Starting /dee2/code/volunteer_pipeline.sh SRR6053279 current disk space = 3048567963648 free memory = 1482437836 SRR6053279 SRAfilesize 1990155d26d2fd4c56c46711309c2de1 SRR6053279.sra SRR6053279.sra file validated SRR6053279 is paired end SRR6053279 is conventional basespace SRR6053279 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053279_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7105 34.0 33.0 34.0 25.0 34.0 2 32.84575 34.0 33.0 34.0 28.0 34.0 3 33.029 34.0 33.0 34.0 32.0 34.0 4 33.198 34.0 33.0 34.0 32.0 34.0 5 33.222 34.0 33.0 34.0 33.0 34.0 6 36.735 38.0 37.0 38.0 34.0 38.0 7 37.13025 38.0 38.0 38.0 36.0 38.0 8 37.23725 38.0 38.0 38.0 36.0 38.0 9 37.373 38.0 38.0 38.0 37.0 38.0 10-14 37.320449999999994 38.0 38.0 38.0 37.0 38.0 15-19 37.2797 38.0 38.0 38.0 36.8 38.0 20-24 37.2604 38.0 38.0 38.0 37.0 38.0 25-29 37.2192 38.0 38.0 38.0 36.6 38.0 30-34 37.17195 38.0 38.0 38.0 36.2 38.0 35-39 37.14415 38.0 38.0 38.0 36.0 38.0 40-44 37.0771 38.0 38.0 38.0 36.0 38.0 45-49 37.04565 38.0 38.0 38.0 36.0 38.0 50-54 37.0236 38.0 38.0 38.0 36.0 38.0 55-59 36.9527 38.0 38.0 38.0 36.0 38.0 60-64 36.94494999999999 38.0 38.0 38.0 35.8 38.0 65-69 36.9293 38.0 38.0 38.0 35.8 38.0 70-74 36.875150000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.844300000000004 38.0 38.0 38.0 35.4 38.0 80-84 36.77435 38.0 38.0 38.0 35.0 38.0 85-89 36.6212 38.0 38.0 38.0 34.2 38.0 90-94 36.612350000000006 38.0 38.0 38.0 34.4 38.0 95-99 36.47775 38.0 38.0 38.0 34.0 38.0 100-104 36.580749999999995 38.0 38.0 38.0 34.2 38.0 105-109 36.37635 38.0 38.0 38.0 34.0 38.0 110-114 36.24485 38.0 38.0 38.0 33.8 38.0 115-119 36.07185 38.0 37.0 38.0 33.0 38.0 120-124 36.02695 38.0 37.2 38.0 33.0 38.0 125-129 35.92635 38.0 37.0 38.0 33.0 38.0 130-134 35.70795 38.0 36.8 38.0 31.6 38.0 135-139 35.64215 38.0 36.4 38.0 32.0 38.0 140-144 35.352199999999996 38.0 36.0 38.0 31.0 38.0 145-149 34.78945 38.0 35.8 38.0 28.8 38.0 150-151 32.564875 37.0 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 1.0 14 1.0 15 1.0 16 0.0 17 6.0 18 1.0 19 3.0 20 5.0 21 3.0 22 8.0 23 5.0 24 11.0 25 16.0 26 18.0 27 21.0 28 31.0 29 37.0 30 36.0 31 56.0 32 64.0 33 91.0 34 142.0 35 204.0 36 535.0 37 2701.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 21.711956521739133 12.03804347826087 13.858695652173914 52.391304347826086 2 18.7 20.65 39.425 21.224999999999998 3 20.25 25.0 24.224999999999998 30.525000000000002 4 22.55 32.800000000000004 21.8 22.85 5 21.125 36.35 25.15 17.375 6 16.35 37.15 25.95 20.549999999999997 7 13.25 21.325 45.775 19.650000000000002 8 18.099999999999998 22.175 31.0 28.725 9 18.099999999999998 22.3 33.15 26.450000000000003 10-14 19.805 29.195 26.755000000000003 24.245 15-19 19.675 29.005 27.1 24.22 20-24 19.919999999999998 28.645 28.095 23.34 25-29 19.869999999999997 28.055000000000003 27.93 24.145 30-34 19.73 28.84 28.000000000000004 23.43 35-39 19.88 28.815 27.529999999999998 23.775 40-44 20.19 28.425 27.58 23.805 45-49 20.015 28.96 27.42 23.605 50-54 20.06 28.294999999999998 27.500000000000004 24.145 55-59 20.49 28.455000000000002 27.625 23.43 60-64 20.43 27.994999999999997 27.415 24.16 65-69 20.445 28.04 27.82 23.695 70-74 20.125 27.93 27.82 24.125 75-79 19.84 28.87 28.084999999999997 23.205000000000002 80-84 20.025000000000002 27.985 28.110000000000003 23.880000000000003 85-89 20.52 28.405 27.305 23.77 90-94 20.315 27.845 27.705000000000002 24.135 95-99 20.599999999999998 28.175 27.79 23.435 100-104 20.599999999999998 28.365000000000002 27.35 23.685000000000002 105-109 20.415 28.215 27.939999999999998 23.43 110-114 20.41 28.625 27.74 23.225 115-119 20.625 28.16 27.175 24.04 120-124 21.33 28.384999999999998 26.889999999999997 23.395 125-129 21.26 27.689999999999998 27.41 23.64 130-134 20.27 28.754999999999995 27.529999999999998 23.445 135-139 20.915 28.255000000000003 26.935 23.895 140-144 21.21 28.355000000000004 26.840000000000003 23.595 145-149 21.23 28.29 26.590000000000003 23.89 150-151 21.175 28.6625 25.9875 24.175 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.5 23 1.5 24 1.5 25 2.0 26 3.5 27 7.0 28 12.5 29 14.0 30 19.0 31 26.5 32 32.5 33 44.5 34 54.5 35 77.5 36 103.5 37 105.5 38 117.5 39 157.5 40 192.5 41 238.0 42 261.5 43 250.5 44 258.0 45 264.0 46 263.0 47 264.5 48 239.5 49 197.5 50 167.0 51 142.0 52 113.5 53 85.0 54 63.5 55 49.0 56 36.5 57 29.5 58 31.5 59 25.5 60 16.5 61 9.5 62 4.5 63 2.5 64 1.0 65 2.5 66 3.0 67 1.5 68 1.0 69 1.0 70 1.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0125 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0125 0.0 0.0 0.025 0.0 74-75 0.025 0.0 0.0 0.025 0.0 76-77 0.025 0.0 0.0 0.025 0.0 78-79 0.025 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.05 0.0 0.0 0.025 0.0 84-85 0.075 0.0 0.0 0.025 0.0 86-87 0.125 0.0 0.0 0.025 0.0 88-89 0.125 0.0 0.0 0.025 0.0 90-91 0.15 0.0 0.0 0.025 0.0 92-93 0.2 0.0 0.0 0.025 0.0 94-95 0.2375 0.0 0.0 0.025 0.0 96-97 0.325 0.0 0.0 0.025 0.0 98-99 0.425 0.0 0.0 0.025 0.0 100-101 0.4375 0.0 0.0 0.025 0.0 102-103 0.575 0.0 0.0 0.025 0.0 104-105 0.8625 0.0 0.0 0.025 0.0 106-107 0.9625 0.0 0.0 0.025 0.0 108-109 1.125 0.0 0.0 0.025 0.0 110-111 1.3125 0.0 0.0 0.025 0.0 112-113 1.5625 0.0 0.0 0.025 0.0 114-115 1.8125 0.0 0.0 0.025 0.0 116-117 2.05 0.0 0.0 0.025 0.0 118-119 2.3499999999999996 0.0 0.0 0.025 0.0 120-121 2.5875000000000004 0.0 0.0 0.025 0.0 122-123 3.0374999999999996 0.0 0.0 0.025 0.0 124-125 3.4 0.0 0.0 0.025 0.0 126-127 3.7750000000000004 0.0 0.0 0.025 0.0 128-129 4.125 0.0 0.0 0.025 0.0 130-131 4.5 0.0 0.0 0.025 0.0 132-133 4.95 0.0 0.0 0.025 0.0 134-135 5.362500000000001 0.0 0.0 0.025 0.0 136-137 5.825 0.0 0.0 0.025 0.0 138-139 6.362500000000001 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6053279 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053279_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.6475 33.0 33.0 34.0 32.0 34.0 2 32.8485 33.0 33.0 34.0 32.0 34.0 3 32.84275 33.0 33.0 34.0 32.0 34.0 4 32.831 33.0 33.0 34.0 32.0 34.0 5 32.892 33.0 33.0 34.0 32.0 34.0 6 37.032 38.0 38.0 38.0 36.0 38.0 7 37.16825 38.0 38.0 38.0 37.0 38.0 8 37.0855 38.0 38.0 38.0 36.0 38.0 9 36.98375 38.0 38.0 38.0 36.0 38.0 10-14 37.06975 38.0 38.0 38.0 36.2 38.0 15-19 37.0464 38.0 38.0 38.0 36.0 38.0 20-24 37.04749999999999 38.0 38.0 38.0 36.0 38.0 25-29 37.08485 38.0 38.0 38.0 36.4 38.0 30-34 36.96085 38.0 38.0 38.0 36.0 38.0 35-39 36.97575 38.0 38.0 38.0 36.0 38.0 40-44 36.98225 38.0 38.0 38.0 36.0 38.0 45-49 36.93955 38.0 38.0 38.0 36.0 38.0 50-54 36.87175 38.0 38.0 38.0 36.0 38.0 55-59 36.84409999999999 38.0 38.0 38.0 35.8 38.0 60-64 36.84415 38.0 38.0 38.0 35.6 38.0 65-69 36.80030000000001 38.0 38.0 38.0 35.6 38.0 70-74 36.8156 38.0 38.0 38.0 35.4 38.0 75-79 36.79665 38.0 38.0 38.0 35.6 38.0 80-84 36.722300000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.67445 38.0 38.0 38.0 35.2 38.0 90-94 36.53065 38.0 38.0 38.0 34.2 38.0 95-99 36.37925 38.0 38.0 38.0 34.0 38.0 100-104 36.334050000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.1582 38.0 38.0 38.0 33.4 38.0 110-114 36.213800000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.01435 38.0 38.0 38.0 33.0 38.0 120-124 35.853750000000005 38.0 38.0 38.0 32.4 38.0 125-129 35.748149999999995 38.0 37.8 38.0 32.6 38.0 130-134 35.58825 38.0 37.4 38.0 31.4 38.0 135-139 35.42445 38.0 36.6 38.0 31.0 38.0 140-144 35.1165 38.0 36.0 38.0 31.0 38.0 145-149 34.498799999999996 38.0 36.0 38.0 27.0 38.0 150-151 31.610625 37.0 32.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 1.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 1.0 15 0.0 16 3.0 17 1.0 18 1.0 19 5.0 20 5.0 21 9.0 22 10.0 23 16.0 24 16.0 25 17.0 26 19.0 27 31.0 28 29.0 29 43.0 30 51.0 31 47.0 32 61.0 33 87.0 34 138.0 35 190.0 36 395.0 37 2811.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.13470205307962 14.57185778668002 18.652979469203807 43.64046069103655 2 23.275000000000002 21.9 37.75 17.075000000000003 3 18.8344172086043 25.812906453226613 32.7663831915958 22.586293146573286 4 23.267450587940957 31.823867900925695 23.46760070052539 21.441080810607957 5 23.792844633475106 35.02626970227671 24.39329497122842 16.787590693019766 6 17.972465581977474 37.246558197747184 24.58072590738423 20.200250312891114 7 17.792792792792792 16.516516516516518 43.84384384384384 21.846846846846844 8 18.728092138207312 22.784176264396592 31.57235853780671 26.91537305958938 9 21.00650976464697 23.38507761642464 30.29544316474712 25.31296945418127 10-14 22.55883825738608 28.813219829744618 26.70005007511267 21.927891837756636 15-19 22.959847802142786 27.330529688595174 27.485731450886153 22.223891058375887 20-24 22.112062490611386 27.655099894847528 28.270992939762657 21.961844674778426 25-29 21.74500675777144 27.691845622465838 28.743054512689593 21.820093107073134 30-34 22.057571964956196 28.430538172715895 28.305381727158952 21.20650813516896 35-39 22.474722194413854 27.745520072079287 28.461307438181997 21.318450295324855 40-44 22.914789225993793 27.51076399319115 28.171623110043054 21.402823670772005 45-49 22.458581510586114 28.044446669002454 27.939336303118274 21.557635517293157 50-54 22.388507933329997 27.954352069673156 27.734120826868214 21.923019170128637 55-59 23.03148620914051 26.92095910296841 28.07228312559443 21.97527156229664 60-64 22.425789658106822 27.65179956950493 28.152375231516242 21.770035540872 65-69 22.855855404796475 27.62729685074851 27.887648325239073 21.62919941921594 70-74 22.624411735255833 28.05647341544007 27.71102433163112 21.608090517672977 75-79 23.475212819228844 26.955433149724588 28.11717576364547 21.452178267401102 80-84 23.760889155902674 27.51076399319115 27.485731450886153 21.242615400020025 85-89 22.992189064690567 27.728820348487883 28.1393951532145 21.13959543360705 90-94 22.835118630493543 27.51526679347282 28.155971568725597 21.493643007308037 95-99 23.44962210320837 28.14955703488663 26.90324841083137 21.497572451073626 100-104 23.095404945439984 27.665431975172687 28.000800880969066 21.23836219841826 105-109 23.141240674911128 28.318229609973468 27.59224953687478 20.948280178240626 110-114 23.25907384230288 28.38548185231539 27.67959949937422 20.67584480600751 115-119 24.443109576012414 27.306402362717126 27.84201832106923 20.408469740201234 120-124 23.5656353259237 28.05647341544007 27.395614298588168 20.98227696004806 125-129 24.004806970106653 27.524911121125633 27.725201542236245 20.74508036653147 130-134 24.47927097937112 27.93410775085119 27.1179651512117 20.468656118565992 135-139 24.82982982982983 27.95795795795796 27.087087087087085 20.125125125125127 140-144 24.23544721958056 28.214625356624456 26.803143300465486 20.746784123329494 145-149 24.424424424424423 28.128128128128125 27.16216216216216 20.285285285285283 150-151 24.824912456228116 27.576288144072038 27.60130065032516 19.997498749374685 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 2.0 22 2.0 23 1.0 24 2.0 25 2.5 26 2.0 27 4.5 28 8.5 29 10.5 30 12.5 31 19.5 32 24.5 33 28.0 34 42.5 35 56.0 36 82.5 37 117.5 38 137.0 39 156.5 40 187.0 41 215.0 42 245.5 43 267.5 44 275.0 45 276.0 46 281.5 47 257.5 48 225.5 49 209.5 50 172.0 51 145.0 52 117.5 53 100.5 54 83.0 55 51.0 56 42.5 57 40.5 58 26.5 59 18.5 60 13.5 61 8.5 62 8.5 63 5.5 64 2.0 65 1.5 66 1.0 67 0.5 68 0.5 69 0.5 70 1.0 71 1.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.0 3 0.05 4 0.075 5 0.075 6 0.125 7 0.1 8 0.15 9 0.15 10-14 0.15 15-19 0.13 20-24 0.145 25-29 0.11499999999999999 30-34 0.125 35-39 0.11 40-44 0.13 45-49 0.105 50-54 0.105 55-59 0.11499999999999999 60-64 0.11499999999999999 65-69 0.135 70-74 0.13 75-79 0.15 80-84 0.13 85-89 0.13999999999999999 90-94 0.11 95-99 0.105 100-104 0.11 105-109 0.135 110-114 0.125 115-119 0.11499999999999999 120-124 0.13 125-129 0.145 130-134 0.13999999999999999 135-139 0.1 140-144 0.105 145-149 0.1 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47222920331743 98.95 2 0.5277707966825836 1.05 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2375 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.425 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.575 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.2875 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.025 0.0 0.0 0.0 0.0 118-119 2.325 0.0 0.0 0.0 0.0 120-121 2.5625 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.7750000000000004 0.0 0.0 0.0 0.0 128-129 4.125 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCAAC 10 0.006830828 145.0 5 >>END_MODULE Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769898 spots for SRR6053279.sra Written 2769898 spots for SRR6053279.sra Read 2769917 spots for SRR6053279.sra Written 2769917 spots for SRR6053279.sra SRR ids: ['SRR6053279.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rovneh0h SRR6053279.sra spots: 55397979 blocks: [[1, 2769898], [2769899, 5539796], [5539797, 8309694], [8309695, 11079592], [11079593, 13849490], [13849491, 16619388], [16619389, 19389286], [19389287, 22159184], [22159185, 24929082], [24929083, 27698980], [27698981, 30468878], [30468879, 33238776], [33238777, 36008674], [36008675, 38778572], [38778573, 41548470], [41548471, 44318368], [44318369, 47088266], [47088267, 49858164], [49858165, 52628062], [52628063, 55397979]] SRR6053279 file size 18750856 SRR6053279 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053279 SRR6053279_1.fastq SRR6053279_2.fastq Input file: SRR6053279_1.fastq Paired file: SRR6053279_2.fastq trimmed: SRR6053279-trimmed-pair1.fastq, SRR6053279-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:06:52 2025 >> started Tue Feb 11 17:07:49 2025 >> done (57.408s) 55397979 read pairs processed; of these: 35577 ( 0.06%) short read pairs filtered out after trimming by size control 36134 ( 0.07%) empty read pairs filtered out after trimming by size control 55326268 (99.87%) read pairs available; of these: 18155414 (32.82%) trimmed read pairs available after processing 37170854 (67.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 9 0.00% 20 8 0.00% 21 9 0.00% 22 11 0.00% 23 12 0.00% 24 10 0.00% 25 11 0.00% 26 11 0.00% 27 11 0.00% 28 13 0.00% 29 12 0.00% 30 16 0.00% 31 11 0.00% 32 21 0.00% 33 21 0.00% 34 16 0.00% 35 25 0.00% 36 23 0.00% 37 28 0.00% 38 39 0.00% 39 37 0.00% 40 32 0.00% 41 52 0.00% 42 48 0.00% 43 57 0.00% 44 52 0.00% 45 76 0.00% 46 72 0.00% 47 84 0.00% 48 104 0.00% 49 128 0.00% 50 157 0.00% 51 132 0.00% 52 168 0.00% 53 194 0.00% 54 175 0.00% 55 223 0.00% 56 228 0.00% 57 260 0.00% 58 314 0.00% 59 360 0.00% 60 417 0.00% 61 463 0.00% 62 503 0.00% 63 577 0.00% 64 592 0.00% 65 651 0.00% 66 754 0.00% 67 774 0.00% 68 903 0.00% 69 1056 0.00% 70 1196 0.00% 71 1342 0.00% 72 1477 0.00% 73 1661 0.00% 74 1878 0.00% 75 2067 0.00% 76 2431 0.00% 77 2715 0.00% 78 2988 0.01% 79 3341 0.01% 80 3858 0.01% 81 4219 0.01% 82 4865 0.01% 83 5446 0.01% 84 6797 0.01% 85 8263 0.01% 86 8988 0.02% 87 10085 0.02% 88 11355 0.02% 89 12312 0.02% 90 13637 0.02% 91 14818 0.03% 92 16281 0.03% 93 17644 0.03% 94 19679 0.04% 95 21644 0.04% 96 23834 0.04% 97 25561 0.05% 98 28255 0.05% 99 30086 0.05% 100 32839 0.06% 101 35367 0.06% 102 37999 0.07% 103 40763 0.07% 104 43750 0.08% 105 46995 0.08% 106 50940 0.09% 107 55397 0.10% 108 58493 0.11% 109 62274 0.11% 110 66047 0.12% 111 70754 0.13% 112 74873 0.14% 113 78424 0.14% 114 82247 0.15% 115 88878 0.16% 116 93398 0.17% 117 97840 0.18% 118 104466 0.19% 119 110018 0.20% 120 114619 0.21% 121 119444 0.22% 122 124084 0.22% 123 128111 0.23% 124 134970 0.24% 125 140591 0.25% 126 146585 0.26% 127 153033 0.28% 128 160392 0.29% 129 164413 0.30% 130 171754 0.31% 131 178225 0.32% 132 182535 0.33% 133 191409 0.35% 134 198980 0.36% 135 207091 0.37% 136 215460 0.39% 137 225288 0.41% 138 237661 0.43% 139 248386 0.45% 140 262770 0.47% 141 277609 0.50% 142 298619 0.54% 143 319801 0.58% 144 354523 0.64% 145 398288 0.72% 146 467680 0.85% 147 580103 1.05% 148 813743 1.47% 149 1462143 2.64% 150 7826654 14.15% 151 37170854 67.18% 55326268 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=2.70 fanout-score-rank=23 prefix-density=0.31 prefix-fanout=2.4 sequence=GGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=34.74 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.7 sequence=CACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTA criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.38 fanout-score-rank=19 prefix-density=0.57 prefix-fanout=2.9 sequence=ACCGCACCCCGGCACAAGCCAACATGGTGGCACCATTCAATGGTCTCAAGTCT criterion=fanout-score sequence-density=0.09 sequence-density-rank=35 fanout-score=11.65 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=5.4 sequence=TGAGGTTGAGTACAGGTGCTTTGTTGG SRR6053279 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:08:35 Started mapping on | Feb 11 17:08:35 Finished on | Feb 11 17:15:04 Mapping speed, Million of reads per hour | 512.02 Number of input reads | 55326268 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 51918139 Uniquely mapped reads % | 93.84% Average mapped length | 294.20 Number of splices: Total | 50199911 Number of splices: Annotated (sjdb) | 49081429 Number of splices: GT/AG | 49183848 Number of splices: GC/AG | 775472 Number of splices: AT/AC | 34112 Number of splices: Non-canonical | 206479 Mismatch rate per base, % | 0.75% Deletion rate per base | 0.06% Deletion average length | 3.03 Insertion rate per base | 0.04% Insertion average length | 2.65 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1984812 % of reads mapped to multiple loci | 3.59% Number of reads mapped to too many loci | 402820 % of reads mapped to too many loci | 0.73% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.70% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1444966 1444966 1444966 N_multimapping 1984812 1984812 1984812 N_noFeature 1668670 51269344 1942892 N_ambiguous 707588 2851 331597 UnstrandedReadsAssigned:49541881 PositiveStrandReadsAssigned:645944 NegativeStrandReadsAssigned:49643650 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6053279 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053279-trimmed-pair1.fastq SRR6053279-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 55,326,268 reads, 48,877,089 reads pseudoaligned [quant] estimated average fragment length: 254.088 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,298 rounds 52401 SRR6053279.ke.tsv 34699 SRR6053279.se.tsv 87100 total ==> SRR6053279.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.91 1882 19.4161 Potri.005G024800.1.v4.1 1035 781.912 904 21.0511 Potri.004G059700.1.v4.1 961 708.058 85 2.18582 Potri.007G009000.2.v4.1 1416 1162.91 0 0 Potri.003G141000.2.v4.1 2943 2689.91 2241.76 15.1745 Potri.016G087400.1.v4.1 270 82.712 3514 773.567 Potri.015G069301.1.v4.1 564 321.194 0 0 Potri.010G195200.1.v4.1 1773 1519.91 112 1.34173 Potri.012G127500.1.v4.1 977 723.984 1058 26.6086 ==> SRR6053279.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1826 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 783 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 20 SRR6053279 completed mapping pipeline successfully