Starting /dee2/code/volunteer_pipeline.sh SRR6053277 current disk space = 3048565604352 free memory = 1579071212 SRR6053277 SRAfilesize cefebbb55953a4823fd3d5d88291ad04 SRR6053277.sra SRR6053277.sra file validated SRR6053277 is paired end SRR6053277 is conventional basespace SRR6053277 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053277_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.4475 34.0 33.0 34.0 18.0 34.0 2 32.73175 34.0 33.0 34.0 28.0 34.0 3 32.95875 34.0 33.0 34.0 32.0 34.0 4 33.2085 34.0 33.0 34.0 32.0 34.0 5 33.23075 34.0 33.0 34.0 33.0 34.0 6 36.80825 38.0 37.0 38.0 35.0 38.0 7 37.245 38.0 38.0 38.0 36.0 38.0 8 37.31475 38.0 38.0 38.0 37.0 38.0 9 37.32975 38.0 38.0 38.0 37.0 38.0 10-14 37.4173 38.0 38.0 38.0 37.0 38.0 15-19 37.3771 38.0 38.0 38.0 37.0 38.0 20-24 37.34044999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.2822 38.0 38.0 38.0 36.8 38.0 30-34 37.23475 38.0 38.0 38.0 36.6 38.0 35-39 37.21515000000001 38.0 38.0 38.0 36.4 38.0 40-44 37.15195 38.0 38.0 38.0 36.0 38.0 45-49 37.1096 38.0 38.0 38.0 36.0 38.0 50-54 37.11900000000001 38.0 38.0 38.0 36.0 38.0 55-59 37.04925000000001 38.0 38.0 38.0 35.8 38.0 60-64 37.019 38.0 38.0 38.0 36.0 38.0 65-69 37.025200000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.971799999999995 38.0 38.0 38.0 35.8 38.0 75-79 36.9442 38.0 38.0 38.0 35.8 38.0 80-84 36.913650000000004 38.0 38.0 38.0 35.4 38.0 85-89 36.78005 38.0 38.0 38.0 35.0 38.0 90-94 36.74735 38.0 38.0 38.0 34.8 38.0 95-99 36.549850000000006 38.0 38.0 38.0 34.0 38.0 100-104 36.58219999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.48225 38.0 38.0 38.0 34.0 38.0 110-114 36.42045 38.0 38.0 38.0 34.0 38.0 115-119 36.251599999999996 38.0 37.8 38.0 33.6 38.0 120-124 36.13475 38.0 37.4 38.0 33.2 38.0 125-129 36.0038 38.0 37.0 38.0 33.0 38.0 130-134 35.862350000000006 38.0 37.0 38.0 32.6 38.0 135-139 35.69705 38.0 36.6 38.0 31.6 38.0 140-144 35.393600000000006 38.0 36.0 38.0 31.0 38.0 145-149 34.9816 38.0 36.0 38.0 30.0 38.0 150-151 32.864125 37.0 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 4.0 20 3.0 21 3.0 22 4.0 23 6.0 24 10.0 25 12.0 26 14.0 27 17.0 28 27.0 29 33.0 30 48.0 31 65.0 32 77.0 33 88.0 34 123.0 35 228.0 36 526.0 37 2710.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.842221000549753 11.847168774051676 11.269928532160527 54.04068169323805 2 20.325 19.975 38.15 21.55 3 20.525 25.1 23.7 30.675 4 22.8 32.2 21.175 23.825 5 20.825 37.025000000000006 24.4 17.75 6 16.125 35.725 27.55 20.599999999999998 7 14.575 20.575 44.0 20.849999999999998 8 18.6 21.575 31.474999999999998 28.349999999999998 9 17.95 21.725 34.0 26.325 10-14 19.580000000000002 29.275000000000002 26.655 24.490000000000002 15-19 19.52 28.055000000000003 27.474999999999998 24.95 20-24 20.115 28.375 27.685 23.825 25-29 19.615 28.865000000000002 27.334999999999997 24.185000000000002 30-34 20.035 27.905 28.050000000000004 24.01 35-39 20.485 28.194999999999997 27.425 23.895 40-44 20.48 28.044999999999998 27.650000000000002 23.825 45-49 20.315 28.694999999999997 27.065 23.925 50-54 19.97 28.515 27.575 23.94 55-59 20.24 28.235 27.584999999999997 23.94 60-64 20.19 28.255000000000003 27.555000000000003 24.0 65-69 20.11 28.87 27.55 23.47 70-74 20.62 28.375 26.905 24.099999999999998 75-79 20.525 27.810000000000002 27.584999999999997 24.08 80-84 20.635 28.525 26.779999999999998 24.060000000000002 85-89 20.535 28.349999999999998 27.625 23.49 90-94 20.255000000000003 27.994999999999997 26.99 24.759999999999998 95-99 20.785 28.335 27.439999999999998 23.44 100-104 20.665 28.555000000000003 27.125 23.655 105-109 21.21 27.375 27.439999999999998 23.974999999999998 110-114 20.45 28.705000000000002 26.685 24.16 115-119 21.185000000000002 27.96 26.915 23.94 120-124 21.46 27.455000000000002 27.345000000000002 23.74 125-129 21.18 28.449999999999996 26.56 23.810000000000002 130-134 21.36 28.1 26.740000000000002 23.799999999999997 135-139 21.175 28.615000000000002 26.229999999999997 23.98 140-144 22.25 28.76 25.814999999999998 23.175 145-149 22.48 28.52 25.580000000000002 23.419999999999998 150-151 21.2875 28.3875 26.450000000000003 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.5 25 3.0 26 4.5 27 6.5 28 12.0 29 15.0 30 14.5 31 22.5 32 33.0 33 40.0 34 50.0 35 62.5 36 82.0 37 110.0 38 137.5 39 154.0 40 185.5 41 225.0 42 237.5 43 243.5 44 263.0 45 273.5 46 268.0 47 259.0 48 223.0 49 186.0 50 162.5 51 140.0 52 131.5 53 106.0 54 74.0 55 60.0 56 50.0 57 41.0 58 36.5 59 29.5 60 19.5 61 12.5 62 6.5 63 4.5 64 2.0 65 1.5 66 2.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.5 74 1.0 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.049999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.5030181086519114 1.0 3 0.05030181086519115 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.4874999999999998 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.9625 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.9124999999999996 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.762499999999999 0.0 0.0 0.0 0.0 128-129 5.375 0.0 0.0 0.0 0.0 130-131 5.9875 0.0 0.0 0.0 0.0 132-133 6.475 0.0 0.0 0.0 0.0 134-135 7.112500000000001 0.0 0.0 0.0 0.0 136-137 7.699999999999999 0.0 0.0 0.0 0.0 138-139 8.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6053277 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053277_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.674 33.0 33.0 34.0 32.0 34.0 2 32.876 33.0 33.0 34.0 32.0 34.0 3 32.952 33.0 33.0 34.0 32.0 34.0 4 32.855 33.0 33.0 34.0 32.0 34.0 5 32.87675 33.0 33.0 34.0 32.0 34.0 6 37.0795 38.0 38.0 38.0 36.0 38.0 7 37.155 38.0 38.0 38.0 37.0 38.0 8 36.96 38.0 38.0 38.0 36.0 38.0 9 36.94 38.0 38.0 38.0 36.0 38.0 10-14 37.067750000000004 38.0 38.0 38.0 36.0 38.0 15-19 37.05025 38.0 38.0 38.0 36.0 38.0 20-24 37.069 38.0 38.0 38.0 36.0 38.0 25-29 37.007200000000005 38.0 38.0 38.0 36.0 38.0 30-34 36.96835 38.0 38.0 38.0 36.0 38.0 35-39 36.9605 38.0 38.0 38.0 36.0 38.0 40-44 36.94515 38.0 38.0 38.0 36.0 38.0 45-49 36.8969 38.0 38.0 38.0 35.6 38.0 50-54 36.857600000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.7983 38.0 38.0 38.0 35.2 38.0 60-64 36.791999999999994 38.0 38.0 38.0 35.2 38.0 65-69 36.7495 38.0 38.0 38.0 35.2 38.0 70-74 36.7476 38.0 38.0 38.0 35.0 38.0 75-79 36.6862 38.0 38.0 38.0 35.2 38.0 80-84 36.6136 38.0 38.0 38.0 34.6 38.0 85-89 36.5778 38.0 38.0 38.0 34.4 38.0 90-94 36.45935 38.0 38.0 38.0 34.0 38.0 95-99 36.40675 38.0 38.0 38.0 34.0 38.0 100-104 36.2676 38.0 38.0 38.0 33.8 38.0 105-109 36.02995 38.0 38.0 38.0 32.8 38.0 110-114 36.01405 38.0 38.0 38.0 33.0 38.0 115-119 35.82475 38.0 37.4 38.0 32.2 38.0 120-124 35.70915 38.0 37.0 38.0 31.6 38.0 125-129 35.66080000000001 38.0 36.8 38.0 31.4 38.0 130-134 35.2992 38.0 36.2 38.0 30.4 38.0 135-139 35.1788 38.0 36.0 38.0 30.2 38.0 140-144 34.78855 38.0 36.0 38.0 28.0 38.0 145-149 34.2738 38.0 35.2 38.0 26.2 38.0 150-151 31.366500000000002 36.5 31.5 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 3.0 10 1.0 11 0.0 12 4.0 13 1.0 14 2.0 15 2.0 16 1.0 17 4.0 18 2.0 19 2.0 20 6.0 21 9.0 22 9.0 23 13.0 24 11.0 25 20.0 26 22.0 27 27.0 28 28.0 29 48.0 30 63.0 31 70.0 32 77.0 33 92.0 34 148.0 35 216.0 36 431.0 37 2685.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.36168084042021 14.757378689344671 16.433216608304154 45.44772386193097 2 23.599999999999998 23.575 37.0 15.825 3 17.525 26.200000000000003 31.35 24.925 4 21.25 33.35 22.6 22.8 5 24.625 35.85 23.25 16.275000000000002 6 16.833416708354175 37.293646823411706 23.78689344672336 22.086043021510758 7 18.27956989247312 16.30407601900475 43.735933983495876 21.680420105026258 8 18.98449224612306 23.56178089044522 29.839919959979987 27.613806903451728 9 20.860430215107552 24.212106053026513 29.41470735367684 25.512756378189096 10-14 22.651325662831415 28.274137068534266 25.817908954477236 23.25662831415708 15-19 21.998799519807925 28.16126450580232 27.475990396158462 22.36394557823129 20-24 22.26113056528264 27.598799399699853 27.428714357178592 22.71135567783892 25-29 22.446734020206062 27.48324497349205 28.09842952885866 21.971591477443233 30-34 21.462511879157706 28.219876956934925 27.869754414044916 22.447856749862453 35-39 22.95573893473368 28.017004251062765 27.101775443860966 21.925481370342588 40-44 22.645190335651044 27.922565154319447 27.537391826321844 21.89485268370767 45-49 22.909581916383274 27.38047609521904 27.70554110822164 22.004400880176036 50-54 22.683402510376556 27.489123368505275 27.689153373005954 22.138320748112218 55-59 22.657930275596456 27.259540839293756 27.689691391987196 22.39283749312259 60-64 23.076923076923077 27.758327498249475 27.193157947384215 21.971591477443233 65-69 23.26046721024461 27.42234005302386 27.24225901655745 22.074933720174077 70-74 23.09808432951533 27.3795828539989 27.78972640424148 21.732606412244284 75-79 23.33166583291646 27.083541770885443 27.373686843421712 22.211105552776388 80-84 23.27047171227052 27.632434595568007 27.377319793907258 21.719773898254214 85-89 23.78689344672336 27.083541770885443 27.518759379689843 21.61080540270135 90-94 23.008451267690152 27.959193879081862 27.16407461119168 21.868280242036306 95-99 23.518527779166874 27.69415412311847 27.309096364454668 21.47822173325999 100-104 23.85977195439088 27.365473094618924 27.345469093818764 21.429285857171436 105-109 23.924569827931172 27.235894357743096 27.425970388155264 21.413565426170468 110-114 23.418196368729056 27.55964587605662 27.62466863402191 21.397489121192418 115-119 24.203471214925223 27.474616115640476 27.3795828539989 20.942329815435404 120-124 24.8811965384423 28.42779250662798 26.21179530788855 20.47921564704117 125-129 24.54727363681841 27.63381690845423 26.953476738369186 20.86543271635818 130-134 24.686108748937023 27.60242108949027 27.022159971987392 20.689310189585314 135-139 24.992499249924993 28.16781678167817 26.282628262826286 20.557055705570555 140-144 25.233785067760163 28.114217132569884 26.213932089813476 20.438065709856478 145-149 26.062606260626065 27.93279327932793 26.55765576557656 19.446944694469448 150-151 25.174999999999997 28.512500000000003 26.3625 19.950000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 4.0 28 4.5 29 7.0 30 11.5 31 17.5 32 18.0 33 23.0 34 38.0 35 55.5 36 75.5 37 100.0 38 118.0 39 136.5 40 183.0 41 211.0 42 236.0 43 264.0 44 262.5 45 264.0 46 271.0 47 265.0 48 241.0 49 218.5 50 195.0 51 155.5 52 122.0 53 104.0 54 88.5 55 73.5 56 54.0 57 45.0 58 38.5 59 27.0 60 20.0 61 13.5 62 9.5 63 5.5 64 3.0 65 3.5 66 3.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.025 8 0.05 9 0.05 10-14 0.05 15-19 0.04 20-24 0.05 25-29 0.03 30-34 0.034999999999999996 35-39 0.025 40-44 0.045 45-49 0.02 50-54 0.015 55-59 0.034999999999999996 60-64 0.03 65-69 0.045 70-74 0.034999999999999996 75-79 0.05 80-84 0.045 85-89 0.05 90-94 0.015 95-99 0.015 100-104 0.02 105-109 0.04 110-114 0.034999999999999996 115-119 0.034999999999999996 120-124 0.045 125-129 0.05 130-134 0.045 135-139 0.01 140-144 0.015 145-149 0.01 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.91056498606537 97.6 2 0.9120851279452749 1.7999999999999998 3 0.15201418799087915 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.02533569799847986 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTTATAGGGAGCACTGCATAGCTTATAAGCTTGTAAGAGATGGCTT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.175 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.8250000000000002 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.6375 0.0 0.0 0.0 0.0 118-119 3.0375 0.0 0.0 0.0 0.0 120-121 3.4625 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.3875 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.425 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.5375 0.0 0.0 0.0 0.0 134-135 7.1875 0.0 0.0 0.0 0.0 136-137 7.775 0.0 0.0 0.0 0.0 138-139 8.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATCTTA 10 0.006830828 145.0 5 GGGGACC 10 0.006830828 145.0 145 ATTTCAA 10 0.006830828 145.0 5 GAAGAGC 40 0.0076550315 18.125 140-144 CGGAAGA 50 0.0013298223 17.4 140-144 >>END_MODULE Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145584 spots for SRR6053277.sra Written 3145584 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra Read 3145566 spots for SRR6053277.sra Written 3145566 spots for SRR6053277.sra SRR ids: ['SRR6053277.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_puov373w SRR6053277.sra spots: 62911338 blocks: [[1, 3145566], [3145567, 6291132], [6291133, 9436698], [9436699, 12582264], [12582265, 15727830], [15727831, 18873396], [18873397, 22018962], [22018963, 25164528], [25164529, 28310094], [28310095, 31455660], [31455661, 34601226], [34601227, 37746792], [37746793, 40892358], [40892359, 44037924], [44037925, 47183490], [47183491, 50329056], [50329057, 53474622], [53474623, 56620188], [56620189, 59765754], [59765755, 62911338]] SRR6053277 file size 21296887 SRR6053277 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053277 SRR6053277_1.fastq SRR6053277_2.fastq Input file: SRR6053277_1.fastq Paired file: SRR6053277_2.fastq trimmed: SRR6053277-trimmed-pair1.fastq, SRR6053277-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:09:09 2025 >> started Tue Feb 11 17:10:14 2025 >> done (64.591s) 62911338 read pairs processed; of these: 39984 ( 0.06%) short read pairs filtered out after trimming by size control 41857 ( 0.07%) empty read pairs filtered out after trimming by size control 62829497 (99.87%) read pairs available; of these: 21774586 (34.66%) trimmed read pairs available after processing 41054911 (65.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 16 0.00% 20 16 0.00% 21 10 0.00% 22 12 0.00% 23 8 0.00% 24 16 0.00% 25 14 0.00% 26 20 0.00% 27 10 0.00% 28 21 0.00% 29 16 0.00% 30 19 0.00% 31 20 0.00% 32 19 0.00% 33 22 0.00% 34 21 0.00% 35 32 0.00% 36 34 0.00% 37 46 0.00% 38 42 0.00% 39 60 0.00% 40 38 0.00% 41 59 0.00% 42 68 0.00% 43 71 0.00% 44 91 0.00% 45 74 0.00% 46 92 0.00% 47 133 0.00% 48 131 0.00% 49 174 0.00% 50 187 0.00% 51 216 0.00% 52 245 0.00% 53 254 0.00% 54 269 0.00% 55 309 0.00% 56 313 0.00% 57 357 0.00% 58 436 0.00% 59 491 0.00% 60 578 0.00% 61 652 0.00% 62 730 0.00% 63 787 0.00% 64 878 0.00% 65 964 0.00% 66 1008 0.00% 67 1123 0.00% 68 1274 0.00% 69 1481 0.00% 70 1700 0.00% 71 1949 0.00% 72 2038 0.00% 73 2319 0.00% 74 2767 0.00% 75 2980 0.00% 76 3388 0.01% 77 3842 0.01% 78 4153 0.01% 79 4698 0.01% 80 5394 0.01% 81 5867 0.01% 82 6717 0.01% 83 7586 0.01% 84 9516 0.02% 85 10912 0.02% 86 12112 0.02% 87 13794 0.02% 88 15317 0.02% 89 16827 0.03% 90 18628 0.03% 91 20533 0.03% 92 22196 0.04% 93 24732 0.04% 94 27243 0.04% 95 30060 0.05% 96 33292 0.05% 97 36388 0.06% 98 39746 0.06% 99 42788 0.07% 100 46811 0.07% 101 50377 0.08% 102 54135 0.09% 103 57748 0.09% 104 62705 0.10% 105 67634 0.11% 106 73788 0.12% 107 79126 0.13% 108 84644 0.13% 109 91281 0.15% 110 96204 0.15% 111 102108 0.16% 112 108685 0.17% 113 113489 0.18% 114 118690 0.19% 115 128184 0.20% 116 135053 0.21% 117 142979 0.23% 118 149391 0.24% 119 158158 0.25% 120 164332 0.26% 121 172859 0.28% 122 177083 0.28% 123 183884 0.29% 124 191443 0.30% 125 200825 0.32% 126 206968 0.33% 127 216566 0.34% 128 225673 0.36% 129 230808 0.37% 130 240617 0.38% 131 248955 0.40% 132 254530 0.41% 133 265522 0.42% 134 273817 0.44% 135 281526 0.45% 136 290557 0.46% 137 302797 0.48% 138 315162 0.50% 139 329136 0.52% 140 344323 0.55% 141 362761 0.58% 142 384819 0.61% 143 408135 0.65% 144 445335 0.71% 145 491940 0.78% 146 565831 0.90% 147 682479 1.09% 148 927826 1.48% 149 1603106 2.55% 150 8420328 13.40% 151 41054911 65.34% 62829497 reads passed initial QC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.44 fanout-score-rank=17 prefix-density=0.63 prefix-fanout=2.2 sequence=CTGATGCACTGCACTTGACGCGTGTTGTCGAATCC criterion=fanout-score sequence-density=0.20 sequence-density-rank=20 fanout-score=5.36 fanout-score-rank=1 prefix-density=0.56 prefix-fanout=1.9 sequence=CGAAGAAGGTACTCAATTTCC criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=30 prefix-density=0.82 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=29 fanout-score=14.15 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=6.7 sequence=CAAAACCACATATAGAGGGTGTA SRR6053277 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:10:59 Started mapping on | Feb 11 17:10:59 Finished on | Feb 11 17:17:58 Mapping speed, Million of reads per hour | 539.82 Number of input reads | 62829497 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 59217589 Uniquely mapped reads % | 94.25% Average mapped length | 292.95 Number of splices: Total | 56373463 Number of splices: Annotated (sjdb) | 55231044 Number of splices: GT/AG | 55207178 Number of splices: GC/AG | 911938 Number of splices: AT/AC | 40675 Number of splices: Non-canonical | 213672 Mismatch rate per base, % | 0.74% Deletion rate per base | 0.06% Deletion average length | 3.00 Insertion rate per base | 0.04% Insertion average length | 2.61 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 2149619 % of reads mapped to multiple loci | 3.42% Number of reads mapped to too many loci | 434237 % of reads mapped to too many loci | 0.69% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.49% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1485981 1485981 1485981 N_multimapping 2149619 2149619 2149619 N_noFeature 1477628 58449824 1767787 N_ambiguous 879532 2973 400589 UnstrandedReadsAssigned:56860429 PositiveStrandReadsAssigned:764792 NegativeStrandReadsAssigned:57049213 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6053277 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053277-trimmed-pair1.fastq SRR6053277-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 62,829,497 reads, 56,035,650 reads pseudoaligned [quant] estimated average fragment length: 240.697 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52401 SRR6053277.ke.tsv 34699 SRR6053277.se.tsv 87100 total ==> SRR6053277.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1778.3 1746 15.4474 Potri.005G024800.1.v4.1 1035 795.303 865 17.112 Potri.004G059700.1.v4.1 961 721.464 125 2.72592 Potri.007G009000.2.v4.1 1416 1176.3 2 0.0267503 Potri.003G141000.2.v4.1 2943 2703.3 2039.18 11.868 Potri.016G087400.1.v4.1 270 88.3655 4271 760.439 Potri.015G069301.1.v4.1 564 335.061 0 0 Potri.010G195200.1.v4.1 1773 1533.3 42 0.430962 Potri.012G127500.1.v4.1 977 737.386 4442 94.7765 ==> SRR6053277.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1447 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 815 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 5 Potri.001G452600.v4.1 10 SRR6053277 completed mapping pipeline successfully