Starting /dee2/code/volunteer_pipeline.sh SRR6053280 current disk space = 3048571215872 free memory = 1506073412 SRR6053280 SRAfilesize 72dcfcb095f45a211d25d251943829e7 SRR6053280.sra SRR6053280.sra file validated SRR6053280 is paired end SRR6053280 is conventional basespace SRR6053280 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053280_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2465 34.0 33.0 34.0 31.0 34.0 2 33.0815 34.0 33.0 34.0 31.0 34.0 3 33.26125 34.0 33.0 34.0 32.0 34.0 4 33.4035 34.0 33.0 34.0 33.0 34.0 5 33.4445 34.0 33.0 34.0 33.0 34.0 6 37.0295 38.0 37.0 38.0 36.0 38.0 7 37.43475 38.0 38.0 38.0 37.0 38.0 8 37.4725 38.0 38.0 38.0 37.0 38.0 9 37.561 38.0 38.0 38.0 38.0 38.0 10-14 37.54475 38.0 38.0 38.0 38.0 38.0 15-19 37.557199999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.5149 38.0 38.0 38.0 38.0 38.0 25-29 37.49535 38.0 38.0 38.0 37.8 38.0 30-34 37.4788 38.0 38.0 38.0 37.6 38.0 35-39 37.3917 38.0 38.0 38.0 37.2 38.0 40-44 37.4033 38.0 38.0 38.0 37.0 38.0 45-49 37.30545 38.0 38.0 38.0 37.0 38.0 50-54 37.324850000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.23219999999999 38.0 38.0 38.0 36.8 38.0 60-64 37.232549999999996 38.0 38.0 38.0 36.6 38.0 65-69 37.233349999999994 38.0 38.0 38.0 36.8 38.0 70-74 37.1862 38.0 38.0 38.0 36.2 38.0 75-79 37.0973 38.0 38.0 38.0 36.0 38.0 80-84 37.10675 38.0 38.0 38.0 36.0 38.0 85-89 37.06085 38.0 38.0 38.0 36.0 38.0 90-94 36.87355 38.0 38.0 38.0 35.8 38.0 95-99 36.84665 38.0 38.0 38.0 35.8 38.0 100-104 36.86569999999999 38.0 38.0 38.0 35.6 38.0 105-109 36.72580000000001 38.0 38.0 38.0 35.0 38.0 110-114 36.6862 38.0 38.0 38.0 35.0 38.0 115-119 36.523450000000004 38.0 38.0 38.0 34.0 38.0 120-124 36.37425 38.0 38.0 38.0 34.2 38.0 125-129 36.2793 38.0 38.0 38.0 34.0 38.0 130-134 36.07035 38.0 37.6 38.0 33.4 38.0 135-139 35.9729 38.0 38.0 38.0 33.4 38.0 140-144 35.56855 38.0 36.4 38.0 32.4 38.0 145-149 35.0979 38.0 36.0 38.0 30.4 38.0 150-151 32.8825 37.0 34.0 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 1.0 14 1.0 15 2.0 16 3.0 17 1.0 18 2.0 19 0.0 20 2.0 21 2.0 22 5.0 23 6.0 24 7.0 25 12.0 26 11.0 27 17.0 28 23.0 29 20.0 30 24.0 31 51.0 32 64.0 33 67.0 34 99.0 35 178.0 36 425.0 37 2976.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.47645951035782 16.0075329566855 7.1563088512241055 39.35969868173258 2 19.650000000000002 16.0 36.275 28.075 3 16.954238559639908 19.754938734683673 28.457114278569644 34.83370842710677 4 20.25 25.75 26.075 27.925 5 23.599999999999998 31.1 23.875 21.425 6 19.875 33.85 26.474999999999998 19.8 7 15.15 26.6 40.699999999999996 17.549999999999997 8 16.35 27.575 30.599999999999998 25.474999999999998 9 16.525000000000002 24.7 34.525 24.25 10-14 18.995 30.28 27.74 22.985 15-19 18.7 29.099999999999998 28.389999999999997 23.810000000000002 20-24 19.395 28.994999999999997 28.294999999999998 23.315 25-29 19.62 28.205000000000002 28.144999999999996 24.03 30-34 19.16 28.549999999999997 28.305000000000003 23.985 35-39 19.42 28.77 27.37 24.44 40-44 19.15 29.445 27.46 23.945 45-49 19.12 28.544999999999998 28.22 24.115000000000002 50-54 19.695 28.849999999999998 27.834999999999997 23.62 55-59 19.355 28.73 28.084999999999997 23.830000000000002 60-64 19.765 28.499999999999996 27.825 23.91 65-69 19.81 28.155 27.794999999999998 24.240000000000002 70-74 19.835 28.225 27.35 24.59 75-79 19.66 28.92 27.435 23.985 80-84 20.405 28.13 28.17 23.294999999999998 85-89 20.01 28.035 28.215 23.74 90-94 20.31 28.7 27.61 23.380000000000003 95-99 19.62 28.189999999999998 27.715 24.474999999999998 100-104 20.445 27.985 27.694999999999997 23.875 105-109 20.21 28.299999999999997 27.495000000000005 23.995 110-114 21.015 27.83 27.33 23.825 115-119 20.45 28.16 27.46 23.93 120-124 20.62 28.18 27.13 24.07 125-129 20.505000000000003 28.025 27.27 24.2 130-134 20.8 27.845 27.400000000000002 23.955000000000002 135-139 20.51 27.79 27.345000000000002 24.355 140-144 20.94 28.410000000000004 26.415 24.235 145-149 20.61 28.425 26.325 24.64 150-151 20.828121090818115 27.745809357017766 26.682511883912934 24.74355766825119 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 2.0 25 3.0 26 5.0 27 5.5 28 7.0 29 13.5 30 20.0 31 26.0 32 41.0 33 54.0 34 60.5 35 83.5 36 97.5 37 109.5 38 140.5 39 179.5 40 220.5 41 235.5 42 238.0 43 247.5 44 272.0 45 279.5 46 261.5 47 261.0 48 239.5 49 183.0 50 141.0 51 124.5 52 105.5 53 84.5 54 64.5 55 42.5 56 32.5 57 29.0 58 20.5 59 12.0 60 10.0 61 10.5 62 6.5 63 2.5 64 4.0 65 3.5 66 2.0 67 2.0 68 2.0 69 1.5 70 1.0 71 1.5 72 1.5 73 1.5 74 1.5 75 0.5 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.074999999999999 2 0.0 3 0.025 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.6 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59839357429718 99.2 2 0.4016064257028112 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.30000000000000004 0.0 0.0 0.0 0.0 84-85 0.42500000000000004 0.0 0.0 0.0 0.0 86-87 0.525 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.875 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.3125 0.0 0.0 0.0 0.0 100-101 1.5 0.0 0.0 0.0 0.0 102-103 1.7875 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.35 0.0 0.0 0.0 0.0 108-109 2.6125 0.0 0.0 0.0 0.0 110-111 3.0625 0.0 0.0 0.0 0.0 112-113 3.525 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.4125 0.0 0.0 0.0 0.0 118-119 4.824999999999999 0.0 0.0 0.0 0.0 120-121 5.275 0.0 0.0 0.0 0.0 122-123 5.8 0.025 0.0 0.0 0.0 124-125 6.175 0.025 0.0 0.0 0.0 126-127 6.487500000000001 0.025 0.0 0.0 0.0 128-129 7.1625 0.025 0.0 0.0 0.0 130-131 7.8375 0.025 0.0 0.0 0.0 132-133 8.5125 0.025 0.0 0.0 0.0 134-135 9.3625 0.025 0.0 0.0 0.0 136-137 10.087499999999999 0.025 0.0 0.0 0.0 138-139 10.675 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGATG 10 0.006846698 144.88751 9 >>END_MODULE SRR6053280 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053280_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.86475 33.0 33.0 34.0 32.0 34.0 2 32.932 33.0 33.0 34.0 32.0 34.0 3 33.01625 34.0 33.0 34.0 32.0 34.0 4 32.87375 34.0 33.0 34.0 32.0 34.0 5 32.93425 34.0 33.0 34.0 32.0 34.0 6 37.1495 38.0 38.0 38.0 37.0 38.0 7 37.15775 38.0 38.0 38.0 37.0 38.0 8 37.15625 38.0 38.0 38.0 37.0 38.0 9 36.99575 38.0 38.0 38.0 36.0 38.0 10-14 37.15755 38.0 38.0 38.0 37.0 38.0 15-19 37.17999999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.16035 38.0 38.0 38.0 37.0 38.0 25-29 37.14829999999999 38.0 38.0 38.0 37.0 38.0 30-34 37.184099999999994 38.0 38.0 38.0 37.0 38.0 35-39 37.1161 38.0 38.0 38.0 37.0 38.0 40-44 37.08895 38.0 38.0 38.0 37.0 38.0 45-49 37.08565 38.0 38.0 38.0 37.0 38.0 50-54 37.04935 38.0 38.0 38.0 36.8 38.0 55-59 37.0278 38.0 38.0 38.0 36.6 38.0 60-64 36.952000000000005 38.0 38.0 38.0 36.0 38.0 65-69 36.93205 38.0 38.0 38.0 36.2 38.0 70-74 36.938550000000006 38.0 38.0 38.0 36.2 38.0 75-79 36.94885000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.8729 38.0 38.0 38.0 36.0 38.0 85-89 36.76625 38.0 38.0 38.0 36.0 38.0 90-94 36.7598 38.0 38.0 38.0 36.0 38.0 95-99 36.63105 38.0 38.0 38.0 35.2 38.0 100-104 36.60175 38.0 38.0 38.0 35.0 38.0 105-109 36.55875 38.0 38.0 38.0 35.0 38.0 110-114 36.4459 38.0 38.0 38.0 34.8 38.0 115-119 36.25745 38.0 38.0 38.0 34.2 38.0 120-124 36.22745 38.0 38.0 38.0 34.0 38.0 125-129 36.111399999999996 38.0 38.0 38.0 34.0 38.0 130-134 35.984750000000005 38.0 38.0 38.0 33.6 38.0 135-139 35.7219 38.0 38.0 38.0 33.0 38.0 140-144 35.4627 38.0 37.2 38.0 32.2 38.0 145-149 34.880649999999996 38.0 36.0 38.0 30.2 38.0 150-151 32.153875 37.0 32.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 0.0 5 1.0 6 2.0 7 0.0 8 1.0 9 0.0 10 1.0 11 0.0 12 3.0 13 3.0 14 2.0 15 1.0 16 4.0 17 2.0 18 3.0 19 3.0 20 6.0 21 4.0 22 6.0 23 5.0 24 10.0 25 10.0 26 13.0 27 21.0 28 26.0 29 36.0 30 33.0 31 43.0 32 50.0 33 80.0 34 102.0 35 158.0 36 352.0 37 3006.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.325 24.925 10.475 30.275000000000002 2 26.965448172258387 28.01702553830746 30.721081622433648 14.296444667000502 3 20.010017530678688 28.249436513899322 32.231404958677686 19.509140996744303 4 22.54509018036072 34.168336673346694 24.473947895791586 18.812625250501004 5 24.849699398797593 36.69839679358717 21.7685370741483 16.683366733466933 6 22.358537806710068 38.98347521281923 21.707561342013022 16.950425638457688 7 21.30696044066099 22.408612919379067 37.68152228342514 18.602904356534804 8 22.283425137706562 25.913870806209317 27.74161241862794 24.061091637456183 9 22.202753441802255 25.18147684605757 29.586983729662077 23.028785982478098 10-14 23.595674376689697 29.598478021427855 25.92870731951537 20.877140282367076 15-19 23.315309902873736 28.296785821568037 27.535796535496143 20.85210774006208 20-24 23.39072980278306 28.82670938031835 27.29001902092302 20.492541795975573 25-29 23.639549436795996 28.530663329161456 27.0738423028786 20.755944931163956 30-34 23.513215859030836 28.839607529034843 26.9873848618342 20.65979175010012 35-39 23.494367959949937 28.360450563204004 27.53441802252816 20.610763454317897 40-44 24.132578981625194 27.997797025985076 27.66735092374706 20.20227306864267 45-49 23.75112623886275 28.666533186505156 27.440184202622888 20.14215637200921 50-54 23.94274560832791 28.411991391822234 27.456083279115163 20.1891797207347 55-59 23.550905996596256 28.61647812593853 27.370107117829612 20.4625087596356 60-64 24.250012520659087 27.350127710722695 27.800871437872487 20.59898833074573 65-69 23.903464850791106 27.658722211095533 27.859002603645106 20.578810334468255 70-74 23.90945059347924 28.892672910301997 27.079681474432814 20.118195021785947 75-79 24.268976567194073 28.009212898057278 27.1179651512117 20.60384538353695 80-84 24.245155475439386 28.15081868709629 27.184417405237593 20.41960843222673 85-89 23.5856613597677 28.597176329227995 26.965054570942225 20.85210774006208 90-94 24.496946641305435 28.261087195915508 26.904595054560016 20.337371108219042 95-99 24.41941941941942 28.37837837837838 27.01201201201201 20.19019019019019 100-104 24.894894894894897 27.952952952952952 27.427427427427425 19.724724724724723 105-109 24.391709221988584 28.637228396915994 27.050165214779216 19.920897166316212 110-114 24.440550688360453 28.565707133917396 27.579474342928663 19.414267834793492 115-119 24.69203805708563 27.906860290435652 27.40610916374562 19.9949924887331 120-124 25.21151439299124 27.964956195244056 27.664580725907385 19.15894868585732 125-129 25.608412618928394 28.147220831246873 27.145718577866802 19.098647971957938 130-134 25.484500976513598 28.569282387700934 26.60123190945966 19.344984726325805 135-139 25.490686961746444 28.80532745844182 26.977768876427 18.726216703384736 140-144 25.845845845845844 28.53853853853854 26.366366366366368 19.24924924924925 145-149 25.809519043090933 28.527100745708424 27.005655372603975 18.657724838596668 150-151 26.760035013129922 27.91046642490934 26.5474552957359 18.782043266224836 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.0 23 2.5 24 2.5 25 4.0 26 5.5 27 3.0 28 4.5 29 8.5 30 10.5 31 10.5 32 21.5 33 30.0 34 39.0 35 53.0 36 68.5 37 95.5 38 138.5 39 165.5 40 206.5 41 258.0 42 248.0 43 270.5 44 291.5 45 289.0 46 285.0 47 254.0 48 242.5 49 209.0 50 160.5 51 134.0 52 107.5 53 83.0 54 64.0 55 53.5 56 45.0 57 32.0 58 27.5 59 20.0 60 12.5 61 8.0 62 5.5 63 6.5 64 4.0 65 2.0 66 2.0 67 1.5 68 0.5 69 0.5 70 0.5 71 1.0 72 1.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.17500000000000002 4 0.2 5 0.2 6 0.15 7 0.15 8 0.15 9 0.125 10-14 0.13 15-19 0.13 20-24 0.11 25-29 0.125 30-34 0.12 35-39 0.125 40-44 0.135 45-49 0.11 50-54 0.095 55-59 0.11 60-64 0.165 65-69 0.13999999999999999 70-74 0.165 75-79 0.13999999999999999 80-84 0.145 85-89 0.13 90-94 0.11 95-99 0.1 100-104 0.1 105-109 0.13 110-114 0.125 115-119 0.15 120-124 0.125 125-129 0.15 130-134 0.155 135-139 0.13999999999999999 140-144 0.1 145-149 0.095 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69864389753893 99.25 2 0.25113008538422904 0.5 3 0.025113008538422906 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025113008538422906 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCAACA 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.5 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7125 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.7375 0.0 0.0 0.0 0.0 104-105 2.0625 0.0 0.0 0.0 0.0 106-107 2.3 0.0 0.0 0.0 0.0 108-109 2.5625 0.0 0.0 0.0 0.0 110-111 3.0250000000000004 0.0 0.0 0.0 0.0 112-113 3.5 0.0 0.0 0.0 0.0 114-115 3.9625000000000004 0.0 0.0 0.0 0.0 116-117 4.3875 0.0 0.0 0.0 0.0 118-119 4.824999999999999 0.0 0.0 0.0 0.0 120-121 5.275 0.0 0.0 0.0 0.0 122-123 5.8 0.0 0.0 0.0 0.0 124-125 6.15 0.0 0.0 0.0 0.0 126-127 6.4625 0.0 0.0 0.0 0.0 128-129 7.137499999999999 0.0 0.0 0.0 0.0 130-131 7.7875 0.0 0.0 0.0 0.0 132-133 8.4 0.0 0.0 0.0 0.0 134-135 9.175 0.0 0.0 0.0 0.0 136-137 9.8875 0.0 0.0 0.0 0.0 138-139 10.475000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGAAGG 10 0.006830828 145.0 1 >>END_MODULE Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707392 spots for SRR6053280.sra Written 2707392 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra Read 2707379 spots for SRR6053280.sra Written 2707379 spots for SRR6053280.sra SRR ids: ['SRR6053280.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k9nkdvx7 SRR6053280.sra spots: 54147593 blocks: [[1, 2707379], [2707380, 5414758], [5414759, 8122137], [8122138, 10829516], [10829517, 13536895], [13536896, 16244274], [16244275, 18951653], [18951654, 21659032], [21659033, 24366411], [24366412, 27073790], [27073791, 29781169], [29781170, 32488548], [32488549, 35195927], [35195928, 37903306], [37903307, 40610685], [40610686, 43318064], [43318065, 46025443], [46025444, 48732822], [48732823, 51440201], [51440202, 54147593]] SRR6053280 file size 18327142 SRR6053280 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053280 SRR6053280_1.fastq SRR6053280_2.fastq Input file: SRR6053280_1.fastq Paired file: SRR6053280_2.fastq trimmed: SRR6053280-trimmed-pair1.fastq, SRR6053280-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 17:04:37 2025 >> started Tue Feb 11 17:05:35 2025 >> done (57.277s) 54147593 read pairs processed; of these: 48011 ( 0.09%) short read pairs filtered out after trimming by size control 63753 ( 0.12%) empty read pairs filtered out after trimming by size control 54035829 (99.79%) read pairs available; of these: 19423610 (35.95%) trimmed read pairs available after processing 34612219 (64.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 23 0.00% 19 27 0.00% 20 36 0.00% 21 30 0.00% 22 17 0.00% 23 35 0.00% 24 24 0.00% 25 18 0.00% 26 22 0.00% 27 22 0.00% 28 25 0.00% 29 25 0.00% 30 31 0.00% 31 32 0.00% 32 42 0.00% 33 40 0.00% 34 44 0.00% 35 44 0.00% 36 35 0.00% 37 60 0.00% 38 85 0.00% 39 81 0.00% 40 94 0.00% 41 109 0.00% 42 138 0.00% 43 171 0.00% 44 171 0.00% 45 185 0.00% 46 230 0.00% 47 257 0.00% 48 314 0.00% 49 387 0.00% 50 381 0.00% 51 515 0.00% 52 470 0.00% 53 639 0.00% 54 714 0.00% 55 695 0.00% 56 710 0.00% 57 892 0.00% 58 998 0.00% 59 1157 0.00% 60 1330 0.00% 61 1453 0.00% 62 1755 0.00% 63 1966 0.00% 64 2139 0.00% 65 2498 0.00% 66 2601 0.00% 67 2946 0.01% 68 3245 0.01% 69 3681 0.01% 70 5572 0.01% 71 5749 0.01% 72 5595 0.01% 73 6339 0.01% 74 6904 0.01% 75 7691 0.01% 76 8405 0.02% 77 8983 0.02% 78 9938 0.02% 79 11189 0.02% 80 12316 0.02% 81 13753 0.03% 82 15598 0.03% 83 17531 0.03% 84 20790 0.04% 85 23300 0.04% 86 24927 0.05% 87 27021 0.05% 88 28822 0.05% 89 31256 0.06% 90 33029 0.06% 91 36375 0.07% 92 39351 0.07% 93 43534 0.08% 94 47490 0.09% 95 51761 0.10% 96 54694 0.10% 97 58611 0.11% 98 61205 0.11% 99 63910 0.12% 100 67956 0.13% 101 72507 0.13% 102 77378 0.14% 103 82797 0.15% 104 89109 0.16% 105 93331 0.17% 106 99873 0.18% 107 103005 0.19% 108 106879 0.20% 109 110645 0.20% 110 113524 0.21% 111 117724 0.22% 112 123966 0.23% 113 129020 0.24% 114 135387 0.25% 115 143473 0.27% 116 149024 0.28% 117 153463 0.28% 118 158342 0.29% 119 161506 0.30% 120 165418 0.31% 121 170074 0.31% 122 173260 0.32% 123 180278 0.33% 124 187358 0.35% 125 193746 0.36% 126 200292 0.37% 127 203829 0.38% 128 208363 0.39% 129 211565 0.39% 130 214923 0.40% 131 218332 0.40% 132 226006 0.42% 133 230370 0.43% 134 234805 0.43% 135 243379 0.45% 136 252137 0.47% 137 262559 0.49% 138 267952 0.50% 139 273018 0.51% 140 283675 0.52% 141 297648 0.55% 142 325393 0.60% 143 330159 0.61% 144 364076 0.67% 145 404148 0.75% 146 504573 0.93% 147 658342 1.22% 148 668837 1.24% 149 1166408 2.16% 150 6998500 12.95% 151 34612219 64.05% 54035829 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=8.96 fanout-score-rank=10 prefix-density=0.47 prefix-fanout=5.2 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTG criterion=fanout-score sequence-density=0.11 sequence-density-rank=8 fanout-score=48.94 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=11.3 sequence=TCCTCATCAAGTTTCTCCGACAG criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=32 prefix-density=0.37 prefix-fanout=2.0 sequence=CACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=88.14 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.9 sequence=TCCTGCTCTCGCAATCGCTGCTTCTTTGTCTGTCTTTGGGTCGATCCGAAAGAGAGGAGCTCTTCTGCGCAATCATGTTGGTCTATCAAGATCTTCTCTCTGGTGATGAGCTTCTCTCGGATTCGTTCCCATACAAGGAGATTGAGAATGGGATACTGTGGGAAGTTGAAGGAAAGTGGGTTGTTCAAGGAGCCGTTGATGTAGACAT SRR6053280 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 17:06:54 Started mapping on | Feb 11 17:06:54 Finished on | Feb 11 17:13:30 Mapping speed, Million of reads per hour | 491.23 Number of input reads | 54035829 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 50087361 Uniquely mapped reads % | 92.69% Average mapped length | 290.29 Number of splices: Total | 44948764 Number of splices: Annotated (sjdb) | 43751648 Number of splices: GT/AG | 44051624 Number of splices: GC/AG | 622897 Number of splices: AT/AC | 45111 Number of splices: Non-canonical | 229132 Mismatch rate per base, % | 0.84% Deletion rate per base | 0.07% Deletion average length | 2.98 Insertion rate per base | 0.05% Insertion average length | 2.68 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1828415 % of reads mapped to multiple loci | 3.38% Number of reads mapped to too many loci | 700951 % of reads mapped to too many loci | 1.30% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.36% % of reads unmapped: other | 0.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2148115 2148115 2148115 N_multimapping 1828415 1828415 1828415 N_noFeature 1573647 49294472 1998860 N_ambiguous 763886 4494 394045 UnstrandedReadsAssigned:47749828 PositiveStrandReadsAssigned:788395 NegativeStrandReadsAssigned:47694456 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6053280 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053280-trimmed-pair1.fastq SRR6053280-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 54,035,829 reads, 47,256,858 reads pseudoaligned [quant] estimated average fragment length: 223.879 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR6053280.ke.tsv 34699 SRR6053280.se.tsv 87100 total ==> SRR6053280.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.12 3202 30.7836 Potri.005G024800.1.v4.1 1035 812.121 2301 48.8976 Potri.004G059700.1.v4.1 961 738.121 49 1.14567 Potri.007G009000.2.v4.1 1416 1193.12 0 0 Potri.003G141000.2.v4.1 2943 2720.12 1689 10.716 Potri.016G087400.1.v4.1 270 89.7487 5061.99 973.386 Potri.015G069301.1.v4.1 564 342.755 0 0 Potri.010G195200.1.v4.1 1773 1550.12 615.857 6.85655 Potri.012G127500.1.v4.1 977 754.121 11472 262.536 ==> SRR6053280.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1965 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1352 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 43 SRR6053280 completed mapping pipeline successfully