Starting /dee2/code/volunteer_pipeline.sh SRR6053278 current disk space = 3048627793920 free memory = 1575883716 SRR6053278 SRAfilesize 33f8e634b9088e2acd33e7ca5e3f5e39 SRR6053278.sra SRR6053278.sra file validated SRR6053278 is paired end SRR6053278 is conventional basespace SRR6053278 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053278_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.291 18.0 18.0 18.0 18.0 32.0 2 21.19975 18.0 18.0 25.0 18.0 30.0 3 25.48925 27.0 18.0 29.0 18.0 31.0 4 26.4155 29.0 25.0 31.0 15.0 33.0 5 31.051 32.0 32.0 33.0 27.0 33.0 6 35.59475 37.0 35.0 38.0 31.0 38.0 7 36.1345 38.0 36.0 38.0 33.0 38.0 8 36.75525 38.0 37.0 38.0 34.0 38.0 9 36.8475 38.0 38.0 38.0 35.0 38.0 10-14 37.08935 38.0 38.0 38.0 35.8 38.0 15-19 37.274300000000004 38.0 38.0 38.0 36.6 38.0 20-24 37.2953 38.0 38.0 38.0 36.8 38.0 25-29 37.2034 38.0 38.0 38.0 36.0 38.0 30-34 37.15015 38.0 38.0 38.0 36.2 38.0 35-39 36.98565000000001 38.0 38.0 38.0 35.8 38.0 40-44 37.02795 38.0 38.0 38.0 36.0 38.0 45-49 36.838649999999994 38.0 38.0 38.0 35.0 38.0 50-54 36.8087 38.0 38.0 38.0 34.8 38.0 55-59 36.6448 38.0 38.0 38.0 34.4 38.0 60-64 36.49295 38.0 37.8 38.0 34.0 38.0 65-69 36.49649999999999 38.0 37.6 38.0 33.8 38.0 70-74 36.4697 38.0 37.8 38.0 34.0 38.0 75-79 36.1496 38.0 37.0 38.0 33.0 38.0 80-84 35.94435 38.0 36.8 38.0 32.0 38.0 85-89 35.84054999999999 38.0 36.8 38.0 31.0 38.0 90-94 35.60595 38.0 36.2 38.0 30.0 38.0 95-99 35.59355000000001 38.0 36.0 38.0 30.6 38.0 100-104 35.32555 38.0 36.0 38.0 28.8 38.0 105-109 35.00645 38.0 35.6 38.0 28.0 38.0 110-114 34.51495 38.0 34.6 38.0 25.2 38.0 115-119 34.4783 38.0 34.8 38.0 25.2 38.0 120-124 34.446 38.0 34.4 38.0 25.6 38.0 125-129 34.00775 38.0 34.2 38.0 23.2 38.0 130-134 33.890950000000004 38.0 34.0 38.0 22.6 38.0 135-139 33.566050000000004 37.8 33.6 38.0 19.8 38.0 140-144 32.6669 36.6 32.6 38.0 14.6 38.0 145-149 32.13164999999999 36.2 32.8 38.0 13.8 38.0 150-151 28.104750000000003 35.0 23.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 1.0 10 2.0 11 0.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 1.0 18 5.0 19 6.0 20 2.0 21 5.0 22 12.0 23 11.0 24 7.0 25 21.0 26 29.0 27 29.0 28 38.0 29 63.0 30 79.0 31 106.0 32 140.0 33 219.0 34 332.0 35 594.0 36 1275.0 37 1015.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.207792207792206 27.558441558441558 5.6103896103896105 44.62337662337663 2 15.375 27.150000000000002 23.175 34.300000000000004 3 17.45 20.25 24.15 38.15 4 20.3 27.275 20.825 31.6 5 21.175 31.924999999999997 24.725 22.175 6 19.5 36.3 24.625 19.575 7 14.424999999999999 27.35 40.425 17.8 8 17.375 28.799999999999997 28.975 24.85 9 15.45 26.575 34.825 23.150000000000002 10-14 18.995 31.014999999999997 26.855 23.135 15-19 18.69 29.07 28.060000000000002 24.18 20-24 19.27 29.585 27.845 23.3 25-29 19.285 29.815 27.615000000000002 23.285 30-34 19.314999999999998 29.125 27.615000000000002 23.945 35-39 19.05 29.13 27.73 24.09 40-44 18.845 29.095 28.32 23.74 45-49 19.23 28.92 28.055000000000003 23.794999999999998 50-54 19.439999999999998 29.215000000000003 27.985 23.36 55-59 19.025 28.705000000000002 27.905 24.365000000000002 60-64 20.04 28.78 27.465 23.715 65-69 19.3 29.360000000000003 27.62 23.72 70-74 19.245 28.945 27.925 23.885 75-79 19.575 29.03 27.515 23.880000000000003 80-84 19.6 28.665000000000003 27.865000000000002 23.87 85-89 19.63 28.884999999999998 27.939999999999998 23.544999999999998 90-94 19.689999999999998 28.970000000000002 27.505000000000003 23.835 95-99 19.975 28.575 27.500000000000004 23.95 100-104 19.185 28.939999999999998 28.395 23.48 105-109 19.97 28.24 27.735 24.055 110-114 19.91 28.349999999999998 27.644999999999996 24.095 115-119 19.97 28.065 28.27 23.695 120-124 20.365 28.660000000000004 27.605 23.369999999999997 125-129 20.565 28.705000000000002 27.075 23.655 130-134 19.869999999999997 28.310000000000002 27.815 24.005000000000003 135-139 20.595 27.150000000000002 28.084999999999997 24.169999999999998 140-144 20.62 28.315 27.075 23.990000000000002 145-149 20.665 27.975 27.650000000000002 23.71 150-151 20.375 28.3125 27.175 24.1375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 1.5 11 1.5 12 1.0 13 0.5 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 2.0 24 2.5 25 4.0 26 6.5 27 9.5 28 12.0 29 16.0 30 26.5 31 37.0 32 48.5 33 57.0 34 65.5 35 94.5 36 119.0 37 137.0 38 170.5 39 203.0 40 193.0 41 198.5 42 220.5 43 223.5 44 236.0 45 245.5 46 257.0 47 242.0 48 210.5 49 185.5 50 164.0 51 130.5 52 98.0 53 92.5 54 76.0 55 53.5 56 42.5 57 30.0 58 24.0 59 17.0 60 8.5 61 6.5 62 9.5 63 9.0 64 3.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.75 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.6735308890005 99.225 2 0.25113008538422904 0.5 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.025113008538422906 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCCACTGCTGCCTCCCGTAGGAGTCTGGACCGTGTCTCAGTTCCAGTGT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.7250000000000001 0.0 0.0 0.0 0.0 114-115 0.925 0.0 0.0 0.0 0.0 116-117 1.0499999999999998 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.5125 0.0 0.0 0.0 0.0 122-123 1.65 0.0 0.0 0.0 0.0 124-125 1.8375 0.0 0.0 0.0 0.0 126-127 1.9874999999999998 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.0375 0.0 0.0 0.0 0.0 136-137 3.2125 0.0 0.0 0.0 0.0 138-139 3.6125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTAAGA 10 0.0068378756 144.95 7 >>END_MODULE SRR6053278 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053278_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52225 33.0 33.0 34.0 32.0 34.0 2 32.561 33.0 33.0 34.0 32.0 34.0 3 32.34775 33.0 33.0 34.0 31.0 34.0 4 32.481 33.0 33.0 34.0 32.0 34.0 5 32.68875 33.0 33.0 34.0 32.0 34.0 6 36.69925 38.0 38.0 38.0 35.0 38.0 7 36.6585 38.0 38.0 38.0 35.0 38.0 8 36.63275 38.0 38.0 38.0 35.0 38.0 9 36.723 38.0 38.0 38.0 35.0 38.0 10-14 36.59635 38.0 38.0 38.0 34.6 38.0 15-19 36.53925 38.0 38.0 38.0 34.2 38.0 20-24 36.549 38.0 38.0 38.0 34.4 38.0 25-29 36.48225 38.0 38.0 38.0 34.4 38.0 30-34 36.70715 38.0 38.0 38.0 35.6 38.0 35-39 36.66705 38.0 38.0 38.0 35.0 38.0 40-44 36.4222 38.0 38.0 38.0 34.2 38.0 45-49 36.2384 38.0 38.0 38.0 33.6 38.0 50-54 36.15495 38.0 37.8 38.0 33.4 38.0 55-59 36.1906 38.0 38.0 38.0 33.6 38.0 60-64 36.215599999999995 38.0 37.8 38.0 33.6 38.0 65-69 36.205749999999995 38.0 38.0 38.0 33.8 38.0 70-74 35.7755 38.0 37.2 38.0 31.0 38.0 75-79 35.66485 38.0 37.0 38.0 30.6 38.0 80-84 35.607299999999995 38.0 37.0 38.0 30.0 38.0 85-89 35.78455 38.0 37.2 38.0 31.4 38.0 90-94 35.7008 38.0 37.0 38.0 31.2 38.0 95-99 35.6563 38.0 37.0 38.0 31.2 38.0 100-104 35.26415 38.0 36.4 38.0 29.0 38.0 105-109 35.18355 38.0 36.2 38.0 28.8 38.0 110-114 34.818450000000006 38.0 35.6 38.0 27.2 38.0 115-119 34.42145 38.0 35.0 38.0 25.0 38.0 120-124 33.62 38.0 34.0 38.0 17.8 38.0 125-129 33.60269999999999 38.0 34.0 38.0 19.4 38.0 130-134 33.59155 38.0 34.0 38.0 19.8 38.0 135-139 33.1935 38.0 33.8 38.0 18.4 38.0 140-144 32.010450000000006 37.2 32.0 38.0 14.0 38.0 145-149 31.583299999999998 37.4 31.8 38.0 11.2 38.0 150-151 27.528875 35.0 16.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 7.0 4 1.0 5 1.0 6 3.0 7 6.0 8 1.0 9 2.0 10 0.0 11 1.0 12 1.0 13 4.0 14 7.0 15 6.0 16 2.0 17 7.0 18 3.0 19 10.0 20 11.0 21 10.0 22 14.0 23 25.0 24 11.0 25 29.0 26 32.0 27 39.0 28 42.0 29 55.0 30 75.0 31 97.0 32 115.0 33 149.0 34 245.0 35 391.0 36 729.0 37 1855.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.58414603650913 21.080270067516878 16.754188547136785 25.581395348837212 2 27.900000000000002 26.900000000000002 28.175 17.025000000000002 3 21.6 28.95 29.475 19.975 4 23.674999999999997 35.875 21.95 18.5 5 24.725 35.8 22.475 17.0 6 21.4 35.575 24.2 18.825 7 20.1 22.975 38.35 18.575 8 23.724999999999998 25.0 25.825 25.45 9 21.7 27.35 29.45 21.5 10-14 24.165 29.125 26.314999999999998 20.395 15-19 23.78 27.644999999999996 27.855 20.72 20-24 23.54 28.48 27.189999999999998 20.79 25-29 23.525 28.03 27.67 20.775 30-34 23.305 28.634999999999998 27.455000000000002 20.605 35-39 24.015 27.91 27.800000000000004 20.275000000000002 40-44 23.745 28.07 28.065 20.119999999999997 45-49 23.915 27.905 27.900000000000002 20.28 50-54 23.330000000000002 27.96 28.37 20.34 55-59 23.575 27.87 28.46 20.095 60-64 23.919999999999998 27.889999999999997 28.07 20.119999999999997 65-69 23.43 28.575 27.889999999999997 20.105 70-74 23.775 28.405 28.115000000000002 19.705000000000002 75-79 23.630000000000003 28.494999999999997 28.055000000000003 19.82 80-84 23.025000000000002 28.23 28.485 20.26 85-89 24.335 27.255000000000003 28.410000000000004 20.0 90-94 23.89 28.285 28.175 19.650000000000002 95-99 24.205 27.765 28.095 19.935 100-104 24.215 28.12 28.235 19.43 105-109 23.845 27.6 28.77 19.785 110-114 23.59 28.49 27.725 20.195 115-119 24.27 28.155 27.955000000000002 19.62 120-124 24.41 27.79 27.99 19.81 125-129 24.485 27.82 28.294999999999998 19.400000000000002 130-134 24.099999999999998 28.02 28.18 19.7 135-139 24.39 27.71 28.804999999999996 19.095000000000002 140-144 24.83 27.77 27.765 19.634999999999998 145-149 25.185000000000002 28.115000000000002 27.665 19.035 150-151 25.0125 27.3 28.4125 19.275000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 1.0 14 1.0 15 0.5 16 0.5 17 1.0 18 1.5 19 0.5 20 0.0 21 0.0 22 1.5 23 2.0 24 1.0 25 1.5 26 3.0 27 3.5 28 4.5 29 5.5 30 11.0 31 21.0 32 25.0 33 32.0 34 46.5 35 62.0 36 81.0 37 116.0 38 140.0 39 175.5 40 226.5 41 242.0 42 246.5 43 274.5 44 295.0 45 278.5 46 261.0 47 251.0 48 229.5 49 193.5 50 160.5 51 137.5 52 113.5 53 89.5 54 70.5 55 49.5 56 38.5 57 32.0 58 19.5 59 15.0 60 11.0 61 7.5 62 7.0 63 5.5 64 2.5 65 0.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39516129032258 98.6 2 0.45362903225806456 0.8999999999999999 3 0.12600806451612903 0.375 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTCGTAGGTTGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (97% over 34bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.025 0.0 0.0 0.0 0.0 88-89 0.05 0.0 0.0 0.0 0.0 90-91 0.1125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.1875 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.375 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.44999999999999996 0.0 0.0 0.0 0.0 110-111 0.5625 0.0 0.0 0.0 0.0 112-113 0.7250000000000001 0.0 0.0 0.0 0.0 114-115 0.9375 0.0 0.0 0.0 0.0 116-117 1.1 0.0 0.0 0.0 0.0 118-119 1.325 0.0 0.0 0.0 0.0 120-121 1.5375 0.0 0.0 0.0 0.0 122-123 1.6875 0.0 0.0 0.0 0.0 124-125 1.8624999999999998 0.0 0.0 0.0 0.0 126-127 2.0125 0.0 0.0 0.0 0.0 128-129 2.2750000000000004 0.0 0.0 0.0 0.0 130-131 2.5 0.0 0.0 0.0 0.0 132-133 2.7750000000000004 0.0 0.0 0.0 0.0 134-135 3.0250000000000004 0.0 0.0 0.0 0.0 136-137 3.2249999999999996 0.0 0.0 0.0 0.0 138-139 3.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCATTC 10 0.006830828 145.0 6 AAAAAAA 30 0.0014437955 24.166668 10-14 >>END_MODULE Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491484 spots for SRR6053278.sra Written 2491484 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra Read 2491474 spots for SRR6053278.sra Written 2491474 spots for SRR6053278.sra SRR ids: ['SRR6053278.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_j7j48jg2 SRR6053278.sra spots: 49829490 blocks: [[1, 2491474], [2491475, 4982948], [4982949, 7474422], [7474423, 9965896], [9965897, 12457370], [12457371, 14948844], [14948845, 17440318], [17440319, 19931792], [19931793, 22423266], [22423267, 24914740], [24914741, 27406214], [27406215, 29897688], [29897689, 32389162], [32389163, 34880636], [34880637, 37372110], [37372111, 39863584], [39863585, 42355058], [42355059, 44846532], [44846533, 47338006], [47338007, 49829490]] SRR6053278 file size 16863878 SRR6053278 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053278 SRR6053278_1.fastq SRR6053278_2.fastq Input file: SRR6053278_1.fastq Paired file: SRR6053278_2.fastq trimmed: SRR6053278-trimmed-pair1.fastq, SRR6053278-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:30:36 2025 >> started Tue Feb 11 17:31:53 2025 >> done (76.363s) 49829490 read pairs processed; of these: 100455 ( 0.20%) short read pairs filtered out after trimming by size control 116061 ( 0.23%) empty read pairs filtered out after trimming by size control 49612974 (99.57%) read pairs available; of these: 20264504 (40.85%) trimmed read pairs available after processing 29348470 (59.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 7 0.00% 21 9 0.00% 22 21 0.00% 23 18 0.00% 24 15 0.00% 25 17 0.00% 26 20 0.00% 27 12 0.00% 28 16 0.00% 29 18 0.00% 30 14 0.00% 31 22 0.00% 32 14 0.00% 33 16 0.00% 34 19 0.00% 35 19 0.00% 36 26 0.00% 37 28 0.00% 38 29 0.00% 39 32 0.00% 40 27 0.00% 41 35 0.00% 42 34 0.00% 43 41 0.00% 44 45 0.00% 45 57 0.00% 46 69 0.00% 47 72 0.00% 48 89 0.00% 49 99 0.00% 50 110 0.00% 51 125 0.00% 52 123 0.00% 53 126 0.00% 54 157 0.00% 55 173 0.00% 56 204 0.00% 57 213 0.00% 58 226 0.00% 59 265 0.00% 60 294 0.00% 61 369 0.00% 62 374 0.00% 63 411 0.00% 64 534 0.00% 65 539 0.00% 66 564 0.00% 67 639 0.00% 68 715 0.00% 69 800 0.00% 70 948 0.00% 71 1069 0.00% 72 1241 0.00% 73 1442 0.00% 74 1520 0.00% 75 1875 0.00% 76 2136 0.00% 77 2447 0.00% 78 2564 0.01% 79 2824 0.01% 80 3211 0.01% 81 3786 0.01% 82 4341 0.01% 83 5257 0.01% 84 9800 0.02% 85 12728 0.03% 86 13474 0.03% 87 15126 0.03% 88 16375 0.03% 89 16913 0.03% 90 16912 0.03% 91 16645 0.03% 92 17562 0.04% 93 18666 0.04% 94 19882 0.04% 95 21320 0.04% 96 22140 0.04% 97 22839 0.05% 98 24169 0.05% 99 25140 0.05% 100 27536 0.06% 101 28887 0.06% 102 30926 0.06% 103 33253 0.07% 104 35238 0.07% 105 37817 0.08% 106 40140 0.08% 107 41405 0.08% 108 44165 0.09% 109 46786 0.09% 110 49365 0.10% 111 51339 0.10% 112 55345 0.11% 113 60200 0.12% 114 64893 0.13% 115 69638 0.14% 116 72846 0.15% 117 74558 0.15% 118 76394 0.15% 119 78598 0.16% 120 81516 0.16% 121 84892 0.17% 122 89300 0.18% 123 94043 0.19% 124 98961 0.20% 125 103953 0.21% 126 108724 0.22% 127 113781 0.23% 128 119497 0.24% 129 124113 0.25% 130 129145 0.26% 131 135215 0.27% 132 142036 0.29% 133 151660 0.31% 134 161660 0.33% 135 172561 0.35% 136 181201 0.37% 137 194545 0.39% 138 206798 0.42% 139 220995 0.45% 140 235857 0.48% 141 256110 0.52% 142 283000 0.57% 143 317846 0.64% 144 364484 0.73% 145 431005 0.87% 146 527722 1.06% 147 708504 1.43% 148 1028500 2.07% 149 1989368 4.01% 150 10055924 20.27% 151 29348470 59.15% 49612974 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.79 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=2.4 sequence=ATCAGGCAGTTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=94.75 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.4 sequence=CATCAATGGCACTCTCTCACAGCCAATAACTTCAACAACTTCCCTATCTTTAATCCTCTCACTCCACAAATTCATAAGCTTCACCATTTTACTTCACCAATTCCTTAGAGATGTAATAGCCCATAACAATAGGAAATATCAGAAATCCAATAAGAATCAGCAATTCAGGAAGAAATATGACAAGGAGTAGTAGTGTGGATGTTGTTGTTAGACACTTCTTTTTGTCTTTAAATATAAGGCGTGGTAGAATTACTGGCACTCCAATGATTCCATATAACGGCCATAATGGAGCTATAGAATACAACACCAACGTCGCAAAAAACCAGCAAAAATTCTTAACATTATTTTTAGAAATCCCATACTGCCACCGAATATTCAGTCCTTTAAGAAATCGAACAGCATACCCAACATAGTAAAAACCATCAATAATGCAAATACCGTTACCACAAGTGCAAATACTCCCATTCCTACCTCTC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.56 fanout-score-rank=24 prefix-density=0.41 prefix-fanout=2.8 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.08 sequence-density-rank=16 fanout-score=275.64 fanout-score-rank=1 prefix-density=0.90 prefix-fanout=24.3 sequence=AAGAAGAAGAAA SRR6053278 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:32:44 Started mapping on | Feb 11 17:32:44 Finished on | Feb 11 17:44:09 Mapping speed, Million of reads per hour | 260.74 Number of input reads | 49612974 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 43197614 Uniquely mapped reads % | 87.07% Average mapped length | 294.47 Number of splices: Total | 36383023 Number of splices: Annotated (sjdb) | 35575185 Number of splices: GT/AG | 35733167 Number of splices: GC/AG | 459550 Number of splices: AT/AC | 35557 Number of splices: Non-canonical | 154749 Mismatch rate per base, % | 0.78% Deletion rate per base | 0.07% Deletion average length | 2.95 Insertion rate per base | 0.05% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1310805 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 122763 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.91% % of reads unmapped: other | 0.14% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 5178016 5178016 5178016 N_multimapping 1310805 1310805 1310805 N_noFeature 1043434 42729536 1188708 N_ambiguous 587894 2018 264712 UnstrandedReadsAssigned:41566286 PositiveStrandReadsAssigned:466060 NegativeStrandReadsAssigned:41744194 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6053278 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053278-trimmed-pair1.fastq SRR6053278-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 49,612,974 reads, 41,271,092 reads pseudoaligned [quant] estimated average fragment length: 234.551 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,318 rounds 52401 SRR6053278.ke.tsv 34699 SRR6053278.se.tsv 87100 total ==> SRR6053278.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1784.45 3670 45.8912 Potri.005G024800.1.v4.1 1035 801.449 1220 33.9665 Potri.004G059700.1.v4.1 961 727.459 53 1.62568 Potri.007G009000.2.v4.1 1416 1182.45 0 0 Potri.003G141000.2.v4.1 2943 2709.45 1392 11.4637 Potri.016G087400.1.v4.1 270 75.8823 4553.44 1338.96 Potri.015G069301.1.v4.1 564 332.465 0 0 Potri.010G195200.1.v4.1 1773 1539.45 335 4.85564 Potri.012G127500.1.v4.1 977 743.454 17285 518.779 ==> SRR6053278.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 5013 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1156 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 21 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 29 SRR6053278 completed mapping pipeline successfully