Starting /dee2/code/volunteer_pipeline.sh SRR6053283 current disk space = 3053376532480 free memory = 1576278780 SRR6053283 SRAfilesize b2f6bbf578bb0794182e9c307f5572d9 SRR6053283.sra SRR6053283.sra file validated SRR6053283 is paired end SRR6053283 is conventional basespace SRR6053283 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053283_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.2575 34.0 33.0 34.0 31.0 34.0 2 33.05475 34.0 33.0 34.0 31.0 34.0 3 33.20175 34.0 33.0 34.0 32.0 34.0 4 33.39 34.0 33.0 34.0 33.0 34.0 5 33.425 34.0 33.0 34.0 33.0 34.0 6 37.07175 38.0 37.0 38.0 36.0 38.0 7 37.33525 38.0 38.0 38.0 37.0 38.0 8 37.5065 38.0 38.0 38.0 37.0 38.0 9 37.476 38.0 38.0 38.0 37.0 38.0 10-14 37.5272 38.0 38.0 38.0 38.0 38.0 15-19 37.52145 38.0 38.0 38.0 37.8 38.0 20-24 37.446749999999994 38.0 38.0 38.0 37.2 38.0 25-29 37.41915 38.0 38.0 38.0 37.0 38.0 30-34 37.45005 38.0 38.0 38.0 37.4 38.0 35-39 37.350350000000006 38.0 38.0 38.0 37.0 38.0 40-44 37.322500000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.2923 38.0 38.0 38.0 37.0 38.0 50-54 37.22605 38.0 38.0 38.0 36.8 38.0 55-59 37.1698 38.0 38.0 38.0 36.4 38.0 60-64 37.23325 38.0 38.0 38.0 36.8 38.0 65-69 37.19035 38.0 38.0 38.0 36.6 38.0 70-74 37.121599999999994 38.0 38.0 38.0 36.0 38.0 75-79 37.09135 38.0 38.0 38.0 36.0 38.0 80-84 37.1007 38.0 38.0 38.0 36.0 38.0 85-89 37.0188 38.0 38.0 38.0 36.0 38.0 90-94 36.883 38.0 38.0 38.0 35.6 38.0 95-99 36.7976 38.0 38.0 38.0 35.2 38.0 100-104 36.7896 38.0 38.0 38.0 35.0 38.0 105-109 36.7019 38.0 38.0 38.0 35.0 38.0 110-114 36.579899999999995 38.0 38.0 38.0 34.2 38.0 115-119 36.48665 38.0 38.0 38.0 34.0 38.0 120-124 36.3899 38.0 38.0 38.0 34.0 38.0 125-129 36.2432 38.0 38.0 38.0 34.0 38.0 130-134 36.1078 38.0 37.8 38.0 33.4 38.0 135-139 35.9534 38.0 37.6 38.0 33.0 38.0 140-144 35.58395 38.0 36.2 38.0 31.4 38.0 145-149 35.25935 38.0 36.0 38.0 31.4 38.0 150-151 33.166000000000004 37.0 34.5 38.0 16.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 1.0 13 0.0 14 0.0 15 0.0 16 2.0 17 0.0 18 2.0 19 2.0 20 0.0 21 7.0 22 7.0 23 5.0 24 6.0 25 7.0 26 15.0 27 14.0 28 23.0 29 35.0 30 34.0 31 47.0 32 52.0 33 56.0 34 99.0 35 178.0 36 457.0 37 2948.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.680988184747584 13.533834586466165 6.7669172932330826 43.018259935553175 2 21.175 13.925 37.55 27.35 3 17.325 18.224999999999998 30.15 34.300000000000004 4 22.1 24.775 25.3 27.825 5 23.9 31.3 24.125 20.674999999999997 6 21.025 35.25 23.225 20.5 7 15.075 26.400000000000002 40.699999999999996 17.825 8 17.275 27.375 30.975 24.375 9 16.3 24.975 35.275 23.45 10-14 19.59 30.220000000000002 27.05 23.14 15-19 20.09 28.74 27.235 23.935000000000002 20-24 19.759999999999998 28.884999999999998 27.915 23.44 25-29 19.994999999999997 29.054999999999996 27.18 23.77 30-34 20.05 28.525 27.655 23.77 35-39 19.950000000000003 28.58 27.46 24.01 40-44 20.57 28.24 27.965 23.225 45-49 19.939999999999998 28.244999999999997 27.675 24.14 50-54 20.305 28.815 27.41 23.47 55-59 19.96 28.075 27.915 24.05 60-64 20.265 28.294999999999998 27.71 23.73 65-69 20.02 28.139999999999997 27.725 24.115000000000002 70-74 20.405 28.13 27.450000000000003 24.015 75-79 20.36 28.155 27.46 24.025 80-84 20.465 28.444999999999997 27.125 23.965 85-89 20.544999999999998 28.075 27.525 23.855 90-94 20.919999999999998 28.16 27.229999999999997 23.69 95-99 20.555 28.67 27.32 23.455000000000002 100-104 20.865000000000002 27.93 27.195000000000004 24.01 105-109 20.825 28.675 26.8 23.7 110-114 20.62 28.665000000000003 27.11 23.605 115-119 21.105 28.299999999999997 26.755000000000003 23.84 120-124 21.305 28.360000000000003 26.715 23.62 125-129 21.58 28.475 26.395000000000003 23.549999999999997 130-134 21.705 28.09 26.919999999999998 23.285 135-139 21.9 27.544999999999998 26.915 23.64 140-144 21.295 27.575 26.645000000000003 24.485 145-149 21.445 28.044999999999998 26.784999999999997 23.724999999999998 150-151 21.198099049524764 27.363681840920464 27.363681840920464 24.074537268634316 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.0 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 2.5 24 3.0 25 1.0 26 4.5 27 6.0 28 8.5 29 13.0 30 15.5 31 22.0 32 32.5 33 41.0 34 49.0 35 73.5 36 97.5 37 111.5 38 130.0 39 146.0 40 205.5 41 258.0 42 254.5 43 247.5 44 233.5 45 247.5 46 252.0 47 234.5 48 216.5 49 208.0 50 184.0 51 139.5 52 120.5 53 98.0 54 72.0 55 59.5 56 48.5 57 37.0 58 34.0 59 24.5 60 16.0 61 11.0 62 10.5 63 7.0 64 1.5 65 4.0 66 4.5 67 2.5 68 2.0 69 1.5 70 0.5 71 1.0 72 1.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.9 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2375 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7875000000000001 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.125 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.875 0.0 0.0 0.0 0.0 110-111 3.2375 0.0 0.0 0.0 0.0 112-113 3.55 0.0 0.0 0.0 0.0 114-115 3.9875 0.0 0.0 0.0 0.0 116-117 4.5375 0.0 0.0 0.0 0.0 118-119 5.125 0.0 0.0 0.0 0.0 120-121 5.8375 0.0 0.0 0.0 0.0 122-123 6.3375 0.0 0.0 0.0 0.0 124-125 6.8875 0.0 0.0 0.0 0.0 126-127 7.35 0.0 0.0 0.0 0.0 128-129 8.125 0.0 0.0 0.0 0.0 130-131 8.8125 0.0 0.0 0.0 0.0 132-133 9.45 0.0 0.0 0.0 0.0 134-135 10.125 0.0 0.0 0.0 0.0 136-137 10.5875 0.0 0.0 0.0 0.0 138-139 11.162500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6053283 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053283_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8655 33.0 33.0 34.0 32.0 34.0 2 32.95975 33.0 33.0 34.0 32.0 34.0 3 33.0035 34.0 33.0 34.0 32.0 34.0 4 32.91075 34.0 33.0 34.0 32.0 34.0 5 32.9385 34.0 33.0 34.0 32.0 34.0 6 37.1945 38.0 38.0 38.0 37.0 38.0 7 37.231 38.0 38.0 38.0 37.0 38.0 8 37.19875 38.0 38.0 38.0 37.0 38.0 9 37.0155 38.0 38.0 38.0 36.0 38.0 10-14 37.22615 38.0 38.0 38.0 37.0 38.0 15-19 37.1897 38.0 38.0 38.0 37.0 38.0 20-24 37.173500000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.1931 38.0 38.0 38.0 37.0 38.0 30-34 37.14575000000001 38.0 38.0 38.0 36.8 38.0 35-39 37.159600000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.13385 38.0 38.0 38.0 37.0 38.0 45-49 37.11280000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.0647 38.0 38.0 38.0 36.6 38.0 55-59 37.033550000000005 38.0 38.0 38.0 36.6 38.0 60-64 37.02040000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.98145 38.0 38.0 38.0 36.0 38.0 70-74 36.90695 38.0 38.0 38.0 36.0 38.0 75-79 36.918549999999996 38.0 38.0 38.0 36.0 38.0 80-84 36.8667 38.0 38.0 38.0 36.0 38.0 85-89 36.774950000000004 38.0 38.0 38.0 35.8 38.0 90-94 36.7242 38.0 38.0 38.0 35.4 38.0 95-99 36.65585 38.0 38.0 38.0 35.0 38.0 100-104 36.5784 38.0 38.0 38.0 35.0 38.0 105-109 36.4931 38.0 38.0 38.0 34.4 38.0 110-114 36.40095 38.0 38.0 38.0 34.4 38.0 115-119 36.33355 38.0 38.0 38.0 34.0 38.0 120-124 36.20375 38.0 38.0 38.0 33.8 38.0 125-129 36.05915 38.0 38.0 38.0 33.6 38.0 130-134 35.8303 38.0 38.0 38.0 33.0 38.0 135-139 35.60415 38.0 37.6 38.0 32.6 38.0 140-144 35.226150000000004 38.0 36.4 38.0 31.2 38.0 145-149 34.75514999999999 38.0 36.0 38.0 29.4 38.0 150-151 32.028875 37.0 32.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 0.0 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 5.0 14 4.0 15 4.0 16 0.0 17 1.0 18 3.0 19 4.0 20 4.0 21 1.0 22 4.0 23 11.0 24 12.0 25 9.0 26 23.0 27 14.0 28 26.0 29 35.0 30 38.0 31 47.0 32 64.0 33 62.0 34 106.0 35 184.0 36 418.0 37 2907.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.225 24.0 10.424999999999999 32.35 2 26.53980971457186 27.491236855282924 31.84777165748623 14.12118177265899 3 18.678017025538306 28.542814221331998 32.72408612919379 20.055082623935906 4 22.044088176352705 33.91783567134269 25.325651302605213 18.7124248496994 5 23.071142284569138 38.30160320641283 21.64328657314629 16.983967935871743 6 20.055082623935906 39.359038557836755 23.335002503755632 17.250876314471707 7 19.45418127190786 22.00801201802704 39.53430145217827 19.00350525788683 8 19.754631947921883 25.062593890836254 28.86830245368052 26.314471707561342 9 20.881321982974463 25.087631447170754 30.095142714071105 23.935903855783675 10-14 23.10465698547822 28.85327991987982 26.649974962443668 21.392088132198296 15-19 23.15973960941412 28.25237856785178 26.99549323985979 21.59238858287431 20-24 22.971010864667303 28.21809442747709 27.93270915736244 20.878185550493168 25-29 23.039559339008512 28.082123184777164 27.86179268903355 21.01652478718077 30-34 23.35770078109353 28.394752653715198 27.48347686761466 20.764069697576605 35-39 23.22751852593631 27.843981574203884 27.28820348487883 21.640296414980973 40-44 23.213659806719743 28.06569525812428 27.720194281708476 21.0004506534475 45-49 22.964854310603787 27.575848603184138 27.8862521277661 21.57304495844598 50-54 23.574468085106385 28.085106382978726 26.978723404255316 21.361702127659573 55-59 23.65193010564262 27.396985931006864 27.817553697491615 21.13353026585891 60-64 23.610415623435152 27.611417125688533 27.496244366549828 21.28192288432649 65-69 23.670505758637958 27.871807711567353 27.496244366549828 20.961442163244868 70-74 24.01602403605408 28.102153229844767 27.055583375062593 20.82623935903856 75-79 23.13470205307962 27.70155232849274 27.846770155232846 21.316975463194794 80-84 24.15122684026039 27.81672508763145 27.38607911867802 20.645968953430145 85-89 24.01862607650711 27.94912878029241 27.19807730823152 20.834167834968955 90-94 23.92229509838282 27.842587493115705 27.677364441996694 20.55775296650478 95-99 24.47058823529412 27.894868585732162 27.394242803504383 20.240300375469335 100-104 24.35287638311721 27.67235768287188 27.33189806238422 20.642867871626695 105-109 23.773282595633887 27.693771279791708 27.398357700781094 21.13458842379331 110-114 24.211316975463195 27.67150726089134 27.906860290435652 20.210315473209814 115-119 24.361542313470206 27.881822734101153 26.87531296945418 20.881321982974463 120-124 24.595663712382958 28.220920334485005 27.20945370787642 19.97396224525562 125-129 25.30796194291437 28.41762643965949 26.675012518778168 19.59939909864797 130-134 25.217826740110166 28.082123184777164 26.855282924386582 19.84476715072609 135-139 25.415581814540356 28.12938113358702 26.401962747846987 20.053074304025635 140-144 25.807259073842303 28.49561952440551 26.16770963704631 19.52941176470588 145-149 25.61830379493341 28.06147992390107 26.834885350956245 19.485330930209273 150-151 27.029393370856784 28.042526579111943 26.74171357098186 18.186366479049408 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 2.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.5 26 2.5 27 4.5 28 6.0 29 4.5 30 10.5 31 19.5 32 23.5 33 26.0 34 40.5 35 64.0 36 81.0 37 99.0 38 136.5 39 168.5 40 211.5 41 245.5 42 238.0 43 252.5 44 269.5 45 286.0 46 286.0 47 250.5 48 220.0 49 205.5 50 185.5 51 146.0 52 112.5 53 85.5 54 62.5 55 52.0 56 48.0 57 38.0 58 23.5 59 17.0 60 14.0 61 12.5 62 12.5 63 8.5 64 4.0 65 3.5 66 2.5 67 3.0 68 3.0 69 2.0 70 1.0 71 0.0 72 0.5 73 0.5 74 1.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.15 4 0.2 5 0.2 6 0.15 7 0.15 8 0.15 9 0.15 10-14 0.15 15-19 0.15 20-24 0.135 25-29 0.15 30-34 0.13999999999999999 35-39 0.13999999999999999 40-44 0.145 45-49 0.13 50-54 0.125 55-59 0.135 60-64 0.15 65-69 0.15 70-74 0.15 75-79 0.15 80-84 0.15 85-89 0.13999999999999999 90-94 0.135 95-99 0.125 100-104 0.135 105-109 0.13999999999999999 110-114 0.15 115-119 0.15 120-124 0.145 125-129 0.15 130-134 0.15 135-139 0.13999999999999999 140-144 0.125 145-149 0.13 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77426636568849 99.45 2 0.17557060446450964 0.35000000000000003 3 0.025081514923501375 0.075 4 0.0 0.0 5 0.025081514923501375 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCAACA 5 0.125 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3875 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7875000000000001 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.8 0.0 0.0 0.0 0.0 104-105 2.1375 0.0 0.0 0.0 0.0 106-107 2.4625 0.0 0.0 0.0 0.0 108-109 2.8875 0.0 0.0 0.0 0.0 110-111 3.2625 0.0 0.0 0.0 0.0 112-113 3.575 0.0 0.0 0.0 0.0 114-115 4.0125 0.0 0.0 0.0 0.0 116-117 4.574999999999999 0.0 0.0 0.0 0.0 118-119 5.1875 0.0 0.0 0.0 0.0 120-121 5.8625 0.0 0.0 0.0 0.0 122-123 6.35 0.0 0.0 0.0 0.0 124-125 6.8875 0.0 0.0 0.0 0.0 126-127 7.3375 0.0 0.0 0.0 0.0 128-129 8.0875 0.0 0.0 0.0 0.0 130-131 8.8125 0.0 0.0 0.0 0.0 132-133 9.4625 0.0 0.0 0.0 0.0 134-135 10.1375 0.0 0.0 0.0 0.0 136-137 10.5875 0.0 0.0 0.0 0.0 138-139 11.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTATGC 10 0.006830828 145.0 1 ACGAAAT 10 0.006830828 145.0 1 >>END_MODULE Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667768 spots for SRR6053283.sra Written 2667768 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra Read 2667757 spots for SRR6053283.sra Written 2667757 spots for SRR6053283.sra SRR ids: ['SRR6053283.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_3_3l1f05 SRR6053283.sra spots: 53355151 blocks: [[1, 2667757], [2667758, 5335514], [5335515, 8003271], [8003272, 10671028], [10671029, 13338785], [13338786, 16006542], [16006543, 18674299], [18674300, 21342056], [21342057, 24009813], [24009814, 26677570], [26677571, 29345327], [29345328, 32013084], [32013085, 34680841], [34680842, 37348598], [37348599, 40016355], [40016356, 42684112], [42684113, 45351869], [45351870, 48019626], [48019627, 50687383], [50687384, 53355151]] SRR6053283 file size 18058609 SRR6053283 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053283 SRR6053283_1.fastq SRR6053283_2.fastq Input file: SRR6053283_1.fastq Paired file: SRR6053283_2.fastq trimmed: SRR6053283-trimmed-pair1.fastq, SRR6053283-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 18:10:26 2025 >> started Tue Feb 11 18:11:27 2025 >> done (60.757s) 53355151 read pairs processed; of these: 41496 ( 0.08%) short read pairs filtered out after trimming by size control 53717 ( 0.10%) empty read pairs filtered out after trimming by size control 53259938 (99.82%) read pairs available; of these: 18726942 (35.16%) trimmed read pairs available after processing 34532996 (64.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 41 0.00% 19 34 0.00% 20 31 0.00% 21 35 0.00% 22 24 0.00% 23 27 0.00% 24 29 0.00% 25 24 0.00% 26 30 0.00% 27 29 0.00% 28 34 0.00% 29 14 0.00% 30 32 0.00% 31 28 0.00% 32 39 0.00% 33 49 0.00% 34 45 0.00% 35 55 0.00% 36 64 0.00% 37 80 0.00% 38 75 0.00% 39 116 0.00% 40 140 0.00% 41 144 0.00% 42 176 0.00% 43 198 0.00% 44 213 0.00% 45 208 0.00% 46 241 0.00% 47 324 0.00% 48 382 0.00% 49 461 0.00% 50 514 0.00% 51 647 0.00% 52 665 0.00% 53 709 0.00% 54 779 0.00% 55 842 0.00% 56 929 0.00% 57 1060 0.00% 58 1261 0.00% 59 1369 0.00% 60 1536 0.00% 61 1747 0.00% 62 2066 0.00% 63 2126 0.00% 64 2456 0.00% 65 2748 0.01% 66 2893 0.01% 67 3124 0.01% 68 3557 0.01% 69 4087 0.01% 70 5121 0.01% 71 5352 0.01% 72 5694 0.01% 73 6480 0.01% 74 7115 0.01% 75 7758 0.01% 76 8816 0.02% 77 9267 0.02% 78 10102 0.02% 79 11330 0.02% 80 12343 0.02% 81 13701 0.03% 82 15689 0.03% 83 17583 0.03% 84 20043 0.04% 85 22824 0.04% 86 25148 0.05% 87 26611 0.05% 88 28701 0.05% 89 30950 0.06% 90 33384 0.06% 91 36602 0.07% 92 39814 0.07% 93 43316 0.08% 94 47872 0.09% 95 51456 0.10% 96 55152 0.10% 97 58979 0.11% 98 61934 0.12% 99 65309 0.12% 100 69426 0.13% 101 72924 0.14% 102 78311 0.15% 103 83833 0.16% 104 89538 0.17% 105 95199 0.18% 106 101181 0.19% 107 105159 0.20% 108 109518 0.21% 109 113580 0.21% 110 115870 0.22% 111 120209 0.23% 112 126088 0.24% 113 130481 0.24% 114 137680 0.26% 115 144832 0.27% 116 150424 0.28% 117 155315 0.29% 118 160803 0.30% 119 163701 0.31% 120 166838 0.31% 121 171475 0.32% 122 175186 0.33% 123 180791 0.34% 124 186269 0.35% 125 191353 0.36% 126 198004 0.37% 127 203880 0.38% 128 206571 0.39% 129 209855 0.39% 130 213009 0.40% 131 217418 0.41% 132 223181 0.42% 133 225360 0.42% 134 231705 0.44% 135 239056 0.45% 136 246041 0.46% 137 255567 0.48% 138 261206 0.49% 139 267852 0.50% 140 277325 0.52% 141 290566 0.55% 142 313957 0.59% 143 320181 0.60% 144 350015 0.66% 145 389906 0.73% 146 471097 0.88% 147 590940 1.11% 148 652730 1.23% 149 1109685 2.08% 150 6542868 12.28% 151 34532996 64.84% 53259938 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=39 prefix-density=0.23 prefix-fanout=1.9 sequence=GCAATGATTGTCT criterion=fanout-score sequence-density=0.07 sequence-density-rank=20 fanout-score=198.23 fanout-score-rank=1 prefix-density=0.65 prefix-fanout=22.6 sequence=CATCATCATCACC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=7.12 fanout-score-rank=15 prefix-density=0.67 prefix-fanout=2.5 sequence=TGGCTGCAAATGTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=40 fanout-score=44.03 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.3 sequence=ATTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCG SRR6053283 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 18:12:21 Started mapping on | Feb 11 18:12:22 Finished on | Feb 11 18:22:15 Mapping speed, Million of reads per hour | 323.33 Number of input reads | 53259938 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 47668341 Uniquely mapped reads % | 89.50% Average mapped length | 290.32 Number of splices: Total | 41626978 Number of splices: Annotated (sjdb) | 40562846 Number of splices: GT/AG | 40847846 Number of splices: GC/AG | 544859 Number of splices: AT/AC | 38352 Number of splices: Non-canonical | 195921 Mismatch rate per base, % | 0.82% Deletion rate per base | 0.07% Deletion average length | 2.96 Insertion rate per base | 0.05% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1727532 % of reads mapped to multiple loci | 3.24% Number of reads mapped to too many loci | 189381 % of reads mapped to too many loci | 0.36% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.75% % of reads unmapped: other | 0.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3886163 3886163 3886163 N_multimapping 1727532 1727532 1727532 N_noFeature 1444879 46935874 1897279 N_ambiguous 600095 4243 317675 UnstrandedReadsAssigned:45623367 PositiveStrandReadsAssigned:728224 NegativeStrandReadsAssigned:45453387 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR6053283 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053283-trimmed-pair1.fastq SRR6053283-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 53,259,938 reads, 44,772,659 reads pseudoaligned [quant] estimated average fragment length: 228.178 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,204 rounds 52401 SRR6053283.ke.tsv 34699 SRR6053283.se.tsv 87100 total ==> SRR6053283.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1790.82 3899 45.6516 Potri.005G024800.1.v4.1 1035 807.822 1508 39.1418 Potri.004G059700.1.v4.1 961 733.837 189 5.40029 Potri.007G009000.2.v4.1 1416 1188.82 0 0 Potri.003G141000.2.v4.1 2943 2715.82 1564.89 12.0819 Potri.016G087400.1.v4.1 270 91.2213 3371 774.85 Potri.015G069301.1.v4.1 564 339.981 0 0 Potri.010G195200.1.v4.1 1773 1545.82 478 6.48371 Potri.012G127500.1.v4.1 977 749.832 32650 913.007 ==> SRR6053283.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1144 Potri.001G233950.v4.1 5 Potri.001G122700.v4.1 1163 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 657 SRR6053283 completed mapping pipeline successfully