Starting /dee2/code/volunteer_pipeline.sh SRR6053284 current disk space = 3053441331200 free memory = 1580037388 SRR6053284 SRAfilesize 9f3deca3a69edf4eb9c360860649fb91 SRR6053284.sra SRR6053284.sra file validated SRR6053284 is paired end SRR6053284 is conventional basespace SRR6053284 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053284_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.32175 34.0 33.0 34.0 18.0 34.0 2 32.7765 34.0 33.0 34.0 28.0 34.0 3 32.95775 34.0 33.0 34.0 31.0 34.0 4 33.1585 34.0 33.0 34.0 32.0 34.0 5 33.2765 34.0 33.0 34.0 33.0 34.0 6 36.80725 38.0 37.0 38.0 35.0 38.0 7 37.1685 38.0 38.0 38.0 36.0 38.0 8 37.33475 38.0 38.0 38.0 37.0 38.0 9 37.37825 38.0 38.0 38.0 37.0 38.0 10-14 37.40865 38.0 38.0 38.0 37.0 38.0 15-19 37.4069 38.0 38.0 38.0 37.0 38.0 20-24 37.39465 38.0 38.0 38.0 37.0 38.0 25-29 37.35595 38.0 38.0 38.0 37.0 38.0 30-34 37.312349999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.2836 38.0 38.0 38.0 37.0 38.0 40-44 37.2457 38.0 38.0 38.0 36.6 38.0 45-49 37.1649 38.0 38.0 38.0 36.0 38.0 50-54 37.164300000000004 38.0 38.0 38.0 36.2 38.0 55-59 37.1118 38.0 38.0 38.0 36.0 38.0 60-64 37.0905 38.0 38.0 38.0 36.0 38.0 65-69 37.008900000000004 38.0 38.0 38.0 36.0 38.0 70-74 37.032650000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.981350000000006 38.0 38.0 38.0 36.0 38.0 80-84 36.9422 38.0 38.0 38.0 35.4 38.0 85-89 36.8294 38.0 38.0 38.0 35.2 38.0 90-94 36.78375 38.0 38.0 38.0 35.0 38.0 95-99 36.631350000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.63715 38.0 38.0 38.0 35.0 38.0 105-109 36.50445 38.0 38.0 38.0 34.0 38.0 110-114 36.401300000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.22345 38.0 38.0 38.0 34.0 38.0 120-124 36.20785000000001 38.0 38.0 38.0 33.8 38.0 125-129 36.06415 38.0 38.0 38.0 33.4 38.0 130-134 35.94155000000001 38.0 37.6 38.0 33.0 38.0 135-139 35.7577 38.0 37.2 38.0 33.0 38.0 140-144 35.495999999999995 38.0 36.0 38.0 31.0 38.0 145-149 34.99829999999999 38.0 36.0 38.0 30.4 38.0 150-151 32.716750000000005 37.0 33.5 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 2.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 2.0 16 1.0 17 0.0 18 2.0 19 5.0 20 3.0 21 5.0 22 7.0 23 10.0 24 6.0 25 6.0 26 12.0 27 14.0 28 25.0 29 29.0 30 34.0 31 47.0 32 68.0 33 98.0 34 129.0 35 209.0 36 500.0 37 2783.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.509933774834437 12.61037527593819 16.335540838852097 47.54415011037528 2 21.7 18.975 38.525 20.8 3 21.45 26.224999999999998 24.25 28.075 4 23.474999999999998 32.975 20.45 23.1 5 22.05 37.0 24.875 16.075 6 17.675 35.475 25.2 21.65 7 13.375 21.95 44.7 19.975 8 18.725 22.0 31.05 28.225 9 18.525 22.175 33.925 25.374999999999996 10-14 19.935 29.285 26.985 23.794999999999998 15-19 20.849999999999998 27.775 27.295 24.08 20-24 20.16 28.610000000000003 27.625 23.605 25-29 20.575 28.235 27.27 23.919999999999998 30-34 19.994999999999997 28.494999999999997 27.334999999999997 24.175 35-39 20.365 28.02 27.439999999999998 24.175 40-44 20.76 28.785 27.08 23.375 45-49 20.605 28.17 27.334999999999997 23.89 50-54 20.665 27.529999999999998 27.305 24.5 55-59 20.23 28.634999999999998 27.445000000000004 23.69 60-64 20.71 27.72 27.565 24.005000000000003 65-69 20.68 28.310000000000002 27.32 23.69 70-74 20.105 28.065 27.33 24.5 75-79 20.525 28.38 27.02 24.075 80-84 20.794999999999998 27.935 27.015 24.255 85-89 21.085 28.455000000000002 27.065 23.395 90-94 21.38 27.79 26.96 23.87 95-99 20.87 28.51 27.27 23.35 100-104 20.995 27.800000000000004 27.139999999999997 24.065 105-109 21.42 28.22 26.695 23.665 110-114 21.395 28.275 26.805 23.525 115-119 21.58 28.82 26.3 23.3 120-124 21.52 28.4 26.705000000000002 23.375 125-129 22.05 28.115000000000002 26.245 23.59 130-134 21.745 28.050000000000004 26.6 23.605 135-139 21.915000000000003 28.095 25.795 24.195 140-144 21.58 28.22 26.090000000000003 24.11 145-149 21.265 28.585 25.965 24.185000000000002 150-151 22.575 28.1125 25.937500000000004 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.5 20 2.5 21 1.5 22 2.5 23 4.0 24 3.0 25 4.0 26 7.0 27 7.5 28 8.5 29 10.5 30 15.0 31 27.0 32 37.5 33 47.5 34 62.0 35 79.5 36 97.5 37 109.0 38 138.0 39 166.0 40 185.5 41 201.5 42 228.0 43 254.5 44 247.0 45 238.0 46 230.5 47 220.0 48 202.0 49 170.0 50 160.5 51 154.5 52 117.5 53 92.5 54 87.0 55 79.0 56 61.0 57 51.5 58 46.5 59 34.0 60 23.5 61 18.0 62 14.0 63 10.0 64 8.0 65 5.5 66 6.0 67 5.5 68 4.5 69 5.0 70 2.5 71 0.0 72 0.0 73 0.5 74 1.5 75 1.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 9.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.6875 0.0 0.0 0.0 0.0 112-113 1.95 0.0 0.0 0.0 0.0 114-115 2.2125000000000004 0.0 0.0 0.0 0.0 116-117 2.5375 0.0 0.0 0.0 0.0 118-119 2.925 0.0 0.0 0.0 0.0 120-121 3.4124999999999996 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.2875 0.0 0.0 0.0 0.0 126-127 4.8 0.0 0.0 0.0 0.0 128-129 5.475 0.0 0.0 0.0 0.0 130-131 6.012499999999999 0.0 0.0 0.0 0.0 132-133 6.4625 0.0 0.0 0.0 0.0 134-135 6.987500000000001 0.0 0.0 0.0 0.0 136-137 7.5375 0.0 0.0 0.0 0.0 138-139 8.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCCA 10 0.006843168 144.91249 3 >>END_MODULE SRR6053284 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053284_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.52475 33.0 33.0 34.0 32.0 34.0 2 32.774 33.0 33.0 34.0 32.0 34.0 3 32.8835 33.0 33.0 34.0 32.0 34.0 4 32.75925 33.0 33.0 34.0 32.0 34.0 5 32.85425 33.0 33.0 34.0 32.0 34.0 6 37.04475 38.0 38.0 38.0 36.0 38.0 7 37.12 38.0 38.0 38.0 36.0 38.0 8 36.96875 38.0 38.0 38.0 36.0 38.0 9 36.92175 38.0 38.0 38.0 36.0 38.0 10-14 37.04655 38.0 38.0 38.0 36.0 38.0 15-19 37.025999999999996 38.0 38.0 38.0 36.0 38.0 20-24 37.01645 38.0 38.0 38.0 36.0 38.0 25-29 37.04565 38.0 38.0 38.0 36.0 38.0 30-34 36.9612 38.0 38.0 38.0 36.0 38.0 35-39 36.954 38.0 38.0 38.0 36.0 38.0 40-44 36.95219999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.91255 38.0 38.0 38.0 36.0 38.0 50-54 36.865300000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.7685 38.0 38.0 38.0 35.4 38.0 60-64 36.760000000000005 38.0 38.0 38.0 35.4 38.0 65-69 36.76595 38.0 38.0 38.0 35.0 38.0 70-74 36.70375 38.0 38.0 38.0 35.0 38.0 75-79 36.597950000000004 38.0 38.0 38.0 35.0 38.0 80-84 36.526149999999994 38.0 38.0 38.0 34.4 38.0 85-89 36.5492 38.0 38.0 38.0 34.8 38.0 90-94 36.439949999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.3074 38.0 38.0 38.0 34.0 38.0 100-104 36.207950000000004 38.0 38.0 38.0 34.0 38.0 105-109 36.0108 38.0 37.8 38.0 33.0 38.0 110-114 36.0313 38.0 38.0 38.0 33.2 38.0 115-119 35.768150000000006 38.0 37.4 38.0 32.2 38.0 120-124 35.6414 38.0 37.0 38.0 31.2 38.0 125-129 35.58455 38.0 37.6 38.0 31.6 38.0 130-134 35.335699999999996 38.0 36.4 38.0 30.6 38.0 135-139 35.152849999999994 38.0 36.0 38.0 30.4 38.0 140-144 34.78735 38.0 36.0 38.0 28.2 38.0 145-149 34.209450000000004 38.0 36.0 38.0 25.0 38.0 150-151 31.276375 36.5 31.5 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 0.0 4 3.0 5 1.0 6 0.0 7 2.0 8 0.0 9 0.0 10 1.0 11 1.0 12 0.0 13 4.0 14 1.0 15 2.0 16 4.0 17 1.0 18 5.0 19 2.0 20 9.0 21 8.0 22 11.0 23 9.0 24 13.0 25 15.0 26 30.0 27 24.0 28 33.0 29 34.0 30 39.0 31 65.0 32 85.0 33 113.0 34 140.0 35 207.0 36 423.0 37 2708.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.94894894894895 12.312312312312311 22.972972972972975 40.765765765765764 2 25.674999999999997 17.275 38.525 18.525 3 20.474999999999998 22.05 35.225 22.25 4 24.2 29.299999999999997 23.375 23.125 5 26.131532883220803 34.18354588647162 23.005751437859466 16.67916979244811 6 18.463847885914436 37.25293970477858 24.218163622717036 20.06504878658994 7 19.154788697174293 16.004001000250064 43.21080270067517 21.630407601900476 8 21.065799349512133 22.316737553164874 27.77082812109082 28.84663497623217 9 22.041531148361273 22.71703777833375 30.848136102076555 24.39329497122842 10-14 23.128502802241794 27.4919935948759 26.336068855084065 23.043434747798237 15-19 23.146202341639146 27.118983288301813 27.699389572700888 22.03542479735815 20-24 22.988390712570055 27.91232986389111 27.19175340272218 21.907526020816654 25-29 23.39286607634199 27.350042523387863 27.485116814247835 21.771974586022314 30-34 23.273964378627177 27.906744046427857 27.276365819491694 21.542925755453272 35-39 22.93532089440248 27.307288279725878 27.52238507328298 22.235005752588666 40-44 22.936055238667066 27.604323026118283 27.138997298108674 22.320624437105973 45-49 22.25890356142457 27.531012404961984 27.951180472188874 22.25890356142457 50-54 23.893362676936928 27.069474316010606 27.474616115640476 21.562546891411994 55-59 23.988193506428534 27.249987493121218 27.244984741607887 21.516834258842362 60-64 23.34667333666833 27.213606803401703 27.463731865932967 21.975987993997 65-69 23.716601621134796 27.204042829980985 27.18402882017412 21.895326728710096 70-74 23.68921352811687 26.886131679007402 27.751650990594356 21.673003802281368 75-79 23.282461846384788 27.130347760820616 27.555666750062546 22.031523642732047 80-84 23.931752226558594 27.27409186430501 27.199039327529274 21.595116581607122 85-89 23.932949712284213 26.90517888416312 27.68076057042782 21.481110833124845 90-94 23.893362676936928 27.569649377282047 27.314560096033613 21.22242784974741 95-99 23.669467787114844 27.02581032412965 27.78611444577831 21.518607442977192 100-104 23.964585834333736 27.601040416166466 27.435974389755902 20.998399359743896 105-109 23.792844633475106 27.445584188141105 27.310482862146614 21.451088316237175 110-114 24.164498699219532 27.52651590954573 27.596557934760856 20.712427456473883 115-119 24.053229276101856 28.055430486767722 27.019860923507927 20.871479313622494 120-124 24.73107519887927 27.11762645719718 27.247711012157904 20.903587331765646 125-129 25.305244195356284 27.24679743795036 26.68634907926341 20.761609287429945 130-134 24.70476381104884 28.01741393114491 26.426140912730183 20.851681345076063 135-139 25.35260578173452 27.463238971691506 26.733019905971787 20.451135340602182 140-144 25.058770569699394 28.059820937328066 26.36422747961787 20.517181013354673 145-149 25.902770831249374 27.433229968990698 26.60298089426828 20.061018305491647 150-151 26.053256657082137 26.540817602200274 26.865858232279034 20.540067508438558 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 2.0 22 1.5 23 0.0 24 0.0 25 1.5 26 2.5 27 4.0 28 7.5 29 8.5 30 12.0 31 24.0 32 29.0 33 32.5 34 44.0 35 60.0 36 74.5 37 89.5 38 124.5 39 155.5 40 173.5 41 184.5 42 214.0 43 249.0 44 260.0 45 259.5 46 239.0 47 225.0 48 214.5 49 188.0 50 176.0 51 161.5 52 124.0 53 117.0 54 107.5 55 76.5 56 62.5 57 59.5 58 57.5 59 45.5 60 35.0 61 26.0 62 17.0 63 12.0 64 11.0 65 7.5 66 3.0 67 3.0 68 4.0 69 4.0 70 2.0 71 1.0 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.0 3 0.0 4 0.0 5 0.025 6 0.075 7 0.025 8 0.075 9 0.075 10-14 0.08 15-19 0.06999999999999999 20-24 0.08 25-29 0.055 30-34 0.06 35-39 0.045 40-44 0.06999999999999999 45-49 0.04 50-54 0.034999999999999996 55-59 0.055 60-64 0.05 65-69 0.06999999999999999 70-74 0.06 75-79 0.075 80-84 0.06999999999999999 85-89 0.075 90-94 0.034999999999999996 95-99 0.04 100-104 0.04 105-109 0.075 110-114 0.06 115-119 0.055 120-124 0.065 125-129 0.08 130-134 0.08 135-139 0.03 140-144 0.034999999999999996 145-149 0.03 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.5125 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 1.0375 0.0 0.0 0.0 0.0 108-109 1.3624999999999998 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.975 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.4375 0.0 0.0 0.0 0.0 122-123 3.875 0.0 0.0 0.0 0.0 124-125 4.3125 0.0 0.0 0.0 0.0 126-127 4.825 0.0 0.0 0.0 0.0 128-129 5.5 0.0 0.0 0.0 0.0 130-131 6.0375 0.0 0.0 0.0 0.0 132-133 6.4875 0.0 0.0 0.0 0.0 134-135 7.025 0.0 0.0 0.0 0.0 136-137 7.5875 0.0 0.0 0.0 0.0 138-139 8.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTACAAC 10 0.0069214175 144.3625 5 TACAACT 10 0.0069214175 144.3625 6 >>END_MODULE Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110406 spots for SRR6053284.sra Written 3110406 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra Read 3110389 spots for SRR6053284.sra Written 3110389 spots for SRR6053284.sra SRR ids: ['SRR6053284.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_b8mvme_i SRR6053284.sra spots: 62207797 blocks: [[1, 3110389], [3110390, 6220778], [6220779, 9331167], [9331168, 12441556], [12441557, 15551945], [15551946, 18662334], [18662335, 21772723], [21772724, 24883112], [24883113, 27993501], [27993502, 31103890], [31103891, 34214279], [34214280, 37324668], [37324669, 40435057], [40435058, 43545446], [43545447, 46655835], [46655836, 49766224], [49766225, 52876613], [52876614, 55987002], [55987003, 59097391], [59097392, 62207797]] SRR6053284 file size 21058480 SRR6053284 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053284 SRR6053284_1.fastq SRR6053284_2.fastq Input file: SRR6053284_1.fastq Paired file: SRR6053284_2.fastq trimmed: SRR6053284-trimmed-pair1.fastq, SRR6053284-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:20:50 2025 >> started Tue Feb 11 19:21:54 2025 >> done (64.359s) 62207797 read pairs processed; of these: 48906 ( 0.08%) short read pairs filtered out after trimming by size control 43846 ( 0.07%) empty read pairs filtered out after trimming by size control 62115045 (99.85%) read pairs available; of these: 21260140 (34.23%) trimmed read pairs available after processing 40854905 (65.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 14 0.00% 20 13 0.00% 21 10 0.00% 22 10 0.00% 23 12 0.00% 24 10 0.00% 25 9 0.00% 26 16 0.00% 27 12 0.00% 28 16 0.00% 29 24 0.00% 30 14 0.00% 31 20 0.00% 32 38 0.00% 33 28 0.00% 34 17 0.00% 35 36 0.00% 36 32 0.00% 37 42 0.00% 38 40 0.00% 39 54 0.00% 40 61 0.00% 41 73 0.00% 42 84 0.00% 43 85 0.00% 44 91 0.00% 45 99 0.00% 46 136 0.00% 47 155 0.00% 48 167 0.00% 49 235 0.00% 50 213 0.00% 51 273 0.00% 52 290 0.00% 53 317 0.00% 54 336 0.00% 55 362 0.00% 56 411 0.00% 57 502 0.00% 58 578 0.00% 59 682 0.00% 60 791 0.00% 61 866 0.00% 62 909 0.00% 63 1042 0.00% 64 1099 0.00% 65 1229 0.00% 66 1302 0.00% 67 1545 0.00% 68 1803 0.00% 69 2824 0.00% 70 2651 0.00% 71 2532 0.00% 72 2825 0.00% 73 3228 0.01% 74 3542 0.01% 75 4044 0.01% 76 4598 0.01% 77 4936 0.01% 78 5515 0.01% 79 6191 0.01% 80 6816 0.01% 81 7791 0.01% 82 8802 0.01% 83 10002 0.02% 84 12472 0.02% 85 14570 0.02% 86 16264 0.03% 87 17669 0.03% 88 19382 0.03% 89 21521 0.03% 90 22862 0.04% 91 24916 0.04% 92 27372 0.04% 93 29648 0.05% 94 32724 0.05% 95 36149 0.06% 96 39624 0.06% 97 43280 0.07% 98 46280 0.07% 99 48962 0.08% 100 52723 0.08% 101 55934 0.09% 102 59469 0.10% 103 63340 0.10% 104 68190 0.11% 105 72773 0.12% 106 78702 0.13% 107 83235 0.13% 108 88030 0.14% 109 93103 0.15% 110 96962 0.16% 111 100642 0.16% 112 105765 0.17% 113 109955 0.18% 114 115555 0.19% 115 123187 0.20% 116 129309 0.21% 117 135451 0.22% 118 142047 0.23% 119 148831 0.24% 120 152973 0.25% 121 159577 0.26% 122 164111 0.26% 123 168812 0.27% 124 176080 0.28% 125 181235 0.29% 126 187908 0.30% 127 196769 0.32% 128 203951 0.33% 129 209064 0.34% 130 215985 0.35% 131 221869 0.36% 132 228101 0.37% 133 235056 0.38% 134 242601 0.39% 135 250244 0.40% 136 260351 0.42% 137 271031 0.44% 138 283616 0.46% 139 296698 0.48% 140 310828 0.50% 141 327293 0.53% 142 347607 0.56% 143 370631 0.60% 144 406759 0.65% 145 456031 0.73% 146 528807 0.85% 147 652861 1.05% 148 904415 1.46% 149 1588974 2.56% 150 8590490 13.83% 151 40854905 65.77% 62115045 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=5.79 fanout-score-rank=12 prefix-density=0.92 prefix-fanout=3.2 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCAACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=17.46 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=5.9 sequence=ACAAATCCAAAGCCGCGAGATCTTCCAGTTTCACGATCGTTTATAATCT criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=35 prefix-density=0.68 prefix-fanout=2.0 sequence=GGCAGTGGCTGCAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=43.71 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.9 sequence=TTTTCTTTGAGAGTGCATAGATTTGTGTTGATATAGAAAACAATGGCACTACATGGAAAGATTGAGACAACATTAGAACTCAAGTCCTCCGCAGAGAAGTTCTACAAAGTGTGGAGGAGCCAGTCCTTCCATGTTCCCAAACATGCTTCCAAGCATATCCAAGGAGTTGATATACATGCAGGTGACTGGGAGACTGCGGGCTCTATCAGGATTTGGCAGTACACAATCGGAGGGAAAGCCGGGGTCTTTAAAGAGGAGGTTTCCTTCGATGATGAGAACAAGATCATAACTCTTAATGGTTTGGAAGGAGATGTCATGAAAATTTACAAGGTCTATAGGCCCGTCTGGCAGCTTACACCAAAAGGCTCGGGCTGCTTGGCAAAACTGACCATTGAATACGAAAAACTCCATCCTGAAGTCCCGGTTCCAGAGATTTATGTTGATCTTATGGTTCATATGACTAAAGACATCGACGAAGCCCTTAGCACGGAGTAATAGAAGGGGTCATCGA SRR6053284 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:22:56 Started mapping on | Feb 11 19:22:56 Finished on | Feb 11 19:42:57 Mapping speed, Million of reads per hour | 186.19 Number of input reads | 62115045 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 50417846 Uniquely mapped reads % | 81.17% Average mapped length | 292.94 Number of splices: Total | 44004603 Number of splices: Annotated (sjdb) | 42824987 Number of splices: GT/AG | 43168360 Number of splices: GC/AG | 576671 Number of splices: AT/AC | 40115 Number of splices: Non-canonical | 219457 Mismatch rate per base, % | 0.77% Deletion rate per base | 0.07% Deletion average length | 2.84 Insertion rate per base | 0.05% Insertion average length | 2.75 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1943704 % of reads mapped to multiple loci | 3.13% Number of reads mapped to too many loci | 508077 % of reads mapped to too many loci | 0.82% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 14.50% % of reads unmapped: other | 0.38% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 9776600 9776600 9776600 N_multimapping 1943704 1943704 1943704 N_noFeature 1861072 49649767 2341793 N_ambiguous 627791 4615 338011 UnstrandedReadsAssigned:47928983 PositiveStrandReadsAssigned:763464 NegativeStrandReadsAssigned:47738042 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR6053284 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053284-trimmed-pair1.fastq SRR6053284-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 62,115,045 reads, 47,087,890 reads pseudoaligned [quant] estimated average fragment length: 243.194 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52401 SRR6053284.ke.tsv 34699 SRR6053284.se.tsv 87100 total ==> SRR6053284.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1775.81 3967 42.3062 Potri.005G024800.1.v4.1 1035 792.806 1409 33.6575 Potri.004G059700.1.v4.1 961 718.843 190 5.00561 Potri.007G009000.2.v4.1 1416 1173.81 1 0.016134 Potri.003G141000.2.v4.1 2943 2700.81 1654.72 11.603 Potri.016G087400.1.v4.1 270 85.4893 3884 860.409 Potri.015G069301.1.v4.1 564 328.501 0 0 Potri.010G195200.1.v4.1 1773 1530.81 582.472 7.20597 Potri.012G127500.1.v4.1 977 734.817 19617 505.582 ==> SRR6053284.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 498 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 1139 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1728 SRR6053284 completed mapping pipeline successfully