Starting /dee2/code/volunteer_pipeline.sh SRR6053282 current disk space = 3048798666752 free memory = 1460784692 SRR6053282 SRAfilesize 243d83e023c8c69272a8379abcf21ad5 SRR6053282.sra SRR6053282.sra file validated SRR6053282 is paired end SRR6053282 is conventional basespace SRR6053282 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053282_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.5095 33.0 33.0 34.0 32.0 34.0 2 32.65025 33.0 33.0 34.0 31.0 34.0 3 32.9385 34.0 33.0 34.0 31.0 34.0 4 33.003 34.0 33.0 34.0 32.0 34.0 5 32.91875 34.0 33.0 34.0 32.0 34.0 6 36.848 38.0 37.0 38.0 35.0 38.0 7 37.216 38.0 38.0 38.0 36.0 38.0 8 37.40925 38.0 38.0 38.0 37.0 38.0 9 37.42125 38.0 38.0 38.0 37.0 38.0 10-14 37.312599999999996 38.0 38.0 38.0 36.8 38.0 15-19 37.34325 38.0 38.0 38.0 37.0 38.0 20-24 37.21825 38.0 38.0 38.0 36.6 38.0 25-29 37.2379 38.0 38.0 38.0 37.0 38.0 30-34 36.775999999999996 38.0 38.0 38.0 36.6 38.0 35-39 36.443 38.0 38.0 38.0 35.2 38.0 40-44 35.837149999999994 38.0 38.0 38.0 34.0 38.0 45-49 35.852149999999995 38.0 38.0 38.0 33.2 38.0 50-54 36.54465 38.0 38.0 38.0 34.0 38.0 55-59 36.54585 38.0 38.0 38.0 34.0 38.0 60-64 36.6645 38.0 38.0 38.0 34.6 38.0 65-69 36.46975 38.0 38.0 38.0 33.8 38.0 70-74 36.43580000000001 38.0 38.0 38.0 34.0 38.0 75-79 36.3424 38.0 37.8 38.0 33.8 38.0 80-84 35.86795000000001 38.0 37.2 38.0 32.0 38.0 85-89 35.6937 38.0 37.0 38.0 30.6 38.0 90-94 35.895 38.0 37.0 38.0 31.8 38.0 95-99 35.5503 38.0 36.8 38.0 29.4 38.0 100-104 35.37785 38.0 36.4 38.0 29.2 38.0 105-109 35.08495 38.0 36.0 38.0 27.8 38.0 110-114 35.3962 38.0 36.0 38.0 29.6 38.0 115-119 35.01425 38.0 35.4 38.0 28.2 38.0 120-124 34.5284 38.0 35.2 38.0 25.0 38.0 125-129 34.22745 38.0 34.4 38.0 24.2 38.0 130-134 33.877300000000005 38.0 34.0 38.0 22.2 38.0 135-139 33.49679999999999 38.0 34.0 38.0 20.2 38.0 140-144 32.8744 37.6 33.2 38.0 16.0 38.0 145-149 31.991699999999998 37.2 32.4 38.0 11.6 38.0 150-151 27.474249999999998 34.5 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 2.0 9 0.0 10 0.0 11 0.0 12 3.0 13 1.0 14 1.0 15 1.0 16 3.0 17 7.0 18 7.0 19 7.0 20 4.0 21 4.0 22 9.0 23 14.0 24 11.0 25 28.0 26 25.0 27 30.0 28 51.0 29 59.0 30 76.0 31 94.0 32 154.0 33 176.0 34 231.0 35 402.0 36 857.0 37 1741.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.50037584565272 13.254823352543221 10.147832623402655 43.096968178401404 2 21.025 17.724999999999998 35.575 25.674999999999997 3 19.075 22.225 25.1 33.6 4 23.425 30.65 21.475 24.45 5 21.675 34.300000000000004 23.400000000000002 20.625 6 16.325 37.3 25.624999999999996 20.75 7 13.750000000000002 25.025 43.125 18.099999999999998 8 16.650000000000002 24.725 30.9 27.725 9 16.7 25.275 33.425 24.6 10-14 18.825 31.705 27.445000000000004 22.025 15-19 18.86 29.304999999999996 28.485 23.35 20-24 18.715 29.470000000000002 28.68 23.135 25-29 18.98131917664146 30.480292482596283 27.179846747132768 23.35854159362949 30-34 18.96192364394286 29.378272584006915 27.965024655584365 23.694779116465863 35-39 19.138291898514474 29.55740466588391 27.607330644749606 23.69697279085201 40-44 19.363847944142744 29.78536333074735 27.46314972847168 23.38763899663822 45-49 20.112907364639465 29.10957146522966 27.564793430844237 23.21272773928663 50-54 19.775000000000002 28.985 27.775 23.465 55-59 20.150000000000002 28.749999999999996 27.405 23.695 60-64 19.002803364036843 28.9347216659992 27.93352022426912 24.128954745694834 65-69 19.51878345255365 28.923015356910607 27.692461607723473 23.865739582812264 70-74 19.51023685266961 28.833801686069847 27.920513849859496 23.735447611401046 75-79 19.232120451693852 28.1405269761606 28.582183186951067 24.04516938519448 80-84 20.069570477918937 28.483565234926395 27.87860455737044 23.56825972978423 85-89 19.829928549864146 28.54483244439972 27.48314380597766 24.14209519975848 90-94 19.89368637480568 28.34361366029788 27.96248934356351 23.800210621332933 95-99 20.410718757826196 28.239418983220638 27.70348109191084 23.646381167042325 100-104 20.405 28.694999999999997 27.485 23.415 105-109 20.845 28.51 27.145000000000003 23.5 110-114 21.15 28.715000000000003 26.495 23.64 115-119 20.77 28.470000000000002 27.139999999999997 23.62 120-124 21.04 28.37 26.75 23.84 125-129 21.279999999999998 28.265 26.119999999999997 24.335 130-134 21.377065598397596 28.45768652979469 26.14421632448673 24.02103154732098 135-139 21.995 28.565 25.36 24.08 140-144 21.255 28.24 25.72 24.785 145-149 21.935 27.515 25.575 24.975 150-151 21.0 28.212500000000002 25.55 25.2375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.0 17 0.5 18 1.0 19 1.5 20 1.5 21 3.5 22 4.0 23 4.0 24 6.5 25 11.0 26 16.0 27 26.0 28 28.0 29 25.0 30 31.5 31 45.0 32 56.0 33 62.5 34 85.0 35 109.0 36 113.0 37 121.5 38 136.0 39 144.5 40 169.0 41 193.5 42 216.0 43 235.5 44 257.5 45 269.0 46 253.5 47 234.0 48 203.5 49 180.0 50 161.0 51 131.0 52 112.5 53 94.0 54 66.5 55 47.5 56 39.5 57 34.0 58 20.0 59 8.5 60 6.5 61 6.0 62 5.5 63 5.0 64 2.0 65 1.0 66 1.0 67 2.5 68 3.0 69 1.5 70 1.0 71 1.5 72 1.5 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.165 30-34 1.645 35-39 2.0549999999999997 40-44 3.325 45-49 2.5749999999999997 50-54 0.0 55-59 0.0 60-64 0.12 65-69 0.045 70-74 0.36 75-79 0.375 80-84 0.8200000000000001 85-89 0.63 90-94 0.295 95-99 0.17500000000000002 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.15 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.27603513174404015 0.5499999999999999 3 0.05018820577164366 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.5125 0.0 0.0 0.0 0.0 88-89 0.725 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1875 0.0 0.0 0.0 0.0 94-95 1.55 0.0 0.0 0.0 0.0 96-97 1.975 0.0 0.0 0.0 0.0 98-99 2.425 0.0 0.0 0.0 0.0 100-101 3.0125 0.0 0.0 0.0 0.0 102-103 3.4124999999999996 0.0 0.0 0.0 0.0 104-105 3.8375 0.0 0.0 0.0 0.0 106-107 4.525 0.0 0.0 0.0 0.0 108-109 5.325 0.0 0.0 0.0 0.0 110-111 6.300000000000001 0.0 0.0 0.0 0.0 112-113 6.949999999999999 0.0 0.0 0.0 0.0 114-115 7.7875 0.0 0.0 0.0 0.0 116-117 8.462499999999999 0.0 0.0 0.0 0.0 118-119 9.662500000000001 0.0 0.0 0.0 0.0 120-121 10.8375 0.0 0.0 0.0 0.0 122-123 12.125 0.0 0.0 0.0 0.0 124-125 13.45 0.0 0.0 0.0 0.0 126-127 14.75 0.0 0.0 0.0 0.0 128-129 16.3 0.0 0.0 0.0 0.0 130-131 17.7875 0.0 0.0 0.0 0.0 132-133 19.275 0.0 0.0 0.0 0.0 134-135 20.9 0.0 0.0 0.0 0.0 136-137 22.725 0.0 0.0 0.0 0.0 138-139 24.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGACTTC 10 0.006916044 144.40001 5 AATTGGA 10 0.006916044 144.40001 4 ACACGTC 100 8.2267297E-4 11.552001 140-144 AGAGCAC 135 0.009912043 10.696297 145 >>END_MODULE SRR6053282 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053282_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.384 33.0 33.0 34.0 25.0 34.0 2 30.26575 33.0 33.0 34.0 18.0 34.0 3 30.2335 33.0 33.0 34.0 18.0 34.0 4 30.2585 33.0 33.0 34.0 15.0 34.0 5 30.23125 34.0 33.0 34.0 15.0 34.0 6 33.73975 38.0 38.0 38.0 14.0 38.0 7 33.80825 38.0 38.0 38.0 14.0 38.0 8 33.8615 38.0 38.0 38.0 16.0 38.0 9 34.017 38.0 38.0 38.0 16.0 38.0 10-14 33.8883 38.0 38.0 38.0 16.0 38.0 15-19 33.802499999999995 38.0 38.0 38.0 16.0 38.0 20-24 33.853699999999996 38.0 38.0 38.0 16.0 38.0 25-29 33.879200000000004 38.0 38.0 38.0 16.0 38.0 30-34 33.612899999999996 38.0 38.0 38.0 14.6 38.0 35-39 33.5832 38.0 38.0 38.0 9.2 38.0 40-44 33.37445 38.0 37.6 38.0 6.8 38.0 45-49 33.34245 38.0 37.6 38.0 2.0 38.0 50-54 32.9494 38.0 37.0 38.0 2.0 38.0 55-59 33.05145 38.0 37.0 38.0 2.0 38.0 60-64 32.86475 38.0 36.6 38.0 2.0 38.0 65-69 32.9571 38.0 36.6 38.0 2.0 38.0 70-74 33.06609999999999 38.0 37.0 38.0 2.0 38.0 75-79 32.6101 38.0 36.4 38.0 2.0 38.0 80-84 32.601150000000004 38.0 36.2 38.0 2.0 38.0 85-89 32.33245 38.0 36.0 38.0 2.0 38.0 90-94 32.06185000000001 38.0 35.2 38.0 2.0 38.0 95-99 31.956400000000002 38.0 34.6 38.0 2.0 38.0 100-104 31.456049999999998 38.0 34.0 38.0 2.0 38.0 105-109 31.198900000000002 38.0 33.6 38.0 2.0 38.0 110-114 30.983500000000003 38.0 32.4 38.0 2.0 38.0 115-119 31.08755 38.0 33.0 38.0 2.0 38.0 120-124 30.989600000000003 38.0 32.8 38.0 2.0 38.0 125-129 30.4295 38.0 30.2 38.0 2.0 38.0 130-134 29.51065 37.4 27.0 38.0 2.0 38.0 135-139 28.794999999999998 36.4 24.0 38.0 2.0 38.0 140-144 28.253949999999996 36.0 22.4 38.0 2.0 38.0 145-149 26.752750000000002 34.6 10.8 38.0 2.0 38.0 150-151 22.16225 28.5 2.0 36.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 339.0 3 2.0 4 9.0 5 9.0 6 13.0 7 2.0 8 22.0 9 8.0 10 2.0 11 2.0 12 3.0 13 4.0 14 4.0 15 11.0 16 8.0 17 16.0 18 24.0 19 4.0 20 15.0 21 9.0 22 15.0 23 11.0 24 25.0 25 20.0 26 31.0 27 38.0 28 44.0 29 46.0 30 77.0 31 97.0 32 122.0 33 152.0 34 196.0 35 318.0 36 662.0 37 1640.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.75581395348838 17.20401691331924 15.750528541226217 31.289640591966172 2 25.068418171866448 23.590585659551177 35.24904214559387 16.091954022988507 3 22.56030701754386 27.302631578947366 30.263157894736842 19.873903508771928 4 25.99672310212998 34.10704533042054 21.245221190606227 18.651010376843256 5 26.259583789704273 35.13143483023001 21.05695509309967 17.552026286966047 6 20.10508849557522 37.63827433628318 23.866150442477878 18.390486725663717 7 19.32540779651645 17.058335637268453 42.46613215371855 21.15012441249654 8 21.483305966064588 23.864258347016968 27.42200328407225 27.230432402846194 9 23.535791757049893 23.644251626898047 28.389370932754883 24.430585683297178 10-14 23.531336933398787 29.253259150166365 25.95319914907544 21.262204767359407 15-19 23.633291546301848 28.140840464381096 27.85196489889355 20.373903090423504 20-24 24.23081075245601 28.4519054302062 26.63284033250567 20.684443484832126 25-29 23.7354722540514 28.924537567523327 26.88928902711846 20.450701151306816 30-34 23.966805891404704 28.308419432842385 27.049901077159817 20.674873598593095 35-39 23.855992942992614 28.509207189326276 26.97100011026574 20.663799757415372 40-44 23.8792114891061 27.980123409599738 27.412220826735105 20.728444274559056 45-49 24.39373897707231 27.921075837742503 27.177028218694886 20.508156966490297 50-54 24.062482689857642 27.8347089126461 27.98980778817925 20.113000609317012 55-59 24.03173378877197 27.866233265384828 28.103134813508895 19.998898132334304 60-64 24.07499310725117 28.001102839812518 27.68127929418252 20.24262475875379 65-69 23.88670686507717 28.97604691043868 26.702439564086962 20.43480666039719 70-74 24.189099735216242 28.304280670785527 27.212047661076788 20.29457193292145 75-79 23.953501369250546 27.77063656178394 27.765047784049628 20.510814284915888 80-84 23.908697100966343 28.418305009441298 27.901810507608577 19.771187381983783 85-89 24.481166193735046 28.186724531241307 27.641462193289932 19.69064708173371 90-94 24.048723249706654 27.702966977705763 28.127619154048165 20.12069061853942 95-99 24.07015590200445 28.273942093541205 27.783964365256125 19.87193763919822 100-104 23.86887485060611 27.505548915827216 28.615332081270275 20.010244152296398 105-109 24.882843753571837 27.883186649902846 28.066064693107784 19.167904903417536 110-114 24.67605952583036 28.28042777117637 28.031460419849484 19.01205228314378 115-119 25.598835907768073 28.54824266845758 27.602417730020147 18.250503693754197 120-124 25.98377056469542 28.46265006669631 27.15651400622499 18.39706536238328 125-129 26.255061851666945 28.623731070061574 27.331225384146002 17.78998169412548 130-134 27.583676694700003 27.44821358017723 26.98538127222442 17.982728452898346 135-139 27.899159663865547 28.296918767507 26.845938375350144 16.95798319327731 140-144 28.764814918833903 28.197494804246475 26.00123574678425 17.03645453013537 145-149 28.91465522046937 28.490997268521102 25.999219577456937 16.595127933552593 150-151 30.19398369412426 27.424796176553272 26.482991284790554 15.898228844531909 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 233.0 1 143.5 2 36.0 3 12.0 4 5.5 5 4.0 6 3.0 7 3.5 8 2.5 9 3.5 10 5.5 11 3.5 12 1.0 13 2.5 14 3.5 15 1.0 16 1.0 17 3.5 18 3.0 19 3.0 20 4.5 21 4.0 22 2.5 23 4.0 24 6.5 25 8.0 26 7.0 27 6.0 28 9.0 29 11.0 30 16.0 31 20.5 32 26.0 33 36.0 34 46.5 35 60.0 36 72.5 37 84.0 38 106.0 39 133.5 40 165.0 41 189.0 42 214.0 43 240.5 44 241.0 45 245.0 46 257.5 47 262.0 48 240.0 49 192.0 50 163.0 51 133.0 52 100.0 53 79.5 54 58.5 55 45.5 56 39.5 57 33.5 58 20.5 59 11.0 60 8.5 61 8.0 62 9.0 63 7.5 64 4.0 65 1.5 66 0.5 67 0.5 68 2.0 69 2.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.4 2 8.649999999999999 3 8.799999999999999 4 8.450000000000001 5 8.7 6 9.6 7 9.575 8 8.649999999999999 9 7.8 10-14 8.334999999999999 15-19 8.265 20-24 7.37 25-29 8.365 30-34 9.02 35-39 9.31 40-44 8.434999999999999 45-49 9.28 50-54 9.735000000000001 55-59 9.245000000000001 60-64 9.325 65-69 9.615 70-74 9.36 75-79 10.535 80-84 9.969999999999999 85-89 10.135 90-94 10.514999999999999 95-99 10.2 100-104 12.145 105-109 12.509999999999998 110-114 11.635 115-119 10.66 120-124 10.040000000000001 125-129 9.865 130-134 11.415000000000001 135-139 10.75 140-144 10.985 145-149 10.305 150-151 11.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 93.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11290322580645 92.175 2 0.564516129032258 1.05 3 0.1881720430107527 0.525 4 0.0 0.0 5 0.0 0.0 6 0.026881720430107527 0.15 7 0.026881720430107527 0.17500000000000002 8 0.0 0.0 9 0.026881720430107527 0.22499999999999998 >10 0.026881720430107527 0.3 >50 0.0 0.0 >100 0.026881720430107527 5.4 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 216 5.4 No Hit GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 12 0.3 No Hit CNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 9 0.22499999999999998 No Hit ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 7 0.17500000000000002 No Hit CNNNNNNNNNNNNNNNNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNN 6 0.15 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.625 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.075 0.0 0.0 0.0 0.0 94-95 1.3875 0.0 0.0 0.0 0.0 96-97 1.8 0.0 0.0 0.0 0.0 98-99 2.1875 0.0 0.0 0.0 0.0 100-101 2.7375 0.0 0.0 0.0 0.0 102-103 3.0374999999999996 0.0 0.0 0.0 0.0 104-105 3.3375000000000004 0.0 0.0 0.0 0.0 106-107 3.9000000000000004 0.0 0.0 0.0 0.0 108-109 4.5875 0.0 0.0 0.0 0.0 110-111 5.375 0.0 0.0 0.0 0.0 112-113 6.0 0.0 0.0 0.0 0.0 114-115 6.775 0.0 0.0 0.0 0.0 116-117 7.35 0.0 0.0 0.0 0.0 118-119 8.5 0.0 0.0 0.0 0.0 120-121 9.55 0.0 0.0 0.0 0.0 122-123 10.65 0.0 0.0 0.0 0.0 124-125 11.725 0.0 0.0 0.0 0.0 126-127 12.9375 0.0 0.0 0.0 0.0 128-129 14.375 0.0 0.0 0.0 0.0 130-131 15.6625 0.0 0.0 0.0 0.0 132-133 17.0125 0.0 0.0 0.0 0.0 134-135 18.5 0.0 0.0 0.0 0.0 136-137 20.112499999999997 0.0 0.0 0.0 0.0 138-139 21.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 35 0.0034914354 20.744467 60-64 CGGAAGA 125 0.004642245 9.372726 140-144 >>END_MODULE Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167734 spots for SRR6053282.sra Written 3167734 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra Read 3167731 spots for SRR6053282.sra Written 3167731 spots for SRR6053282.sra SRR ids: ['SRR6053282.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0jwhvc4z SRR6053282.sra spots: 63354623 blocks: [[1, 3167731], [3167732, 6335462], [6335463, 9503193], [9503194, 12670924], [12670925, 15838655], [15838656, 19006386], [19006387, 22174117], [22174118, 25341848], [25341849, 28509579], [28509580, 31677310], [31677311, 34845041], [34845042, 38012772], [38012773, 41180503], [41180504, 44348234], [44348235, 47515965], [47515966, 50683696], [50683697, 53851427], [53851428, 57019158], [57019159, 60186889], [60186890, 63354623]] SRR6053282 file size 21447102 SRR6053282 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053282 SRR6053282_1.fastq SRR6053282_2.fastq Input file: SRR6053282_1.fastq Paired file: SRR6053282_2.fastq trimmed: SRR6053282-trimmed-pair1.fastq, SRR6053282-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:49:43 2025 >> started Tue Feb 11 16:51:00 2025 >> done (76.210s) 63354623 read pairs processed; of these: 93822 ( 0.15%) short read pairs filtered out after trimming by size control 336023 ( 0.53%) empty read pairs filtered out after trimming by size control 62924778 (99.32%) read pairs available; of these: 38271420 (60.82%) trimmed read pairs available after processing 24653358 (39.18%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 13 0.00% 19 22 0.00% 20 9 0.00% 21 13 0.00% 22 14 0.00% 23 16 0.00% 24 14 0.00% 25 22 0.00% 26 22 0.00% 27 20 0.00% 28 33 0.00% 29 25 0.00% 30 21 0.00% 31 27 0.00% 32 28 0.00% 33 39 0.00% 34 31 0.00% 35 32 0.00% 36 65 0.00% 37 52 0.00% 38 56 0.00% 39 91 0.00% 40 98 0.00% 41 136 0.00% 42 151 0.00% 43 187 0.00% 44 220 0.00% 45 264 0.00% 46 298 0.00% 47 354 0.00% 48 442 0.00% 49 528 0.00% 50 561 0.00% 51 637 0.00% 52 804 0.00% 53 832 0.00% 54 981 0.00% 55 1131 0.00% 56 1200 0.00% 57 1445 0.00% 58 1672 0.00% 59 1906 0.00% 60 2178 0.00% 61 2426 0.00% 62 2879 0.00% 63 3373 0.01% 64 3739 0.01% 65 4238 0.01% 66 5118 0.01% 67 6299 0.01% 68 7952 0.01% 69 13874 0.02% 70 11271 0.02% 71 9487 0.02% 72 10503 0.02% 73 12225 0.02% 74 13632 0.02% 75 15223 0.02% 76 16945 0.03% 77 19372 0.03% 78 21389 0.03% 79 23890 0.04% 80 27336 0.04% 81 30285 0.05% 82 34837 0.06% 83 39354 0.06% 84 46479 0.07% 85 52285 0.08% 86 57390 0.09% 87 62729 0.10% 88 68614 0.11% 89 75393 0.12% 90 81807 0.13% 91 88328 0.14% 92 96958 0.15% 93 107332 0.17% 94 117290 0.19% 95 126834 0.20% 96 135144 0.21% 97 144155 0.23% 98 153241 0.24% 99 164320 0.26% 100 176000 0.28% 101 188733 0.30% 102 202565 0.32% 103 215108 0.34% 104 231415 0.37% 105 246601 0.39% 106 255669 0.41% 107 266647 0.42% 108 275657 0.44% 109 290697 0.46% 110 302938 0.48% 111 317821 0.51% 112 339009 0.54% 113 347105 0.55% 114 366333 0.58% 115 384611 0.61% 116 392800 0.62% 117 402287 0.64% 118 412751 0.66% 119 421326 0.67% 120 432710 0.69% 121 444512 0.71% 122 458113 0.73% 123 472650 0.75% 124 490778 0.78% 125 504096 0.80% 126 521559 0.83% 127 526376 0.84% 128 531603 0.84% 129 531935 0.85% 130 539267 0.86% 131 542761 0.86% 132 557763 0.89% 133 571875 0.91% 134 585691 0.93% 135 604149 0.96% 136 609377 0.97% 137 622007 0.99% 138 630339 1.00% 139 640011 1.02% 140 645787 1.03% 141 665154 1.06% 142 685275 1.09% 143 712048 1.13% 144 761143 1.21% 145 821381 1.31% 146 906133 1.44% 147 1064676 1.69% 148 1388762 2.21% 149 2295975 3.65% 150 9540805 15.16% 151 24653358 39.18% 62924778 reads passed initial QC criterion=sequence-density sequence-density=0.28 sequence-density-rank=1 fanout-score=3.31 fanout-score-rank=24 prefix-density=0.36 prefix-fanout=2.6 sequence=TGAAATTAAGGGATTTCTTTTACTTAGAAGAATGCACTCAAGCT criterion=fanout-score sequence-density=0.05 sequence-density-rank=34 fanout-score=21.08 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=4.5 sequence=CCAACAAAGCAGCAGGAAATACAAGACACTTACAGATTACTAGCCATCAAATGAGATCCTGTAGAAAGGATTTGAGGAGGCCATGGCTAGCTAACTGTACTT criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=30 prefix-density=0.49 prefix-fanout=2.0 sequence=CACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=256.02 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=10.6 sequence=CAAGAAAATTAATTTGTTCATATATATAGTTGAGATACAGAAATATGGAGGCTCCTCTTAAATTCATCGGTCTTCTGGGATTGCTTGTGCTTTTGAGTGTTGCTGGAGGGG SRR6053282 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:51:49 Started mapping on | Feb 11 16:51:49 Finished on | Feb 11 16:59:06 Mapping speed, Million of reads per hour | 518.37 Number of input reads | 62924778 Average input read length | 281 UNIQUE READS: Uniquely mapped reads number | 58106851 Uniquely mapped reads % | 92.34% Average mapped length | 279.91 Number of splices: Total | 43436123 Number of splices: Annotated (sjdb) | 42217676 Number of splices: GT/AG | 42587138 Number of splices: GC/AG | 558196 Number of splices: AT/AC | 50231 Number of splices: Non-canonical | 240558 Mismatch rate per base, % | 0.83% Deletion rate per base | 0.08% Deletion average length | 2.87 Insertion rate per base | 0.06% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1883294 % of reads mapped to multiple loci | 2.99% Number of reads mapped to too many loci | 1131121 % of reads mapped to too many loci | 1.80% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.40% % of reads unmapped: other | 0.47% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2998240 2998240 2998240 N_multimapping 1883294 1883294 1883294 N_noFeature 2015497 57109447 2584726 N_ambiguous 782529 5701 350778 UnstrandedReadsAssigned:55308825 PositiveStrandReadsAssigned:991703 NegativeStrandReadsAssigned:55171347 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=129 echo kmer=125 SRR6053282 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053282-trimmed-pair1.fastq SRR6053282-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 62,924,778 reads, 55,991,874 reads pseudoaligned [quant] estimated average fragment length: 165.777 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,366 rounds 52401 SRR6053282.ke.tsv 34699 SRR6053282.se.tsv 87100 total ==> SRR6053282.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1853.22 5380 47.9672 Potri.005G024800.1.v4.1 1035 870.223 3067 58.2336 Potri.004G059700.1.v4.1 961 796.223 80 1.66014 Potri.007G009000.2.v4.1 1416 1251.22 0 0 Potri.003G141000.2.v4.1 2943 2778.22 2041.39 12.1408 Potri.016G087400.1.v4.1 270 109.311 8038.03 1214.99 Potri.015G069301.1.v4.1 564 399.295 0 0 Potri.010G195200.1.v4.1 1773 1608.22 398 4.08909 Potri.012G127500.1.v4.1 977 812.223 17591 357.854 ==> SRR6053282.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 4752 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1675 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 12 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 71 SRR6053282 completed mapping pipeline successfully