Starting /dee2/code/volunteer_pipeline.sh SRR6053287 current disk space = 3048751837184 free memory = 1416174384 SRR6053287 SRAfilesize 0c775a86e3f92353755071150659d08f SRR6053287.sra SRR6053287.sra file validated SRR6053287 is paired end SRR6053287 is conventional basespace SRR6053287 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053287_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.17 34.0 33.0 34.0 32.0 34.0 2 33.22225 34.0 33.0 34.0 32.0 34.0 3 33.3315 34.0 33.0 34.0 32.0 34.0 4 33.40025 34.0 34.0 34.0 33.0 34.0 5 33.45275 34.0 34.0 34.0 33.0 34.0 6 37.00775 38.0 37.0 38.0 36.0 38.0 7 37.3335 38.0 38.0 38.0 37.0 38.0 8 37.41525 38.0 38.0 38.0 37.0 38.0 9 37.525 38.0 38.0 38.0 37.0 38.0 10-14 37.49435 38.0 38.0 38.0 37.2 38.0 15-19 37.505 38.0 38.0 38.0 37.6 38.0 20-24 37.4457 38.0 38.0 38.0 37.0 38.0 25-29 37.432449999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.486250000000005 38.0 38.0 38.0 37.4 38.0 35-39 37.39465 38.0 38.0 38.0 37.0 38.0 40-44 37.3476 38.0 38.0 38.0 37.0 38.0 45-49 37.369749999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.247699999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.2894 38.0 38.0 38.0 37.0 38.0 60-64 37.28335 38.0 38.0 38.0 37.0 38.0 65-69 37.18455 38.0 38.0 38.0 36.8 38.0 70-74 37.2126 38.0 38.0 38.0 37.0 38.0 75-79 37.175149999999995 38.0 38.0 38.0 37.0 38.0 80-84 37.16695 38.0 38.0 38.0 36.2 38.0 85-89 37.081849999999996 38.0 38.0 38.0 36.0 38.0 90-94 37.08375 38.0 38.0 38.0 36.0 38.0 95-99 36.9412 38.0 38.0 38.0 36.0 38.0 100-104 36.8828 38.0 38.0 38.0 36.0 38.0 105-109 36.84925 38.0 38.0 38.0 35.6 38.0 110-114 36.786449999999995 38.0 38.0 38.0 35.2 38.0 115-119 36.649800000000006 38.0 38.0 38.0 35.0 38.0 120-124 36.5809 38.0 38.0 38.0 34.6 38.0 125-129 36.408500000000004 38.0 38.0 38.0 34.2 38.0 130-134 36.3445 38.0 38.0 38.0 34.0 38.0 135-139 36.079950000000004 38.0 38.0 38.0 33.4 38.0 140-144 35.88340000000001 38.0 37.8 38.0 33.4 38.0 145-149 35.4444 38.0 37.0 38.0 31.8 38.0 150-151 33.46625 37.5 34.5 38.0 17.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 3.0 18 2.0 19 1.0 20 4.0 21 3.0 22 2.0 23 7.0 24 7.0 25 8.0 26 12.0 27 19.0 28 24.0 29 24.0 30 27.0 31 44.0 32 51.0 33 75.0 34 88.0 35 142.0 36 373.0 37 3081.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.70871261378413 13.211963589076722 6.319895968790637 44.7594278283485 2 19.425 15.4 37.525 27.650000000000002 3 16.8 18.0 28.525 36.675000000000004 4 19.55 26.75 25.05 28.65 5 21.425 32.0 24.825 21.75 6 19.575 34.4 24.925 21.099999999999998 7 14.05 27.025 42.275 16.650000000000002 8 15.675 26.950000000000003 31.7 25.674999999999997 9 14.825 25.2 35.449999999999996 24.525 10-14 18.41 30.740000000000002 28.17 22.68 15-19 18.84 29.115000000000002 28.299999999999997 23.745 20-24 19.15 29.080000000000002 27.694999999999997 24.075 25-29 18.66 29.335 28.095 23.91 30-34 19.73 28.965000000000003 27.575 23.73 35-39 19.255 28.725 28.165000000000003 23.855 40-44 19.5 28.68 28.07 23.75 45-49 19.064999999999998 28.89 27.735 24.310000000000002 50-54 19.765 28.84 27.375 24.02 55-59 18.970000000000002 28.52 27.955000000000002 24.555 60-64 18.89 29.015 27.625 24.47 65-69 19.759999999999998 28.544999999999998 27.93 23.765 70-74 19.09 28.389999999999997 27.905 24.615000000000002 75-79 19.919999999999998 28.994999999999997 27.650000000000002 23.435 80-84 19.81 28.389999999999997 27.839999999999996 23.96 85-89 19.945 28.355000000000004 27.295 24.404999999999998 90-94 20.07 28.865000000000002 27.529999999999998 23.535 95-99 19.67 28.58 27.855 23.895 100-104 20.215 27.98 27.605 24.2 105-109 20.200000000000003 28.28 28.025 23.494999999999997 110-114 20.355 28.16 27.52 23.965 115-119 20.28 28.075 27.51 24.135 120-124 20.27 28.415000000000003 27.16 24.154999999999998 125-129 20.91 28.939999999999998 26.165 23.985 130-134 21.33 28.205000000000002 26.46 24.005000000000003 135-139 21.095 28.835 26.419999999999998 23.65 140-144 20.95 27.98 26.855 24.215 145-149 21.08 28.515 26.650000000000002 23.755000000000003 150-151 21.337500000000002 26.4125 27.8875 24.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 5.0 27 9.5 28 11.0 29 14.0 30 23.0 31 31.0 32 40.5 33 50.0 34 64.5 35 81.0 36 92.0 37 114.0 38 159.5 39 190.0 40 203.0 41 228.0 42 255.0 43 263.5 44 258.5 45 263.5 46 261.5 47 242.0 48 210.0 49 182.5 50 168.0 51 133.5 52 100.5 53 84.0 54 62.5 55 47.5 56 36.0 57 25.0 58 17.0 59 12.5 60 12.5 61 11.0 62 7.5 63 4.5 64 2.5 65 3.0 66 2.5 67 2.0 68 1.0 69 1.0 70 1.5 71 1.0 72 2.0 73 1.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.8747808665164 99.7 2 0.10017530678687703 0.2 3 0.0 0.0 4 0.025043826696719257 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.975 0.0 0.0 0.0 0.0 102-103 2.25 0.0 0.0 0.0 0.0 104-105 2.6125 0.0 0.0 0.0 0.0 106-107 3.025 0.0 0.0 0.0 0.0 108-109 3.525 0.0 0.0 0.0 0.0 110-111 4.0 0.0 0.0 0.0 0.0 112-113 4.4 0.0 0.0 0.0 0.0 114-115 4.975 0.0 0.0 0.0 0.0 116-117 5.3125 0.0 0.0 0.0 0.0 118-119 5.8375 0.0 0.0 0.0 0.0 120-121 6.4375 0.0 0.0 0.0 0.0 122-123 6.9625 0.0 0.0 0.0 0.0 124-125 7.7125 0.0 0.0 0.0 0.0 126-127 8.587499999999999 0.0 0.0 0.0 0.0 128-129 9.25 0.0 0.0 0.0 0.0 130-131 10.075 0.0 0.0 0.0 0.0 132-133 10.7875 0.0 0.0 0.0 0.0 134-135 11.5125 0.0 0.0 0.0 0.0 136-137 12.25 0.0 0.0 0.0 0.0 138-139 12.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTTCT 10 0.006577216 146.82278 1 GTTTCTT 10 0.006832588 144.9875 2 ATTCCAA 10 0.006832588 144.9875 8 >>END_MODULE SRR6053287 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR6053287_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8425 33.0 33.0 34.0 32.0 34.0 2 32.874 33.0 33.0 34.0 32.0 34.0 3 32.98525 33.0 33.0 34.0 32.0 34.0 4 32.95925 34.0 33.0 34.0 32.0 34.0 5 32.97725 34.0 33.0 34.0 32.0 34.0 6 37.131 38.0 38.0 38.0 37.0 38.0 7 37.1165 38.0 38.0 38.0 37.0 38.0 8 37.11975 38.0 38.0 38.0 37.0 38.0 9 37.07475 38.0 38.0 38.0 37.0 38.0 10-14 37.1198 38.0 38.0 38.0 36.8 38.0 15-19 37.08135 38.0 38.0 38.0 36.8 38.0 20-24 37.15235 38.0 38.0 38.0 37.0 38.0 25-29 37.150600000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.07785 38.0 38.0 38.0 36.8 38.0 35-39 37.093599999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.0934 38.0 38.0 38.0 36.6 38.0 45-49 37.1101 38.0 38.0 38.0 37.0 38.0 50-54 37.0336 38.0 38.0 38.0 36.8 38.0 55-59 37.01135 38.0 38.0 38.0 36.6 38.0 60-64 36.9375 38.0 38.0 38.0 36.0 38.0 65-69 36.961349999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.93315 38.0 38.0 38.0 36.0 38.0 75-79 36.8987 38.0 38.0 38.0 36.0 38.0 80-84 36.899899999999995 38.0 38.0 38.0 36.0 38.0 85-89 36.868950000000005 38.0 38.0 38.0 36.0 38.0 90-94 36.81505 38.0 38.0 38.0 35.8 38.0 95-99 36.67059999999999 38.0 38.0 38.0 35.0 38.0 100-104 36.643350000000005 38.0 38.0 38.0 35.0 38.0 105-109 36.55335 38.0 38.0 38.0 35.0 38.0 110-114 36.354299999999995 38.0 38.0 38.0 34.2 38.0 115-119 36.294 38.0 38.0 38.0 34.0 38.0 120-124 36.06805000000001 38.0 38.0 38.0 33.6 38.0 125-129 36.063900000000004 38.0 38.0 38.0 34.0 38.0 130-134 35.8555 38.0 38.0 38.0 33.2 38.0 135-139 35.62160000000001 38.0 37.8 38.0 32.6 38.0 140-144 35.4469 38.0 37.2 38.0 32.0 38.0 145-149 34.96195 38.0 36.0 38.0 31.0 38.0 150-151 31.951 37.0 32.0 38.0 15.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 5.0 4 1.0 5 0.0 6 1.0 7 2.0 8 0.0 9 0.0 10 1.0 11 0.0 12 3.0 13 0.0 14 4.0 15 1.0 16 2.0 17 3.0 18 7.0 19 5.0 20 3.0 21 5.0 22 9.0 23 9.0 24 7.0 25 15.0 26 22.0 27 14.0 28 32.0 29 29.0 30 28.0 31 59.0 32 64.0 33 66.0 34 96.0 35 162.0 36 379.0 37 2964.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.125 23.95 10.549999999999999 31.374999999999996 2 27.750000000000004 25.724999999999998 32.15 14.374999999999998 3 17.849999999999998 29.225 33.6 19.325 4 21.825 35.099999999999994 24.95 18.125 5 26.075 34.775 22.225 16.925 6 21.346346346346344 38.36336336336336 22.8978978978979 17.39239239239239 7 20.200250312891114 21.576971214017522 38.82352941176471 19.39924906132666 8 20.275344180225282 25.707133917396746 30.21276595744681 23.804755944931163 9 20.906359539308962 24.586880320480724 31.347020530796193 23.15973960941412 10-14 23.26640965303159 29.294547639313073 26.89130325940019 20.547739448255147 15-19 23.47669353627397 28.258148500475645 27.682371201121512 20.582786762128872 20-24 23.690798037448683 28.08651246620607 27.951336737759085 20.27135275858616 25-29 23.214017521902377 28.550688360450565 27.694618272841055 20.540675844806007 30-34 23.294942413620433 28.187280921382076 27.77666499749624 20.74111166750125 35-39 23.16664163788357 28.13735796165591 27.9821795064324 20.71382089402813 40-44 23.614795535312076 28.870313829521 27.76915761549627 19.745733019670656 45-49 23.202843412094513 27.88346015218262 28.369042851421707 20.544653584301162 50-54 23.709637046307886 28.170212765957448 27.904881101376724 20.21526908635795 55-59 24.24409291149379 27.64817781337605 27.362835402482983 20.74489387264718 60-64 23.5906678682287 27.91128467007109 27.946330229298088 20.551717232402122 65-69 23.658121369917883 28.00420588824354 28.309633486881637 20.02803925495694 70-74 24.122565463375555 28.438391828969106 27.26180343463676 20.177239273018575 75-79 23.967149081075668 27.92328108568281 27.47258250287946 20.63698733036206 80-84 23.803324654516324 27.773883436811538 27.57360304426197 20.849188864410173 85-89 24.514222756410255 27.944711538461537 27.25360576923077 20.287459935897438 90-94 23.843380733026237 27.668736230723013 28.354696575205285 20.13318646104546 95-99 23.951346481129242 27.560316347982784 28.296125738312146 20.19221143257583 100-104 24.559471365638768 28.19883860632759 27.417901481778134 19.823788546255507 105-109 24.7446424994993 28.049268976567195 27.29821750450631 19.907871019427198 110-114 24.451567665030552 28.28808975257939 27.291395372132627 19.968947210257436 115-119 25.309229305423408 28.11858380489759 27.302318593820424 19.26986829585858 120-124 25.231585799409146 28.381152671373496 26.939061639377098 19.448199889840268 125-129 25.40183265735316 28.05568073706875 27.269540834209604 19.272945771368484 130-134 25.50953978666934 27.883218989433622 27.237217687415495 19.370023536481547 135-139 26.19405226794833 28.321818363873035 26.454390707920293 19.029738660258335 140-144 25.66451419132002 27.9821795064324 26.700705811683434 19.652600490564147 145-149 26.576892270724873 27.683219863836605 27.032438926712054 18.707448938726472 150-151 26.93846923461731 28.05152576288144 26.28814407203602 18.721860930465233 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 1.5 3 2.0 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.5 20 1.5 21 2.0 22 1.5 23 1.0 24 0.5 25 0.5 26 2.5 27 5.0 28 5.5 29 9.5 30 13.5 31 16.5 32 18.5 33 22.5 34 37.0 35 61.0 36 83.5 37 123.0 38 161.0 39 182.5 40 205.5 41 237.5 42 268.5 43 275.0 44 272.0 45 285.5 46 286.0 47 247.0 48 216.5 49 196.5 50 179.5 51 147.0 52 100.0 53 79.0 54 62.5 55 42.0 56 33.5 57 27.5 58 23.0 59 18.5 60 11.0 61 7.5 62 7.5 63 4.0 64 1.5 65 3.0 66 2.5 67 2.0 68 2.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.1 7 0.125 8 0.125 9 0.15 10-14 0.135 15-19 0.135 20-24 0.13 25-29 0.125 30-34 0.15 35-39 0.11499999999999999 40-44 0.105 45-49 0.12 50-54 0.125 55-59 0.12 60-64 0.13 65-69 0.13999999999999999 70-74 0.135 75-79 0.155 80-84 0.13999999999999999 85-89 0.16 90-94 0.13999999999999999 95-99 0.11 100-104 0.12 105-109 0.13999999999999999 110-114 0.16999999999999998 115-119 0.155 120-124 0.145 125-129 0.145 130-134 0.155 135-139 0.13 140-144 0.11499999999999999 145-149 0.12 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62292609351434 99.075 2 0.32679738562091504 0.65 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.025138260432378077 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CTTAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCAACA 8 0.2 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.75 0.0 0.0 0.0 0.0 92-93 0.875 0.0 0.0 0.0 0.0 94-95 1.1 0.0 0.0 0.0 0.0 96-97 1.375 0.0 0.0 0.0 0.0 98-99 1.675 0.0 0.0 0.0 0.0 100-101 2.0 0.0 0.0 0.0 0.0 102-103 2.2625 0.0 0.0 0.0 0.0 104-105 2.5875 0.0 0.0 0.0 0.0 106-107 3.0 0.0 0.0 0.0 0.0 108-109 3.5 0.0 0.0 0.0 0.0 110-111 3.9749999999999996 0.0 0.0 0.0 0.0 112-113 4.362500000000001 0.0 0.0 0.0 0.0 114-115 4.925000000000001 0.0 0.0 0.0 0.0 116-117 5.275 0.0 0.0 0.0 0.0 118-119 5.7625 0.0 0.0 0.0 0.0 120-121 6.3125 0.0 0.0 0.0 0.0 122-123 6.825 0.0 0.0 0.0 0.0 124-125 7.5625 0.0 0.0 0.0 0.0 126-127 8.3875 0.0 0.0 0.0 0.0 128-129 9.0625 0.0 0.0 0.0 0.0 130-131 9.8375 0.0 0.0 0.0 0.0 132-133 10.5375 0.0 0.0 0.0 0.0 134-135 11.2875 0.0 0.0 0.0 0.0 136-137 12.024999999999999 0.0 0.0 0.0 0.0 138-139 12.7625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAGAATC 10 0.00682755 145.0 2 >>END_MODULE Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771406 spots for SRR6053287.sra Written 2771406 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra Read 2771391 spots for SRR6053287.sra Written 2771391 spots for SRR6053287.sra SRR ids: ['SRR6053287.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__z6cyb06 SRR6053287.sra spots: 55427835 blocks: [[1, 2771391], [2771392, 5542782], [5542783, 8314173], [8314174, 11085564], [11085565, 13856955], [13856956, 16628346], [16628347, 19399737], [19399738, 22171128], [22171129, 24942519], [24942520, 27713910], [27713911, 30485301], [30485302, 33256692], [33256693, 36028083], [36028084, 38799474], [38799475, 41570865], [41570866, 44342256], [44342257, 47113647], [47113648, 49885038], [49885039, 52656429], [52656430, 55427835]] SRR6053287 file size 18760974 SRR6053287 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR6053287 SRR6053287_1.fastq SRR6053287_2.fastq Input file: SRR6053287_1.fastq Paired file: SRR6053287_2.fastq trimmed: SRR6053287-trimmed-pair1.fastq, SRR6053287-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Feb 11 16:39:58 2025 >> started Tue Feb 11 16:41:31 2025 >> done (92.786s) 55427835 read pairs processed; of these: 70383 ( 0.13%) short read pairs filtered out after trimming by size control 48400 ( 0.09%) empty read pairs filtered out after trimming by size control 55309052 (99.79%) read pairs available; of these: 19942203 (36.06%) trimmed read pairs available after processing 35366849 (63.94%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 32 0.00% 19 33 0.00% 20 18 0.00% 21 35 0.00% 22 24 0.00% 23 26 0.00% 24 27 0.00% 25 22 0.00% 26 31 0.00% 27 31 0.00% 28 24 0.00% 29 23 0.00% 30 29 0.00% 31 30 0.00% 32 38 0.00% 33 42 0.00% 34 49 0.00% 35 47 0.00% 36 55 0.00% 37 83 0.00% 38 89 0.00% 39 138 0.00% 40 120 0.00% 41 149 0.00% 42 160 0.00% 43 186 0.00% 44 228 0.00% 45 201 0.00% 46 305 0.00% 47 293 0.00% 48 393 0.00% 49 467 0.00% 50 511 0.00% 51 594 0.00% 52 662 0.00% 53 721 0.00% 54 828 0.00% 55 834 0.00% 56 947 0.00% 57 1112 0.00% 58 1235 0.00% 59 1490 0.00% 60 1717 0.00% 61 1972 0.00% 62 2143 0.00% 63 2446 0.00% 64 2677 0.00% 65 2843 0.01% 66 3165 0.01% 67 3599 0.01% 68 4187 0.01% 69 4988 0.01% 70 8406 0.02% 71 7243 0.01% 72 6952 0.01% 73 7877 0.01% 74 8524 0.02% 75 9298 0.02% 76 10143 0.02% 77 10906 0.02% 78 11955 0.02% 79 13242 0.02% 80 14779 0.03% 81 16735 0.03% 82 18980 0.03% 83 21657 0.04% 84 24968 0.05% 85 27713 0.05% 86 29809 0.05% 87 32115 0.06% 88 34563 0.06% 89 36796 0.07% 90 39352 0.07% 91 43582 0.08% 92 47172 0.09% 93 52449 0.09% 94 57827 0.10% 95 62174 0.11% 96 65803 0.12% 97 70184 0.13% 98 73384 0.13% 99 77683 0.14% 100 82006 0.15% 101 87692 0.16% 102 93414 0.17% 103 99102 0.18% 104 105964 0.19% 105 111364 0.20% 106 118729 0.21% 107 123114 0.22% 108 126348 0.23% 109 130004 0.24% 110 133279 0.24% 111 138823 0.25% 112 145587 0.26% 113 151278 0.27% 114 159424 0.29% 115 168318 0.30% 116 173320 0.31% 117 177452 0.32% 118 182130 0.33% 119 185317 0.34% 120 189841 0.34% 121 192857 0.35% 122 196948 0.36% 123 203064 0.37% 124 210601 0.38% 125 215994 0.39% 126 222470 0.40% 127 227560 0.41% 128 231470 0.42% 129 232232 0.42% 130 237379 0.43% 131 236288 0.43% 132 242124 0.44% 133 248555 0.45% 134 254650 0.46% 135 262008 0.47% 136 270403 0.49% 137 278186 0.50% 138 283187 0.51% 139 292312 0.53% 140 297026 0.54% 141 307430 0.56% 142 322335 0.58% 143 338076 0.61% 144 366322 0.66% 145 399930 0.72% 146 448123 0.81% 147 530764 0.96% 148 696940 1.26% 149 1185598 2.14% 150 6644495 12.01% 151 35366849 63.94% 55309052 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=5.55 fanout-score-rank=26 prefix-density=0.54 prefix-fanout=3.8 sequence=ACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCATCCAGAGCCGCAGCCACAGTTTCCTCCACAGCAAGACATTTTCTGTTGGAAAAGAAGGAAAGTGTG criterion=fanout-score sequence-density=0.08 sequence-density-rank=14 fanout-score=75.21 fanout-score-rank=1 prefix-density=0.42 prefix-fanout=13.7 sequence=TCCTCATCAAGTTTCTCCGACAG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=32 prefix-density=0.51 prefix-fanout=2.0 sequence=CACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT criterion=fanout-score sequence-density=0.07 sequence-density-rank=18 fanout-score=294.32 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=19.2 sequence=AAGAAGAAGAAA SRR6053287 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 11 16:42:29 Started mapping on | Feb 11 16:42:29 Finished on | Feb 11 16:52:24 Mapping speed, Million of reads per hour | 334.64 Number of input reads | 55309052 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 51417195 Uniquely mapped reads % | 92.96% Average mapped length | 289.38 Number of splices: Total | 45735011 Number of splices: Annotated (sjdb) | 44635174 Number of splices: GT/AG | 44864335 Number of splices: GC/AG | 616201 Number of splices: AT/AC | 43187 Number of splices: Non-canonical | 211288 Mismatch rate per base, % | 0.76% Deletion rate per base | 0.07% Deletion average length | 2.91 Insertion rate per base | 0.05% Insertion average length | 2.73 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 1815210 % of reads mapped to multiple loci | 3.28% Number of reads mapped to too many loci | 629979 % of reads mapped to too many loci | 1.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.42% % of reads unmapped: other | 0.20% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2105825 2105825 2105825 N_multimapping 1815210 1815210 1815210 N_noFeature 1687791 50596404 2164377 N_ambiguous 743042 4566 396421 UnstrandedReadsAssigned:48986362 PositiveStrandReadsAssigned:816225 NegativeStrandReadsAssigned:48856397 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR6053287 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR6053287-trimmed-pair1.fastq SRR6053287-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 55,309,052 reads, 48,466,469 reads pseudoaligned [quant] estimated average fragment length: 221.833 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,180 rounds 52401 SRR6053287.ke.tsv 34699 SRR6053287.se.tsv 87100 total ==> SRR6053287.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1797.17 4464 44.2732 Potri.005G024800.1.v4.1 1035 814.167 3836 83.9789 Potri.004G059700.1.v4.1 961 740.184 113 2.7211 Potri.007G009000.2.v4.1 1416 1195.17 2 0.0298268 Potri.003G141000.2.v4.1 2943 2722.17 2144.47 14.0414 Potri.016G087400.1.v4.1 270 94.2341 5287 1000.01 Potri.015G069301.1.v4.1 564 345.303 0 0 Potri.010G195200.1.v4.1 1773 1552.17 305 3.50241 Potri.012G127500.1.v4.1 977 756.178 17303 407.852 ==> SRR6053287.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1321 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 1075 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 3 Potri.001G452600.v4.1 14 SRR6053287 completed mapping pipeline successfully