Starting /dee2/code/volunteer_pipeline.sh SRR6053281 current disk space = 3049409789952 free memory = 1415730952 SRR6053281 SRAfilesize 2ed86531b182c7e81648b48732a6628c SRR6053281.sra SRR6053281.sra file validated SRR6053281 is paired end SRR6053281 is conventional basespace SRR6053281 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053281_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2545 34.0 33.0 34.0 32.0 34.0 2 32.996 34.0 33.0 34.0 30.0 34.0 3 33.2025 34.0 33.0 34.0 32.0 34.0 4 33.381 34.0 33.0 34.0 33.0 34.0 5 33.416 34.0 33.0 34.0 33.0 34.0 6 37.03625 38.0 37.0 38.0 36.0 38.0 7 37.3295 38.0 38.0 38.0 37.0 38.0 8 37.39825 38.0 38.0 38.0 37.0 38.0 9 37.46 38.0 38.0 38.0 37.0 38.0 10-14 37.515 38.0 38.0 38.0 37.4 38.0 15-19 37.493399999999994 38.0 38.0 38.0 37.8 38.0 20-24 37.443000000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.426300000000005 38.0 38.0 38.0 37.2 38.0 30-34 37.408100000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.31529999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.26845 38.0 38.0 38.0 37.0 38.0 45-49 37.289950000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.2384 38.0 38.0 38.0 36.8 38.0 55-59 37.14 38.0 38.0 38.0 36.2 38.0 60-64 37.16715 38.0 38.0 38.0 36.4 38.0 65-69 37.1833 38.0 38.0 38.0 36.4 38.0 70-74 37.11125 38.0 38.0 38.0 36.0 38.0 75-79 37.0758 38.0 38.0 38.0 36.0 38.0 80-84 37.01285 38.0 38.0 38.0 36.0 38.0 85-89 36.9812 38.0 38.0 38.0 36.0 38.0 90-94 36.8412 38.0 38.0 38.0 35.4 38.0 95-99 36.796549999999996 38.0 38.0 38.0 35.0 38.0 100-104 36.738 38.0 38.0 38.0 34.8 38.0 105-109 36.67315 38.0 38.0 38.0 34.8 38.0 110-114 36.554649999999995 38.0 38.0 38.0 34.2 38.0 115-119 36.38164999999999 38.0 38.0 38.0 34.0 38.0 120-124 36.299 38.0 38.0 38.0 33.8 38.0 125-129 36.1954 38.0 38.0 38.0 33.6 38.0 130-134 36.0052 38.0 37.8 38.0 33.2 38.0 135-139 35.85540000000001 38.0 37.6 38.0 33.2 38.0 140-144 35.48625 38.0 36.6 38.0 32.2 38.0 145-149 35.13445 38.0 36.0 38.0 31.0 38.0 150-151 32.765125 37.0 33.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 2.0 13 1.0 14 1.0 15 1.0 16 1.0 17 2.0 18 2.0 19 4.0 20 2.0 21 2.0 22 1.0 23 6.0 24 8.0 25 8.0 26 15.0 27 14.0 28 20.0 29 27.0 30 38.0 31 47.0 32 66.0 33 87.0 34 99.0 35 173.0 36 474.0 37 2897.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.73558594797533 13.167068919281308 7.910968087959239 45.18637704478412 2 21.05 14.224999999999998 37.6 27.125 3 17.875 15.35 27.525 39.25 4 22.275 22.275 23.95 31.5 5 22.975 30.025000000000002 24.0 23.0 6 21.5 32.550000000000004 24.325 21.625 7 15.174999999999999 27.6 40.45 16.775000000000002 8 17.599999999999998 26.375 33.175 22.85 9 16.400000000000002 25.074999999999996 35.025 23.5 10-14 20.09 29.42 27.939999999999998 22.55 15-19 19.869999999999997 28.345 28.27 23.515 20-24 20.175 27.66 28.144999999999996 24.02 25-29 20.24 28.185 28.02 23.555 30-34 20.115 28.65 27.325 23.91 35-39 19.915 28.32 27.794999999999998 23.97 40-44 19.935 28.7 27.650000000000002 23.715 45-49 20.544999999999998 27.665 27.665 24.125 50-54 20.155 27.639999999999997 27.889999999999997 24.315 55-59 20.535 27.839999999999996 27.985 23.64 60-64 20.355 28.4 27.575 23.669999999999998 65-69 20.39 27.405 28.08 24.125 70-74 19.96 28.365000000000002 28.189999999999998 23.485 75-79 20.39 27.54 27.62 24.45 80-84 20.369999999999997 27.68 28.1 23.849999999999998 85-89 20.18 27.725 27.925 24.169999999999998 90-94 20.59 27.589999999999996 28.32 23.5 95-99 20.41 27.644999999999996 27.955000000000002 23.990000000000002 100-104 20.669999999999998 27.634999999999998 28.34 23.355 105-109 21.325 27.26 27.944999999999997 23.47 110-114 21.0 27.51 28.075 23.415 115-119 20.94 27.650000000000002 27.939999999999998 23.47 120-124 21.349999999999998 28.384999999999998 27.089999999999996 23.175 125-129 21.01 28.26 26.900000000000002 23.830000000000002 130-134 21.525 28.29 26.265 23.919999999999998 135-139 20.919999999999998 28.299999999999997 26.5 24.279999999999998 140-144 21.41 27.985 26.834999999999997 23.77 145-149 21.665 28.04 25.619999999999997 24.675 150-151 21.510755377688845 27.226113056528263 25.887943971985994 25.3751875937969 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 1.5 21 1.0 22 0.5 23 3.0 24 4.5 25 5.5 26 5.5 27 4.0 28 6.5 29 14.0 30 18.0 31 20.5 32 31.5 33 43.5 34 45.5 35 57.0 36 81.5 37 106.0 38 128.5 39 161.0 40 183.0 41 210.5 42 248.5 43 274.0 44 268.5 45 257.0 46 262.0 47 247.0 48 217.5 49 197.0 50 168.5 51 147.5 52 133.0 53 105.0 54 75.0 55 50.5 56 50.5 57 38.5 58 25.0 59 24.5 60 19.5 61 12.5 62 8.5 63 5.5 64 6.0 65 6.0 66 5.5 67 4.0 68 2.0 69 1.0 70 0.5 71 0.5 72 1.0 73 1.5 74 0.5 75 0.0 76 0.5 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.775 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.45 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.3125 0.0 0.0 0.0 0.0 110-111 2.7874999999999996 0.0 0.0 0.0 0.0 112-113 3.0875 0.0 0.0 0.0 0.0 114-115 3.7249999999999996 0.0 0.0 0.0 0.0 116-117 4.475 0.0 0.0 0.0 0.0 118-119 4.9875 0.0 0.0 0.0 0.0 120-121 5.6 0.0 0.0 0.0 0.0 122-123 6.4 0.0 0.0 0.0 0.0 124-125 7.0 0.0 0.0 0.0 0.0 126-127 7.5375 0.0 0.0 0.0 0.0 128-129 8.025 0.0 0.0 0.0 0.0 130-131 8.6375 0.0 0.0 0.0 0.0 132-133 9.399999999999999 0.0 0.0 0.0 0.0 134-135 10.125 0.0 0.0 0.0 0.0 136-137 10.775 0.0 0.0 0.0 0.0 138-139 11.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6053281 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053281_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.771 33.0 33.0 34.0 32.0 34.0 2 32.88625 33.0 33.0 34.0 32.0 34.0 3 32.903 34.0 33.0 34.0 32.0 34.0 4 32.827 34.0 33.0 34.0 32.0 34.0 5 32.79 34.0 33.0 34.0 32.0 34.0 6 37.14225 38.0 38.0 38.0 37.0 38.0 7 37.06225 38.0 38.0 38.0 36.0 38.0 8 37.058 38.0 38.0 38.0 37.0 38.0 9 36.97425 38.0 38.0 38.0 36.0 38.0 10-14 37.129200000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.1009 38.0 38.0 38.0 37.0 38.0 20-24 37.092749999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.10315 38.0 38.0 38.0 36.8 38.0 30-34 37.0438 38.0 38.0 38.0 37.0 38.0 35-39 37.0253 38.0 38.0 38.0 36.4 38.0 40-44 37.023849999999996 38.0 38.0 38.0 36.8 38.0 45-49 36.940749999999994 38.0 38.0 38.0 36.4 38.0 50-54 36.905550000000005 38.0 38.0 38.0 36.4 38.0 55-59 36.891000000000005 38.0 38.0 38.0 36.2 38.0 60-64 36.7941 38.0 38.0 38.0 36.0 38.0 65-69 36.8325 38.0 38.0 38.0 36.0 38.0 70-74 36.79655 38.0 38.0 38.0 36.0 38.0 75-79 36.80035 38.0 38.0 38.0 36.0 38.0 80-84 36.72605 38.0 38.0 38.0 35.8 38.0 85-89 36.66655 38.0 38.0 38.0 35.8 38.0 90-94 36.657799999999995 38.0 38.0 38.0 35.6 38.0 95-99 36.50985 38.0 38.0 38.0 34.6 38.0 100-104 36.46745 38.0 38.0 38.0 34.8 38.0 105-109 36.38855 38.0 38.0 38.0 34.4 38.0 110-114 36.2658 38.0 38.0 38.0 34.0 38.0 115-119 36.13315 38.0 38.0 38.0 34.0 38.0 120-124 36.030649999999994 38.0 38.0 38.0 33.8 38.0 125-129 35.81895000000001 38.0 38.0 38.0 33.0 38.0 130-134 35.6931 38.0 38.0 38.0 32.8 38.0 135-139 35.528650000000006 38.0 37.8 38.0 32.6 38.0 140-144 35.20975 38.0 36.2 38.0 31.0 38.0 145-149 34.6685 38.0 36.0 38.0 28.2 38.0 150-151 31.63525 37.0 32.0 38.0 14.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 2.0 4 3.0 5 2.0 6 1.0 7 3.0 8 4.0 9 0.0 10 1.0 11 3.0 12 2.0 13 5.0 14 1.0 15 0.0 16 4.0 17 0.0 18 5.0 19 4.0 20 4.0 21 2.0 22 7.0 23 7.0 24 13.0 25 13.0 26 18.0 27 19.0 28 24.0 29 36.0 30 29.0 31 47.0 32 62.0 33 72.0 34 101.0 35 194.0 36 420.0 37 2882.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.0 21.349999999999998 12.6 34.050000000000004 2 26.7017017017017 26.25125125125125 32.30730730730731 14.73973973973974 3 20.045045045045047 27.97797797797798 30.78078078078078 21.196196196196198 4 21.30162703379224 33.942428035043804 24.780976220275345 19.97496871088861 5 24.505632040050063 36.470588235294116 21.877346683354194 17.146433041301627 6 20.77077077077077 39.61461461461461 21.646646646646648 17.96796796796797 7 20.945945945945947 22.42242242242242 37.56256256256256 19.06906906906907 8 20.695695695695697 24.824824824824827 29.87987987987988 24.5995995995996 9 21.696696696696698 25.125125125125123 30.33033033033033 22.84784784784785 10-14 23.103103103103102 29.644644644644647 25.985985985985987 21.266266266266264 15-19 22.427427427427425 28.47847847847848 27.467467467467465 21.626626626626628 20-24 23.55855855855856 28.063063063063066 27.66266266266266 20.715715715715717 25-29 23.35835835835836 28.133133133133132 27.16216216216216 21.346346346346344 30-34 22.942942942942942 28.473473473473476 27.43743743743744 21.146146146146148 35-39 23.18818818818819 28.213213213213212 27.38238238238238 21.216216216216218 40-44 23.00800800800801 27.962962962962962 27.49249249249249 21.536536536536534 45-49 23.303303303303302 27.78778778778779 27.952952952952952 20.955955955955957 50-54 23.33833833833834 28.303303303303302 27.41241241241241 20.945945945945947 55-59 23.408408408408405 27.46246246246246 27.68768768768769 21.44144144144144 60-64 23.453453453453456 28.10810810810811 27.257257257257255 21.18118118118118 65-69 23.95895895895896 28.513513513513512 26.651651651651655 20.875875875875877 70-74 23.7649532008609 28.419840832874517 27.06341658741679 20.75178937884779 75-79 23.32832832832833 27.56756756756757 27.46246246246246 21.641641641641645 80-84 23.84884884884885 27.60760760760761 27.6976976976977 20.845845845845844 85-89 23.97897897897898 27.85785785785786 27.017017017017015 21.146146146146148 90-94 24.02902902902903 28.098098098098095 27.31731731731732 20.555555555555554 95-99 23.72872872872873 28.15815815815816 27.46246246246246 20.65065065065065 100-104 23.626263637273546 28.295465919327395 27.554799319387445 20.52347112401161 105-109 24.13913913913914 28.1981981981982 27.45745745745746 20.205205205205203 110-114 24.10910910910911 28.303303303303302 27.04204204204204 20.545545545545547 115-119 24.634634634634633 28.173173173173172 26.836836836836834 20.355355355355357 120-124 24.73973973973974 28.493493493493492 26.346346346346344 20.42042042042042 125-129 25.110110110110114 28.338338338338335 26.616616616616618 19.934934934934933 130-134 25.765765765765764 28.433433433433436 26.296296296296294 19.504504504504506 135-139 25.53053053053053 28.218218218218215 26.256256256256254 19.994994994994993 140-144 25.95836252627365 28.49064157741968 26.03343008707837 19.517565809228305 145-149 25.654371653070417 27.71633051398829 26.995645863570395 19.633651969370902 150-151 26.21310655327664 27.75137568784392 26.725862931465734 19.30965482741371 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 2.0 23 1.5 24 2.5 25 2.5 26 1.5 27 3.0 28 5.5 29 10.0 30 17.0 31 22.0 32 21.5 33 26.0 34 42.0 35 56.0 36 75.5 37 112.0 38 141.0 39 158.0 40 187.0 41 224.5 42 254.0 43 276.5 44 284.5 45 278.0 46 277.5 47 244.5 48 209.5 49 197.5 50 170.0 51 143.0 52 113.0 53 90.0 54 76.5 55 55.0 56 39.5 57 37.5 58 29.0 59 19.5 60 13.5 61 14.0 62 16.0 63 11.0 64 7.0 65 4.5 66 3.5 67 4.5 68 4.0 69 2.0 70 2.0 71 1.0 72 1.0 73 1.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.1 4 0.125 5 0.125 6 0.1 7 0.1 8 0.1 9 0.1 10-14 0.1 15-19 0.1 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.105 75-79 0.1 80-84 0.1 85-89 0.1 90-94 0.1 95-99 0.1 100-104 0.09 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.1 130-134 0.1 135-139 0.1 140-144 0.09 145-149 0.095 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64832956543582 99.175 2 0.25119316754584275 0.5 3 0.07535795026375283 0.22499999999999998 4 0.025119316754584273 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7625 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.15 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.475 0.0 0.0 0.0 0.0 106-107 1.8624999999999998 0.0 0.0 0.0 0.0 108-109 2.325 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.0999999999999996 0.0 0.0 0.0 0.0 114-115 3.7375 0.0 0.0 0.0 0.0 116-117 4.5 0.0 0.0 0.0 0.0 118-119 5.0125 0.0 0.0 0.0 0.0 120-121 5.612500000000001 0.0 0.0 0.0 0.0 122-123 6.387499999999999 0.0 0.0 0.0 0.0 124-125 6.975 0.0 0.0 0.0 0.0 126-127 7.512499999999999 0.0 0.0 0.0 0.0 128-129 8.0125 0.0 0.0 0.0 0.0 130-131 8.6875 0.0 0.0 0.0 0.0 132-133 9.4625 0.0 0.0 0.0 0.0 134-135 10.2 0.0 0.0 0.0 0.0 136-137 10.8875 0.0 0.0 0.0 0.0 138-139 11.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCAAA 10 0.006830828 145.0 1 >>END_MODULE Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630019 spots for SRR6053281.sra Written 2630019 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra Read 2630012 spots for SRR6053281.sra Written 2630012 spots for SRR6053281.sra SRR ids: ['SRR6053281.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n9hgjax7 SRR6053281.sra spots: 52600247 blocks: [[1, 2630012], [2630013, 5260024], [5260025, 7890036], [7890037, 10520048], [10520049, 13150060], [13150061, 15780072], [15780073, 18410084], [18410085, 21040096], [21040097, 23670108], [23670109, 26300120], [26300121, 28930132], [28930133, 31560144], [31560145, 34190156], [34190157, 36820168], [36820169, 39450180], [39450181, 42080192], [42080193, 44710204], [44710205, 47340216], [47340217, 49970228], [49970229, 52600247]] SRR6053281 file size 17802797 SRR6053281 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053281 SRR6053281_1.fastq SRR6053281_2.fastq Input file: SRR6053281_1.fastq Paired file: SRR6053281_2.fastq trimmed: SRR6053281-trimmed-pair1.fastq, SRR6053281-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 15:48:20 2025 >> started Tue Feb 11 15:49:51 2025 >> done (90.732s) 52600247 read pairs processed; of these: 59885 ( 0.11%) short read pairs filtered out after trimming by size control 61874 ( 0.12%) empty read pairs filtered out after trimming by size control 52478488 (99.77%) read pairs available; of these: 19425034 (37.02%) trimmed read pairs available after processing 33053454 (62.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 25 0.00% 19 30 0.00% 20 25 0.00% 21 32 0.00% 22 23 0.00% 23 33 0.00% 24 19 0.00% 25 21 0.00% 26 18 0.00% 27 24 0.00% 28 25 0.00% 29 18 0.00% 30 28 0.00% 31 22 0.00% 32 29 0.00% 33 33 0.00% 34 35 0.00% 35 28 0.00% 36 35 0.00% 37 51 0.00% 38 52 0.00% 39 51 0.00% 40 70 0.00% 41 74 0.00% 42 74 0.00% 43 95 0.00% 44 103 0.00% 45 129 0.00% 46 172 0.00% 47 205 0.00% 48 232 0.00% 49 264 0.00% 50 263 0.00% 51 345 0.00% 52 368 0.00% 53 445 0.00% 54 478 0.00% 55 512 0.00% 56 561 0.00% 57 646 0.00% 58 785 0.00% 59 888 0.00% 60 973 0.00% 61 1148 0.00% 62 1292 0.00% 63 1446 0.00% 64 1618 0.00% 65 1846 0.00% 66 2172 0.00% 67 2430 0.00% 68 3167 0.01% 69 4759 0.01% 70 10959 0.02% 71 6663 0.01% 72 4612 0.01% 73 5070 0.01% 74 5773 0.01% 75 6422 0.01% 76 7193 0.01% 77 7805 0.01% 78 8658 0.02% 79 9571 0.02% 80 10445 0.02% 81 11858 0.02% 82 13553 0.03% 83 15373 0.03% 84 18651 0.04% 85 21867 0.04% 86 23568 0.04% 87 25680 0.05% 88 27769 0.05% 89 29824 0.06% 90 31957 0.06% 91 34673 0.07% 92 38317 0.07% 93 42114 0.08% 94 46290 0.09% 95 50559 0.10% 96 54357 0.10% 97 58968 0.11% 98 62481 0.12% 99 65652 0.13% 100 69717 0.13% 101 74072 0.14% 102 78905 0.15% 103 84937 0.16% 104 91661 0.17% 105 97921 0.19% 106 104037 0.20% 107 109714 0.21% 108 113758 0.22% 109 119223 0.23% 110 122270 0.23% 111 127054 0.24% 112 133310 0.25% 113 137903 0.26% 114 145518 0.28% 115 153925 0.29% 116 161245 0.31% 117 167296 0.32% 118 174917 0.33% 119 178317 0.34% 120 182846 0.35% 121 187509 0.36% 122 190307 0.36% 123 195871 0.37% 124 203323 0.39% 125 208669 0.40% 126 216537 0.41% 127 224590 0.43% 128 230355 0.44% 129 233645 0.45% 130 238307 0.45% 131 241199 0.46% 132 246081 0.47% 133 248298 0.47% 134 254561 0.49% 135 262029 0.50% 136 269990 0.51% 137 280264 0.53% 138 287123 0.55% 139 293174 0.56% 140 304049 0.58% 141 315191 0.60% 142 338521 0.65% 143 341913 0.65% 144 372382 0.71% 145 410258 0.78% 146 496159 0.95% 147 616890 1.18% 148 675180 1.29% 149 1129655 2.15% 150 6499559 12.39% 151 33053454 62.98% 52478488 reads passed initial QC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=6.05 fanout-score-rank=17 prefix-density=0.52 prefix-fanout=2.2 sequence=TTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCAACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.11 sequence-density-rank=16 fanout-score=47.24 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=11.3 sequence=TCCTCATCAAGTTTCTCCGACAG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=32 prefix-density=0.47 prefix-fanout=2.1 sequence=GGCAGTGGCTGCAAATGTGGCATGTACCCTGACTTAGGTTTCTCAGAGA criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=41.24 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.4 sequence=AAAACAAAAAAGAAATGGATGCCAAAGCTCTCTTCTTCTTTGCCTTGTTGTCCTTCTCAGCTGTGTCGGTCAGGCCGGCATTAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTG SRR6053281 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 15:50:56 Started mapping on | Feb 11 15:50:57 Finished on | Feb 11 16:09:03 Mapping speed, Million of reads per hour | 173.96 Number of input reads | 52478488 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 46229280 Uniquely mapped reads % | 88.09% Average mapped length | 289.88 Number of splices: Total | 40415541 Number of splices: Annotated (sjdb) | 39278633 Number of splices: GT/AG | 39603034 Number of splices: GC/AG | 571834 Number of splices: AT/AC | 42024 Number of splices: Non-canonical | 198649 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.07% Deletion average length | 3.03 Insertion rate per base | 0.05% Insertion average length | 2.74 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1605808 % of reads mapped to multiple loci | 3.06% Number of reads mapped to too many loci | 227647 % of reads mapped to too many loci | 0.43% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.21% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4679458 4679458 4679458 N_multimapping 1605808 1605808 1605808 N_noFeature 1500217 45520205 1962654 N_ambiguous 554134 4323 305008 UnstrandedReadsAssigned:44174929 PositiveStrandReadsAssigned:704752 NegativeStrandReadsAssigned:43961618 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6053281 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053281-trimmed-pair1.fastq SRR6053281-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 52,478,488 reads, 43,262,804 reads pseudoaligned [quant] estimated average fragment length: 223.394 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,294 rounds 52401 SRR6053281.ke.tsv 34699 SRR6053281.se.tsv 87100 total ==> SRR6053281.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1795.61 4273 53.5656 Potri.005G024800.1.v4.1 1035 812.606 1323 36.6475 Potri.004G059700.1.v4.1 961 738.611 65 1.9809 Potri.007G009000.2.v4.1 1416 1193.61 0 0 Potri.003G141000.2.v4.1 2943 2720.61 1785 14.7685 Potri.016G087400.1.v4.1 270 92.5184 2696 655.928 Potri.015G069301.1.v4.1 564 343.923 0 0 Potri.010G195200.1.v4.1 1773 1550.61 1059 15.373 Potri.012G127500.1.v4.1 977 754.611 45161 1347.12 ==> SRR6053281.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 152 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 915 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1402 SRR6053281 completed mapping pipeline successfully