGCAATAACACAGGGGCATACAGTAACCAGGCAAGAGTTCAATCGCTTAGTTTCGTGGCGGGATTTGAGGAAAACTGCGACTGTTCTTTAACCAAACATCCGTGCGATTCGTGCCACTCGTAGACGGCATCTCACAGTCACTGAAGGCTATTAAAGAGTTAGCACCCACCATTGGATGAAGCCCAGGATAAGTGACCCCCCCGGACCTTGGAGTTTCAT SRR6053276 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 14:55:01 Started mapping on | Feb 11 14:55:01 Finished on | Feb 11 15:14:59 Mapping speed, Million of reads per hour | 171.76 Number of input reads | 57158076 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 48674108 Uniquely mapped reads % | 85.16% Average mapped length | 294.17 Number of splices: Total | 42960906 Number of splices: Annotated (sjdb) | 42008060 Number of splices: GT/AG | 42175192 Number of splices: GC/AG | 560412 Number of splices: AT/AC | 37749 Number of splices: Non-canonical | 187553 Mismatch rate per base, % | 0.77% Deletion rate per base | 0.07% Deletion average length | 2.88 Insertion rate per base | 0.04% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1521891 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 703350 % of reads mapped to too many loci | 1.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.65% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 7032780 7032780 7032780 N_multimapping 1521891 1521891 1521891 N_noFeature 1435274 48173013 1590944 N_ambiguous 655825 2455 309777 UnstrandedReadsAssigned:46583009 PositiveStrandReadsAssigned:498640 NegativeStrandReadsAssigned:46773387 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6053276 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053276-trimmed-pair1.fastq SRR6053276-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 57,158,076 reads, 46,709,958 reads pseudoaligned [quant] estimated average fragment length: 236.649 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,237 rounds 52401 SRR6053276.ke.tsv 34699 SRR6053276.se.tsv 87100 total ==> SRR6053276.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1782.35 3073.3 35.8456 Potri.005G024800.1.v4.1 1035 799.351 1270 33.0286 Potri.004G059700.1.v4.1 961 725.363 30 0.859786 Potri.007G009000.2.v4.1 1416 1180.35 0 0 Potri.003G141000.2.v4.1 2943 2707.35 1589.52 12.2052 Potri.016G087400.1.v4.1 270 77.4266 5433.13 1458.76 Potri.015G069301.1.v4.1 564 330.908 0 0 Potri.010G195200.1.v4.1 1773 1537.35 588 7.95113 Potri.012G127500.1.v4.1 977 741.357 7063 198.055 ==> SRR6053276.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 8842 Potri.001G233950.v4.1 7 Potri.001G122700.v4.1 910 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 35 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 54 SRR6053276 completed mapping pipeline successfully