Starting /dee2/code/volunteer_pipeline.sh SRR6053285 current disk space = 3053398110208 free memory = 1580137320 SRR6053285 SRAfilesize b839364b0682bccef1c0431cc3e58075 SRR6053285.sra SRR6053285.sra file validated SRR6053285 is paired end SRR6053285 is conventional basespace SRR6053285 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053285_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.90775 34.0 33.0 34.0 32.0 34.0 2 33.15775 34.0 33.0 34.0 32.0 34.0 3 33.246 34.0 33.0 34.0 32.0 34.0 4 33.4025 34.0 33.0 34.0 33.0 34.0 5 33.45125 34.0 33.0 34.0 33.0 34.0 6 36.93775 38.0 37.0 38.0 35.0 38.0 7 37.3185 38.0 38.0 38.0 37.0 38.0 8 37.377 38.0 38.0 38.0 37.0 38.0 9 37.429 38.0 38.0 38.0 37.0 38.0 10-14 37.428200000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.475049999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.4088 38.0 38.0 38.0 37.0 38.0 25-29 37.3894 38.0 38.0 38.0 37.0 38.0 30-34 37.3831 38.0 38.0 38.0 37.0 38.0 35-39 37.32195 38.0 38.0 38.0 37.0 38.0 40-44 37.282650000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.2221 38.0 38.0 38.0 37.0 38.0 50-54 37.17205 38.0 38.0 38.0 36.0 38.0 55-59 37.16325 38.0 38.0 38.0 36.2 38.0 60-64 37.17325 38.0 38.0 38.0 36.0 38.0 65-69 37.096199999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.10355 38.0 38.0 38.0 36.0 38.0 75-79 37.02115 38.0 38.0 38.0 36.0 38.0 80-84 36.9893 38.0 38.0 38.0 36.0 38.0 85-89 36.93435 38.0 38.0 38.0 35.6 38.0 90-94 36.841899999999995 38.0 38.0 38.0 35.4 38.0 95-99 36.6917 38.0 38.0 38.0 34.6 38.0 100-104 36.714800000000004 38.0 38.0 38.0 34.8 38.0 105-109 36.63015 38.0 38.0 38.0 34.6 38.0 110-114 36.537150000000004 38.0 38.0 38.0 34.4 38.0 115-119 36.38530000000001 38.0 38.0 38.0 34.0 38.0 120-124 36.270599999999995 38.0 38.0 38.0 34.0 38.0 125-129 36.19525 38.0 38.0 38.0 33.8 38.0 130-134 35.98635 38.0 38.0 38.0 33.2 38.0 135-139 35.7996 38.0 37.0 38.0 33.0 38.0 140-144 35.5837 38.0 36.0 38.0 32.2 38.0 145-149 35.1596 38.0 36.0 38.0 31.2 38.0 150-151 32.6215 37.0 33.5 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 2.0 17 2.0 18 3.0 19 1.0 20 5.0 21 2.0 22 5.0 23 3.0 24 6.0 25 13.0 26 13.0 27 18.0 28 19.0 29 38.0 30 40.0 31 49.0 32 49.0 33 78.0 34 121.0 35 208.0 36 453.0 37 2869.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.433848572177105 12.418129421011265 5.344511396384595 49.80351061042704 2 17.349999999999998 13.575000000000001 42.825 26.25 3 16.075 17.675 28.475 37.775 4 21.6 26.0 24.9 27.500000000000004 5 22.925 31.874999999999996 24.5 20.7 6 18.175 35.65 25.224999999999998 20.95 7 13.775 26.275 43.075 16.875 8 15.950000000000001 25.324999999999996 34.225 24.5 9 15.925 23.724999999999998 36.625 23.724999999999998 10-14 19.040000000000003 29.92 27.88 23.16 15-19 19.54 28.67 27.650000000000002 24.14 20-24 19.564999999999998 28.715000000000003 28.465 23.255 25-29 19.23 28.910000000000004 27.925 23.935000000000002 30-34 19.295 28.22 28.53 23.955000000000002 35-39 19.955000000000002 28.43 27.985 23.630000000000003 40-44 19.994999999999997 28.215 28.439999999999998 23.35 45-49 19.869999999999997 28.544999999999998 27.445000000000004 24.14 50-54 19.525000000000002 28.62 28.33 23.525 55-59 19.585 28.62 27.615000000000002 24.18 60-64 20.31 27.894999999999996 28.185 23.61 65-69 19.564999999999998 28.54 28.155 23.74 70-74 19.665 28.265 28.735 23.335 75-79 19.875 28.599999999999998 27.389999999999997 24.135 80-84 20.19 28.49 28.105000000000004 23.215 85-89 20.035 27.889999999999997 28.535 23.54 90-94 19.73 28.405 28.165000000000003 23.7 95-99 20.46 27.85 28.125 23.565 100-104 19.91 28.389999999999997 28.505000000000003 23.195 105-109 20.93 28.715000000000003 27.145000000000003 23.21 110-114 20.27 28.355000000000004 27.779999999999998 23.595 115-119 20.294999999999998 28.970000000000002 27.43 23.305 120-124 21.115000000000002 28.560000000000002 26.985 23.34 125-129 20.794999999999998 28.525 26.795 23.885 130-134 21.12 28.025 27.26 23.595 135-139 21.325 28.515 26.875 23.285 140-144 21.265 28.194999999999997 26.51 24.03 145-149 21.205 28.720000000000002 26.575 23.5 150-151 21.3625 28.125 25.674999999999997 24.837500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 3.0 24 4.5 25 4.5 26 4.0 27 6.5 28 12.0 29 16.5 30 19.0 31 19.5 32 27.5 33 43.5 34 57.0 35 65.0 36 88.5 37 123.5 38 150.5 39 180.5 40 210.5 41 228.0 42 256.0 43 280.0 44 275.5 45 271.5 46 264.5 47 249.0 48 243.5 49 194.5 50 134.0 51 116.5 52 111.0 53 100.5 54 70.0 55 41.5 56 31.0 57 23.5 58 16.0 59 17.0 60 13.0 61 7.5 62 4.0 63 2.5 64 2.5 65 1.5 66 2.0 67 2.0 68 0.5 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.575 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.87484355444305 99.75 2 0.1251564455569462 0.25 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.9874999999999999 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4875 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.7249999999999996 0.0 0.0 0.0 0.0 108-109 3.1625 0.0 0.0 0.0 0.0 110-111 3.5 0.0 0.0 0.0 0.0 112-113 3.9625000000000004 0.0 0.0 0.0 0.0 114-115 4.387499999999999 0.0 0.0 0.0 0.0 116-117 4.875 0.0 0.0 0.0 0.0 118-119 5.475 0.0 0.0 0.0 0.0 120-121 6.1875 0.0 0.0 0.0 0.0 122-123 6.7875 0.0 0.0 0.0 0.0 124-125 7.550000000000001 0.0 0.0 0.0 0.0 126-127 8.25 0.0 0.0 0.0 0.0 128-129 9.087499999999999 0.0 0.0 0.0 0.0 130-131 9.7375 0.0 0.0 0.0 0.0 132-133 10.5625 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.325 0.0 0.0 0.0 0.0 138-139 13.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR6053285 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053285_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.7275 33.0 33.0 34.0 32.0 34.0 2 32.76125 33.0 33.0 34.0 32.0 34.0 3 32.88875 33.0 33.0 34.0 32.0 34.0 4 32.805 34.0 33.0 34.0 32.0 34.0 5 32.839 34.0 33.0 34.0 32.0 34.0 6 37.06775 38.0 38.0 38.0 36.0 38.0 7 37.1095 38.0 38.0 38.0 37.0 38.0 8 37.125 38.0 38.0 38.0 36.0 38.0 9 36.99875 38.0 38.0 38.0 36.0 38.0 10-14 37.044650000000004 38.0 38.0 38.0 36.0 38.0 15-19 37.07815 38.0 38.0 38.0 36.6 38.0 20-24 37.0835 38.0 38.0 38.0 36.2 38.0 25-29 37.07735 38.0 38.0 38.0 36.4 38.0 30-34 37.0583 38.0 38.0 38.0 36.2 38.0 35-39 37.0876 38.0 38.0 38.0 36.4 38.0 40-44 37.0332 38.0 38.0 38.0 36.2 38.0 45-49 37.04105 38.0 38.0 38.0 36.0 38.0 50-54 37.044149999999995 38.0 38.0 38.0 36.2 38.0 55-59 36.9875 38.0 38.0 38.0 36.0 38.0 60-64 36.82365 38.0 38.0 38.0 35.8 38.0 65-69 36.890249999999995 38.0 38.0 38.0 36.0 38.0 70-74 36.85095 38.0 38.0 38.0 35.8 38.0 75-79 36.81080000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.78265 38.0 38.0 38.0 35.4 38.0 85-89 36.7316 38.0 38.0 38.0 35.0 38.0 90-94 36.65175 38.0 38.0 38.0 35.0 38.0 95-99 36.569900000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.48825000000001 38.0 38.0 38.0 34.2 38.0 105-109 36.434200000000004 38.0 38.0 38.0 34.2 38.0 110-114 36.267450000000004 38.0 38.0 38.0 34.0 38.0 115-119 36.135600000000004 38.0 38.0 38.0 33.8 38.0 120-124 35.92915000000001 38.0 38.0 38.0 33.0 38.0 125-129 35.9168 38.0 38.0 38.0 33.0 38.0 130-134 35.743550000000006 38.0 37.8 38.0 33.0 38.0 135-139 35.473400000000005 38.0 37.0 38.0 31.4 38.0 140-144 35.13995 38.0 36.0 38.0 31.0 38.0 145-149 34.60785 38.0 36.0 38.0 28.2 38.0 150-151 31.620375000000003 36.5 32.0 38.0 15.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 0.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 2.0 13 0.0 14 1.0 15 2.0 16 1.0 17 3.0 18 5.0 19 3.0 20 10.0 21 7.0 22 9.0 23 15.0 24 11.0 25 25.0 26 18.0 27 23.0 28 28.0 29 28.0 30 37.0 31 54.0 32 53.0 33 85.0 34 109.0 35 205.0 36 403.0 37 2853.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.599999999999998 23.275000000000002 11.025 36.1 2 24.05 25.85 36.375 13.725000000000001 3 16.375 28.65 34.35 20.625 4 21.125 34.2 25.85 18.825 5 25.15 36.15 21.625 17.075000000000003 6 20.36018009004502 39.19459729864933 22.836418209104554 17.608804402201102 7 20.040030022516888 20.540405303977984 40.38028521391043 19.039279459594695 8 19.70985492746373 24.23711855927964 31.51575787893947 24.537268634317158 9 21.99149362021516 23.767825869402053 32.49937453089817 21.74130597948461 10-14 23.346342439707797 28.57500250175122 26.603622535775038 21.475032522765936 15-19 22.61583108175723 28.905233663564495 27.46422495747023 21.014710297208044 20-24 22.675873111177825 29.340538376863805 27.259081356949867 20.724507155008506 25-29 22.954920698453996 28.283384199729824 27.783058988342425 20.97863611347376 30-34 23.158526821457166 27.842273819055247 27.87730184147318 21.121897518014414 35-39 22.692480864475463 28.745810195607586 27.33503426884787 21.226674671069087 40-44 22.962629446195407 27.850317674721097 28.5156836259943 20.6713692530892 45-49 22.957626694682077 27.945369953474408 28.385612086647654 20.711391265195857 50-54 23.163898339003403 28.587152291374824 28.29697818691215 19.951971182709627 55-59 22.854855656176515 27.883124030619904 28.498524040626407 20.763496272577175 60-64 23.34517436333617 27.587932155901335 28.54855656176515 20.51833691899735 65-69 23.102326745058793 28.231173380035024 27.920940705529144 20.745559169377035 70-74 23.6565595917142 27.35915140598419 28.35985189632743 20.624437105974184 75-79 23.14467297202622 28.459190311765 27.783616073662614 20.612520642546166 80-84 23.486440508355848 27.829480636445513 27.679375562894027 21.00470329230461 85-89 23.641277149434494 28.205384846361724 27.960164147732957 20.19317385647082 90-94 24.036825778044633 28.46992895026518 27.519263484439104 19.973981787251073 95-99 24.01700850425213 28.264132066033014 27.383691845922964 20.335167583791897 100-104 24.14448669201521 28.40204122473484 27.231338803281968 20.22213327996798 105-109 24.36827620715537 28.326244683512634 27.59069301976482 19.714786089567177 110-114 24.52074678412333 28.94539266229541 27.08844286500826 19.445417688573002 115-119 25.2076869182264 28.385546992293065 26.874186768091285 19.53257932138925 120-124 24.85364023017263 28.491368526394794 27.2604453340005 19.394545909432072 125-129 25.339004253189895 28.886664998749062 26.424818613960472 19.349512134100575 130-134 25.61433361693609 28.562134027325957 26.41008958510585 19.4134427706321 135-139 25.44280996697688 28.760132092464723 26.633643550485342 19.16341439007305 140-144 26.439541747961382 28.20551303216769 26.219420681374757 19.135524538496174 145-149 26.255753452071247 29.32259355613368 25.870522313388033 18.551130678407045 150-151 26.569142285571395 28.632158039509875 26.11902975743936 18.67966991747937 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 0.5 23 1.0 24 4.0 25 6.5 26 5.5 27 6.5 28 8.5 29 13.5 30 17.5 31 20.0 32 24.5 33 38.0 34 46.5 35 52.5 36 88.0 37 123.5 38 149.5 39 170.0 40 208.5 41 246.0 42 260.0 43 276.5 44 281.0 45 288.0 46 272.5 47 237.0 48 229.0 49 196.5 50 155.5 51 126.0 52 102.5 53 89.5 54 63.5 55 44.0 56 33.5 57 25.5 58 20.0 59 18.5 60 12.5 61 9.5 62 9.5 63 5.5 64 2.5 65 0.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.05 7 0.075 8 0.05 9 0.075 10-14 0.06999999999999999 15-19 0.06999999999999999 20-24 0.06999999999999999 25-29 0.065 30-34 0.08 35-39 0.055 40-44 0.055 45-49 0.055 50-54 0.06 55-59 0.065 60-64 0.065 65-69 0.075 70-74 0.06999999999999999 75-79 0.08499999999999999 80-84 0.06999999999999999 85-89 0.09 90-94 0.06999999999999999 95-99 0.05 100-104 0.06 105-109 0.075 110-114 0.105 115-119 0.09 120-124 0.075 125-129 0.075 130-134 0.095 135-139 0.06999999999999999 140-144 0.055 145-149 0.06 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82460536206464 99.6 2 0.15033826108744675 0.3 3 0.0 0.0 4 0.025056376847907794 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7749999999999999 0.0 0.0 0.0 0.0 96-97 0.9874999999999999 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.4375 0.0 0.0 0.0 0.0 102-103 1.775 0.0 0.0 0.0 0.0 104-105 2.1624999999999996 0.0 0.0 0.0 0.0 106-107 2.6375 0.0 0.0 0.0 0.0 108-109 3.0875 0.0 0.0 0.0 0.0 110-111 3.4125 0.0 0.0 0.0 0.0 112-113 3.8875 0.0 0.0 0.0 0.0 114-115 4.3125 0.0 0.0 0.0 0.0 116-117 4.800000000000001 0.0 0.0 0.0 0.0 118-119 5.375 0.0 0.0 0.0 0.0 120-121 6.0625 0.0 0.0 0.0 0.0 122-123 6.7125 0.0 0.0 0.0 0.0 124-125 7.5 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 9.0375 0.0 0.0 0.0 0.0 130-131 9.7125 0.0 0.0 0.0 0.0 132-133 10.575 0.0 0.0 0.0 0.0 134-135 11.3875 0.0 0.0 0.0 0.0 136-137 12.337499999999999 0.0 0.0 0.0 0.0 138-139 13.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACATT 10 0.006830828 145.0 4 >>END_MODULE Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra Read 3034964 spots for SRR6053285.sra Written 3034964 spots for SRR6053285.sra Read 3034951 spots for SRR6053285.sra Written 3034951 spots for SRR6053285.sra SRR ids: ['SRR6053285.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_0cu5e99s SRR6053285.sra spots: 60699033 blocks: [[1, 3034951], [3034952, 6069902], [6069903, 9104853], [9104854, 12139804], [12139805, 15174755], [15174756, 18209706], [18209707, 21244657], [21244658, 24279608], [24279609, 27314559], [27314560, 30349510], [30349511, 33384461], [33384462, 36419412], [36419413, 39454363], [39454364, 42489314], [42489315, 45524265], [45524266, 48559216], [48559217, 51594167], [51594168, 54629118], [54629119, 57664069], [57664070, 60699033]] SRR6053285 file size 20547210 SRR6053285 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053285 SRR6053285_1.fastq SRR6053285_2.fastq Input file: SRR6053285_1.fastq Paired file: SRR6053285_2.fastq trimmed: SRR6053285-trimmed-pair1.fastq, SRR6053285-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 19:27:49 2025 >> started Tue Feb 11 19:28:54 2025 >> done (64.853s) 60699033 read pairs processed; of these: 72869 ( 0.12%) short read pairs filtered out after trimming by size control 38826 ( 0.06%) empty read pairs filtered out after trimming by size control 60587338 (99.82%) read pairs available; of these: 23391741 (38.61%) trimmed read pairs available after processing 37195597 (61.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 37 0.00% 19 47 0.00% 20 39 0.00% 21 38 0.00% 22 40 0.00% 23 50 0.00% 24 38 0.00% 25 38 0.00% 26 28 0.00% 27 38 0.00% 28 39 0.00% 29 25 0.00% 30 42 0.00% 31 38 0.00% 32 32 0.00% 33 49 0.00% 34 38 0.00% 35 38 0.00% 36 51 0.00% 37 36 0.00% 38 64 0.00% 39 58 0.00% 40 70 0.00% 41 87 0.00% 42 105 0.00% 43 110 0.00% 44 137 0.00% 45 126 0.00% 46 166 0.00% 47 183 0.00% 48 244 0.00% 49 255 0.00% 50 298 0.00% 51 354 0.00% 52 369 0.00% 53 446 0.00% 54 538 0.00% 55 599 0.00% 56 611 0.00% 57 781 0.00% 58 834 0.00% 59 1005 0.00% 60 1218 0.00% 61 1370 0.00% 62 1479 0.00% 63 1770 0.00% 64 1966 0.00% 65 2140 0.00% 66 2448 0.00% 67 2749 0.00% 68 3087 0.01% 69 3660 0.01% 70 4352 0.01% 71 4720 0.01% 72 5364 0.01% 73 6204 0.01% 74 6895 0.01% 75 7778 0.01% 76 8762 0.01% 77 9355 0.02% 78 10490 0.02% 79 11952 0.02% 80 13313 0.02% 81 15100 0.02% 82 17160 0.03% 83 19370 0.03% 84 22949 0.04% 85 26234 0.04% 86 28624 0.05% 87 31431 0.05% 88 34388 0.06% 89 37038 0.06% 90 40723 0.07% 91 44470 0.07% 92 48634 0.08% 93 53684 0.09% 94 59769 0.10% 95 64751 0.11% 96 69612 0.11% 97 75705 0.12% 98 79014 0.13% 99 84686 0.14% 100 90447 0.15% 101 96615 0.16% 102 103538 0.17% 103 111532 0.18% 104 117732 0.19% 105 125891 0.21% 106 134118 0.22% 107 141232 0.23% 108 147063 0.24% 109 152891 0.25% 110 156658 0.26% 111 162906 0.27% 112 171761 0.28% 113 177288 0.29% 114 185336 0.31% 115 195674 0.32% 116 202187 0.33% 117 210260 0.35% 118 218199 0.36% 119 221065 0.36% 120 226225 0.37% 121 232304 0.38% 122 235515 0.39% 123 242900 0.40% 124 250221 0.41% 125 256169 0.42% 126 264536 0.44% 127 271181 0.45% 128 276456 0.46% 129 280927 0.46% 130 285136 0.47% 131 287673 0.47% 132 291802 0.48% 133 297905 0.49% 134 304969 0.50% 135 312007 0.51% 136 320459 0.53% 137 330182 0.54% 138 338424 0.56% 139 349254 0.58% 140 357752 0.59% 141 371167 0.61% 142 386858 0.64% 143 403606 0.67% 144 436672 0.72% 145 478677 0.79% 146 536145 0.88% 147 638114 1.05% 148 846154 1.40% 149 1448863 2.39% 150 7738460 12.77% 151 37195597 61.39% 60587338 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=8.24 fanout-score-rank=11 prefix-density=0.47 prefix-fanout=3.5 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCAACACCAGCAATGATTGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=347.49 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=28.4 sequence=CTTCTTCTTCTT criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.01 fanout-score-rank=29 prefix-density=0.23 prefix-fanout=2.7 sequence=TAGCAGAAAATGAAGAAGACCCTGGTCTTGTTATGAACTTTTACAAGGATACATGCCCTCAAGCTGAGGACATTGTCAAAGAACAAGTTAGACTCCTTTACAAGAGACACAAAAACACTGCATTTTCTTGGCTAAGAAACATCTTCCATGACTGTGCTGTTCAGTCATGTGATGCTTCACTGCTGCTGGACTCAACAAGGAGGACCTTGTCCGAGAAGGAGACAGACAGGAGCTTTGGCCTCAGGAACTTTAGATACTTTGACGATATCAAAGAAGCTGTTGAAAGAGAGTGTCCTGGAGT criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=376.38 fanout-score-rank=1 prefix-density=0.94 prefix-fanout=32.5 sequence=AAGAAGAAGAAA SRR6053285 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 19:29:40 Started mapping on | Feb 11 19:29:40 Finished on | Feb 11 19:39:01 Mapping speed, Million of reads per hour | 388.80 Number of input reads | 60587338 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 55887979 Uniquely mapped reads % | 92.24% Average mapped length | 289.10 Number of splices: Total | 50377004 Number of splices: Annotated (sjdb) | 49093644 Number of splices: GT/AG | 49448626 Number of splices: GC/AG | 655330 Number of splices: AT/AC | 46436 Number of splices: Non-canonical | 226612 Mismatch rate per base, % | 0.75% Deletion rate per base | 0.07% Deletion average length | 2.94 Insertion rate per base | 0.05% Insertion average length | 2.71 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1959486 % of reads mapped to multiple loci | 3.23% Number of reads mapped to too many loci | 173251 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2771044 2771044 2771044 N_multimapping 1959486 1959486 1959486 N_noFeature 1943008 55036198 2504286 N_ambiguous 647126 4843 353749 UnstrandedReadsAssigned:53297845 PositiveStrandReadsAssigned:846938 NegativeStrandReadsAssigned:53029944 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR6053285 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053285-trimmed-pair1.fastq SRR6053285-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 60,587,338 reads, 52,155,431 reads pseudoaligned [quant] estimated average fragment length: 224.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR6053285.ke.tsv 34699 SRR6053285.se.tsv 87100 total ==> SRR6053285.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1794.38 3684 39.2223 Potri.005G024800.1.v4.1 1035 811.378 1124 26.4649 Potri.004G059700.1.v4.1 961 737.402 566 14.6636 Potri.007G009000.2.v4.1 1416 1192.38 2 0.0320438 Potri.003G141000.2.v4.1 2943 2719.38 2030.21 14.2626 Potri.016G087400.1.v4.1 270 96.6413 4212 832.632 Potri.015G069301.1.v4.1 564 345.49 0 0 Potri.010G195200.1.v4.1 1773 1549.38 316 3.89634 Potri.012G127500.1.v4.1 977 753.388 26432 670.254 ==> SRR6053285.se.tsv <== Potri.001G166300.v4.1 1 Potri.001G448400.v4.1 1957 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 1404 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 8 Potri.001G452600.v4.1 580 SRR6053285 completed mapping pipeline successfully